Chitinase from Bacillus licheniformis DSM13: Expression in Lactobacillus plantarum WCFS1 and biochemical characterisation

Protein Expression and Purification 81 (2012) 166–174

Contents lists available at SciVerse ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Chitinase from Bacillus licheniformis DSM13: Expression in Lactobacillus plantarum WCFS1 and biochemical characterisation Hoang Anh Nguyen a,b, Thu-Ha Nguyen a,c, Tien-Thanh Nguyen d, Clemens K. Peterbauer a, Geir Mathiesen e, Dietmar Haltrich a,⇑ a

Food Biotechnology Laboratory, Department of Food Sciences and Technology, BOKU – University of Natural Resources and Life Sciences Vienna, Austria Department of Biochemistry and Food Biotechnology, Hanoi University of Agriculture, Hanoi, Viet Nam Austrian Centre of Industrial Biotechnology, Graz, Austria d School of Biological and Food Technology, Hanoi University of Science and Technology, Hanoi, Viet Nam e Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, Ås, Norway b c

a r t i c l e

i n f o

Article history: Received 18 August 2011 and in revised form 10 October 2011 Available online 19 October 2011 Keywords: Chitinase Inducible protein expression Bacillus licheniformis DSM13 Lactobacillus plantarum WCFS1 Lactic acid bacteria

a b s t r a c t The gene chi, coding for a GH18 chitinase from the Gram-positive bacterium Bacillus licheniformis DSM13 (ATCC 14580), was cloned into the inducible lactobacillal expression vectors pSIP403 and pSIP409, derived from the sakacin-P operon of Lactobacillus sakei, and expressed in the host strain Lactobacillus plantarum WCFS1. Both the complete chi gene including the original bacillal signal sequence as well as the mature chi gene were compared, however, no extracellular chitinase activity was detected with any of the constructs. The chitinase gene was expressed intracellularly as an active enzyme with these different systems, at levels of approximately 5 mg of recombinant protein per litre of cultivation medium. Results obtained for the two different expression vectors that only differ in the promoter sequence were well comparable. To further verify the suitability of this expression system, recombinant, His-tagged chitinase Chi was purified from cell extracts of L. plantarum and characterised. The monomeric 65-kDa enzyme can degrade both chitin and chitosan, and shows properties that are very similar to those reported for the native chitinase purified from other B. licheniformis isolates. It shows good thermostability (half lives of stability of 20 and 8.4 days at 37 and 50 °C, respectively), and good stability in the pH range of 5–10. The results presented lead the way to overproduction of chitinase in a food-grade system, which is of interest for the food and feed industry. Ó 2011 Elsevier Inc. All rights reserved.

Introduction Chitin is a long-chain polymer composed of b-1,4-linked N-acetyl glucosamine (GlcNAc1) residues, and is the second most abundant polysaccharide in nature after cellulose [1–3]. The main sources of chitin are the shell wastes of shrimp, crab, lobster and squid, which are readily available in vast amounts in countries with strong aquaculture industry. This waste material causes environmental pollution if not processed and disposed of properly, but could serve as a valuable chitin source for the production of chitooligosaccharides from chitosan or N-acetyl-chito-oligosaccharides from chitin, both of which show useful characteristics such as prebiotic properties, indicating that these oligosaccharides are

⇑ Corresponding author. Fax: +43 1 47654 6199. E-mail address: [email protected] (D. Haltrich). Abbreviations used: LAB, lactic acid bacteria; GlcNAc, N-acetyl-D-glucosamine; (GlcNAc)2, N-diacetyl- chitobiose; (GlcNAc)3, N-triacetyl-chitotriose; pNP-(GlcNAc)2, 4-nitrophenyl N,N0 -diacetyl-b-D-chitobioside; IP; inducing peptide pheromone IP673. 1

1046-5928/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2011.10.005

used as carbon sources supporting the selective growth of beneficial intestinal bacteria, or antibacterial and antifungal properties, and thus can be potentially applied in food, agriculture and medicine [1,4–6]. Chitin and its soluble, partially deacetylated derivative chitosan are depolymerised by several enzymes acting on these polymeric substrates, namely chitinases (glycoside hydrolase families 18 and 19) as well as chitosanases (GH families 8, 46, 75 and 80), which both hydrolyse the glycosidic bonds between the sugars [7]. Chitinases as well as chitosanases can be employed in the formation of the above-mentioned chito-oligosaccharides [4,5]. An additional application of chitinases is as an antifungal agent. Chitinases depolymerise chitin, which is an essential structural component of fungal cell walls, and thereby cause cell lysis. This mechanism of combating fungi is utilised by plants, in which chitinase biosynthesis is induced in response to attacks by phytopathogenic fungi. In addition, several bacterial chitinase-producing strains are used as biocontrol agents of plant fungal diseases [7]. An elegant application based on these antifungal properties has been proposed by Brurberg et al. [8], who suggested the use of

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

chitinase against fungal infections in silage used for ruminant feeding, since some of the typical infection strains in silage such as Fusarium can produce mycotoxins. To this end they proposed the in situ formation of chitinase during the silage production through starter cultures that are used for inoculation and that are directly involved in the silage fermentation such as Lactobacillus plantarum. The complete genome of Bacillus licheniformis DSM 13 has been elucidated and was found to contain a number of genes coding for polysaccharide-degrading enzymes, among these two putative chitinase genes [9]. These chi and chiA genes code for two chitinases belonging to glycoside hydrolase family GH18, Chi (GenBank accession number AAU21943) and ChiA (GenBank accession number AAU21944), respectively. The chi gene encodes a protein of 598 amino acids while the chiA gene encodes a protein of 693 amino acids. The alignment of the deduced amino acid sequences of chi and chiA shows 30% identities between these two chitinases. Chitinases of B. licheniformis have been purified and characterised from different strains, e.g. the wild-type chitinase from B. licheniformis Mb-2 [10] or the chitinase ChiA from B. licheniformis DSM 8785 heterologously expressed in Escherichia coli [11,12]. This latter chitinase as well as several other chitinases of the Chi-type from B. licheniformis are highly identical to Chi from B. licheniformis DSM 13, for example the two enzymes from strain DSM 13 and DSM 8785 differ only by two amino acids (Supplementary material, Fig. 1). The aim of this research was to study the expression of a chitinase gene from B. licheniformis DSM13 in L. plantarum using different expression vectors of the pSIP series, which were constructed based on the sakacin-P operon of Lactobacillus sakei [13–15]. In addition the recombinant chitinase was characterised to some extent. Materials and methods Enzymes, substrates, and chemicals Restriction enzymes and T4 DNA ligase were purchased from Fermentas (Vilnius, Lithuania) and were used with buffers and protocols provided by the supplier together with the enzymes. The inducing peptide pheromone IP-673 (IP) was from the Molecular Biology Unit, University of Newcastle-upon-Tyne, UK. Chitin, chitosan, N-acetyl-D-glucosamine (GlcNAc), 4-nitrophenyl-N,N0 diacetyl-b-D-chitobioside (pNP-(GlcNAc)2) were purchased from Sigma (St. Louis, USA). Di-N-acetyl chitobiose (GlcNAc)2 and triN-acetyl chitotriose (GlcNAc)3 were obtained from Megazyme (Bray, Ireland). All other chemicals were of the highest grade available and were obtained from Sigma or Merck (Darmstadt, Germany).

167

Germany) was grown in M1 medium at 37 °C with shaking at 125 rpm, E. coli NEB 5a (New England Biolabs; Ipswich, MA, USA) was grown in Luria-Bertani (LB) medium with shaking at 125 rpm, and L. plantarum WCFS1 [17] (culture collection of the Norwegian University of Life Sciences, Ås, Norway) was grown in de Man–Rogosa–Sharp (MRS) medium in tightly capped bottles or tubes without shaking. When appropriate, erythromycin was added at final concentrations of 200 lg ml1 for E. coli and 5 lg ml1 for L. plantarum. DNA isolation and construction of plasmids Genomic DNA of B. licheniformis DSM13 was isolated as described previously by Nguyen et al. [18]. Primers for the PCR reactions (Table 2) were designed based on the sequence of chitinase Chi from B. licheniformis DSM13 with the GenBank accession number AAU21943 [9]. Two forward (native chi and mature chi, respectively) and two reverse primers (with and without a hexahistidine tag) were designed so that they contained NcoI and XhoI recogni0 tion sites at their 5 -end, respectively, which are compatible with the restriction sites of the pSIP403 and pSIP409 expression plasmids [15,19]. The conditions for a 25-ll standard PCR reaction (Phusion High-Fidelity PCR Kit; New England Biolabs) were 1 cycle at 98 °C for 3 min, 30 cycles at 98 °C for 10 s, 60 °C for 20 s and 72 °C for 40 s, with an additional extension step at 72 °C for 5 min for the final cycle. The amplified genes of interest were separated by agarose gel electrophoresis and purified with the Wizard SV Gel PCR Clean-Up system (Promega; Madison, WI, USA), digested by NcoI and XhoI, and ligated into the NcoI–XhoI fragments of the expression plasmids so that the operon encoding the native chitinase containing its signal peptide or mature chitinase without the signal sequence was translationally fused to the PsspA promoter in pSIP403 or the PsspQ promoter in pSIP409 [13,15], yielding pANH31, pANH32, pANH33, pANH34, pANH91, pANH92, pANH93, pANH94 (Table 1). All plasmids were transformed into E. coli NEB 5a chemical competent cells, positive colonies were detected by colony PCR, and correct constructs were confirmed by sequencing performed by a commercial provider. Expression of chitinase

Colloidal chitin was prepared according to the method of Roberts and Selitrennikoff [16] with some modifications. Briefly, 5 g of chitin from crab shells (C7170, Sigma Aldrich) was gradually added into 100 ml of cold concentrated HCl with gentle agitation on a magnetic stirrer at 4 °C for 18 h. The mixture was then added to 500 ml of ice-cold 96% ethanol and left for 24 h with rapid stirring at 4 °C. The precipitate was harvested by centrifugation at 8000g for 20 min at 4 °C and washed repeatedly with sterile distilled water until the pH reached 6. The colloidal chitin was kept at 4 °C until further use. Approximately 95 ± 4 g of colloidal chitin was obtained by this procedure from 5 g of chitin powder.

For expression of chitinase from B. licheniformis DSM13, plasmids were isolated from E. coli NEB 5a by the PureYield Plasmid Miniprep System (Promega), and then transformed into electrocompetent L. plantarum WCFS1 cells according to the method of Aukrust and Blom [20]. Overnight cultures of L. plantarum containing the selected expression plasmids were used to inoculate 100 ml of fresh MRS medium supplemented with 5 lg ml1 of erythromycin in capped bottles. Cultures were incubated at 37 °C until the OD600 reached 0.3. Induction was performed by the addition of IP to the cultures to a final concentration of 25 ng ml1. Samples were taken regularly, biomass was harvested by centrifugation (3500g, 20 min, 4 °C) and washed twice with 50 mM sodium phosphate buffer pH 6. The cell pellet was resuspended in the same buffer and disrupted using a sonicator (Sonics vibra-cell; Sonics and Materials, Newtown, CT) set at 25% power and cycle 60 for 3 min sonication time. Cell-free extracts were obtained by centrifugation (16,000g, 20 min, 4 °C), and chitinase activity of the cell-free extract was assayed by using pNP-(GlcNAc)2 as substrate.

Bacterial strains, plasmids and media

Production and purification of chitinase

The strains and plasmids used and constructed in this study are listed in Table 1. B. licheniformis DSM13 (ATCC 14580, German Collection of Microorganisms and Cell Cultures; Braunschweig,

An overnight culture of L. plantarum WCFS1 harbouring pANH94 was used to inoculate 2 l of fresh MRS medium containing 20 g l1 glucose and 5 lg ml1 of erythromycin in tightly capped

Preparation of colloidal chitin

168

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

Enzyme assays and protein determination

Table 1 Bacteria and plasmids used in this work. Strains and plasmids Strains Bacillus licheniformis DSM13 Escherichia coli NEB5a Lactobacillus plantarum WCFS1 Plasmids pSIP403

pSip409

pANH31 pANH32 pANH33 pANH34 pANH91 pANH92 pANH93 pANH94

Relevant characteristics and target

Source or reference

Source of chitinase gene chi

DSMZ

Cloning host

New England Biolabs [17]

Expression host

spp-based expression vector with promoter PsppA translationally fused to gusA as reporter gene spp-based expression vector with promoter PsppQ translationally fused to gusA as reporter gene pSIP403 with gusA replaced by mature chi pSIP403 with gusA replaced by mature chi carrying a C-terminal hexa-histidine tag pSIP403 with gusA replaced by native chi pSIP403 with gusA replaced by native chi carrying a C-terminal hexa-histidine tag pSIP409 with gusA replaced by mature chi pSIP409 with gusA replaced by mature chi carrying a C-terminal hexa-histidine tag pSIP409 with gusA replaced by native chi pSIP409 with gusA replaced by native chi carrying a C-terminal hexa-histidine tag

[15]

Enzyme assay using colloidal chitin as substrate The reaction mixture consisted of 250 ll of a 2%-solution of colloidal chitin in 50 mM sodium phosphate buffer pH 6 and 250 ll of appropriately diluted enzyme solution. After incubation for 30 min at 37 °C and 600 rpm on a Thermomixer Compact (Eppendorf; Hamburg, Germany), the reaction was stopped by heating at 100 °C for 10 min and then centrifuged at 10,000g for 5 min. The concentration of reducing sugars in the supernatant was determined based on the dinitrosalicylic acid (DNS) method using GlcNAc as the standard. One unit of chitinase activity is defined as the amount of enzyme releasing one lmol of reducing sugar per minute under the specified assay conditions. This assay was used as the standard enzyme assay for the characterisation of recombinant Chi.

[15]

This study This study This study This study This study This study

Enzyme assay using chitosan as substrate Reaction mixtures consisted of 175 ll of a 2%-solution of chitosan in 50 mM sodium phosphate buffer pH 6 and 175 ll of enzyme solution. After incubation for 30 min at 37 °C and 600 rpm in a thermomixer, the reaction was terminated by the addition of 375 ll DNS solution, heated at 100 °C for 15 min and then centrifuged at 10,000g for 5 min. Reducing sugars released in the supernatant were determined as described above.

This study This study

bottles. Protein production was induced by the addition of 25 ng IP per ml at OD600 0.3, and the culture was then grown to an OD600 of approximately 5. Cells were harvested by centrifugation (4000g, 20 min, 4 °C) and washed twice with 50 mM sodium phosphate buffer pH 6. If necessary, cells were stored at 20 °C for subsequent protein purification. Cells were suspended in 50 mM sodium phosphate buffer pH 6 and disrupted by quadruple passage through a French press (Amicon; Silver Spring, MD). Cell debris was removed by centrifugation (16,000g, 15 min, 4 °C) to obtain the crude cell extract, which was used for subsequent protein purification by immobilized metal affinity chromatography (IMAC) with a 10-ml BioRad Profinity IMAC Ni-Charged Resin column (Biorad; Vienna, Austria). The column was equilibrated with buffer (pH 6.5; Na2HPO4 20 mM; NaCl 0.5 mM; imidazole 20 mM). After the protein sample had been applied to the column it was washed with 3 column volumes (CV) of the same buffer, before proteins were eluted with a linear gradient of 20–500 mM imidazole in 10 CV starting buffer. Fractions containing the highest chitinase activity were pooled, desalted and concentrated using Amicon Ultra Centrifugal filter tubes (10 kDa cut-off; Millipore, Billeria, MA). The purified enzyme in sodium phosphate buffer pH 6.0 was stored at 4 °C for subsequent characterisation.

Enzyme assay using p-NP-chitobiose (pNP-(GlcNAc)2) as substrate The assay was performed in principle as described by Yamabhai et al. [11,12] with some modifications. The reaction was initiated by adding 20 ll of enzyme solution to 100 ll of 0.18 mM pNP-(GlcNAc)2 in 50 mM sodium phosphate buffer pH 6, and then the mixture was incubated for 30 min at 37 °C and 600 rpm using an Eppendorf thermomixer. After incubation the reaction was stopped by adding 480 ll of 0.5 M Na2CO3. p-Nitrophenol liberated during the reaction was determined spectrophotometrically at 405 nm. One unit of enzyme is defined as the amount of the enzyme releasing 1 lmol of p-nitrophenol per minute under the given conditions.

Protein determination The protein concentration was determined by using the Bradford method with bovine serum albumin as standard.

Characterisation of recombinant chitinase Gel electrophoresis Protein samples were analysed by sodium dodecyl sulphate(SDS–PAGE) and native polyacrylamide gel electrophoresis (native PAGE) performed on a PhastSystem unit (Amersham; Uppsala, Sweden) using precast polyacrylamide gels (PhastGel 8–25). Coomassie brilliant blue staining was used for the visualisation of the protein bands.

Table 2 Sequence of primers used for PCR amplification; restriction sites are underlined. Primer

Restriction enzyme

Sequence 50 ? 30

Reference sequence Accession number

FW1

NcoI

GCGGCCATGGCAAAAATCGTGTTGATC

AAU21943 AAU21943

FW2

NcoI

GCGGCCATGGATTCCGGAAAAAACTAT

RV1

XhoI

GGCGCTCGAGTTATTCGCAGCCTCCGAT

AAU21943

RV2

XhoI

TAATCTCGAGTTAGTGGTGGTGGTGGTGGTGTTCGCAGCCTCCGATCAG

AAU21943

FW1 and FW2 are forward primers for native chi and mature chi, respectively. RV1 and RV2 are reverse primers for both native chi and mature chi carrying no His-tag and a His-tag, respectively.

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

Gel permeation chromatography Gel permeation chromatography was performed on a Superose 12 column (16  1000 mm; GE Healthcare) using 20 mM phosphate buffer pH 6.5 containing 150 mM KCl and with the Sigma Gel Filtration Molecular Markers Kit with standard proteins of 12–200 kDa. Substrate specificity In order to investigate the substrate specificity of purified chitinase, Chi activity was assayed using 2% of colloidal chitin, 2% of soluble chitosan, 0.18 mM of pNP-(GlcNAc)2, and 10 mM of pNP-GlcNAc as the substrates under the same conditions as described above. Kinetic analysis Steady-state kinetic data for Chi and its substrate colloidal chitin were obtained by using the standard enzyme assay and varying the concentrations of colloidal chitin from 20 to 90 mg l1. Kinetic constants were calculated by non-linear least-square regression, fitting the data to the Henri–Michaelis–Menten equation using SigmaPlot (SPSS; Chicago, IL, USA). Effect of temperature and pH on activity and stability of purified enzyme The effect of temperature on chitinase activity was determined by using the standard assay with the temperature varied over the range of 20–80 °C. The temperature stability of Chi was studied by incubating enzyme samples in 50 mM sodium phosphate buffer pH 6.0 at various temperatures. At certain time intervals (up to 13 days), samples were withdrawn and the remaining enzyme activity was measured under standard assay conditions. In order to determine the pH optimum, chitinase activity was determined under standard assay conditions but varying the pHvalue from 4 to 10 using Britton–Robinson buffer (20 mM sodium citrate, 20 mM sodium phosphate, and 20 mM borate; 1 M NaOH was used to adjust to the respective pH of interest). To determine the pH stability of chitinase, enzyme samples were incubated at various pH values and 37 °C for 24 h, and the residual enzyme activity was measured under standard assay conditions. Effect of various metal cations on chitinase activity To study the effect of various cations on chitinase activity, enzyme samples were assayed with 2% colloidal chitin in 10 mM Bis-Tris buffer pH 6 in the presence of various cations in final concentrations of 1, 5, and 10 mM (chloride form) at 37 °C, 600 rpm for 30 min. The measured activities were compared with the activity of the enzyme samples without added cations under the same conditions. Analysis of hydrolysis products Chi-catalysed hydrolysis of di-N-acetyl chitobiose (GlcNAc)2 and tri-N-acetyl chitotriose (GlcNAc)3 was followed by incubating 100 ll of a 10 mM-solution of the respective substrate in 50 mM sodium phosphate buffer pH 6 with 4 mU of purified enzyme, using an Eppendorf thermomixer set at 37 °C and 600 rpm. Samples (10 ll) were withdrawn at various time points and chitinase was inactivated by incubation of these samples at 100 °C for 5 min. Hydrolysis of colloidal chitin was studied accordingly by using reaction mixtures (960 ll) containing 5% of colloidal chitin together with 80 mU of purified chitinase Chi. These mixtures were incubated at 37 °C and 50 °C, 600 rpm using an Eppendorf thermomixer. Samples (20 ll) were taken regularly and the enzyme inactivated as above. Products released by chitinase from these carbohydrate substrates were analysed using thin layer chromatography (TLC) based on method of Rauvolfová et al. [21]. Aliquots (1 ll) of the reaction mixtures were loaded onto high-performance

169

TLC silica plates (Kieselgel 60 F245, Merck) and run against a mobile phase of isopropanol/water/28% ammonia (7:2:1, v/v/v). Plates were dried, sprayed with 5% H2SO4 in ethanol, followed by baking at 220 °C in an oven for 10 min to develop the spots on the TLC plate. Hydrolysis products obtained from colloidal chitin were also analysed by high performance anion exchange chromatography with pulsed amperometric detection (HPAEC–PAD) as described previously by Splechtna et al. [22]. Results Plasmid construction and expression in L. plantarum WCFS1 The chi gene, coding for one chitinase from B. licheniformis DSM13, was successfully cloned into the lactobacillal pSIP expression vectors pSIP403 and pSIP409. Both the complete chi gene containing the native N-terminal signal sequence as well as the gene for the mature protein without its predicted signal sequence, both with and without C-terminal His tag, were translationally fused to either the PsppA (pSIP403) or PsppQ (pSIP409) promoter; the cleavage site of the signal peptide was predicted by SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/). This resulted in the eight expression plasmids pANH31, pANH32, pANH33, pANH34, pANH91, pANH92, pANH93, pANH94 (Table 1); ‘3’ denotes that chi is cloned into pSIP403, while ‘9’ denotes that pSIP409 was used. All plasmids were transformed into L. plantarum WCFS1, and expression of the introduced chitinase gene was studied at different time points after induction. Table 3 shows the specific chitinase activities and the volumetric enzymatic activities (units per litre of cultivation medium) in cell-free extracts sampled at different OD600, using pNP-(GlcNAc)2 as the assay substrate. In general, the expression plasmids based on pSIP409 gave better results, both with respect to specific and volumetric activities obtained. Highest volumetric activities were obtained in cell-free extracts from L. plantarum (pANH92) during its active growth phase (OD600 1.6– 4.7), 1.56 U l1, which then decreased somewhat when the cells entered the stationary phase. Highest specific activities were typically obtained during the late growth phase when the OD600 had reached values of 5. No extracellular chitinase activity was detected at any stages of the cultivation, neither for L. plantarum harbouring the plasmids with the native signal peptide or without it (data not shown). No significant differences in the expression of His-tagged and non-tagged Chi were observed, and therefore only the results for the affinity-tagged proteins are shown (Table 3). Production and purification of recombinant chitinase Chi L. plantarum WCFS1 harbouring pANH92 (pSIP409 derived, containing mature chi together with the His6 tag) was used for all subsequent studies, including purification and characterisation of the enzyme. Cells were harvested at OD600 4.7 from a 2-l culture after induction with 25 ng ml1 IP, disrupted by using a French press and clarified by centrifugation. Recombinant, His-tagged chitinase was purified from the crude, soluble cell extract thus obtained by using immobilised metal affinity chromatography (IMAC). This resulted in an electrophoretically homogenous chitinase preparation of 1.38 U mg1 when using 2% colloidal chitin as substrate. The total yield of purified recChi from a 2-l cultivation typically was 10.2 U (corresponding to 7.4 mg of protein) obtained with a recovery of 69% (Table 4). Chi was purified 55-fold by a single IMAC step, which indicates that approximately 2% of the soluble intracellular protein in L. plantarum was in fact Chi. The purified, His-tagged chitinase showed one single band each on SDS–PAGE (Fig. 1A) and native PAGE (Fig. 1B). Gel permeation chromatography and comparison with standard proteins gave a molecular mass of

170

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

Table 3 Chitinase activity in cell-free extracts of L. plantarum WCFS1 harbouring various plasmids for over-expression of B. licheniformis Chi. Protein expression was induced by the addition of 25 ng ml1 IP, added at OD600 0.3. Chitinase activity was measured using pNP-(GlcNAc)2 as substrate. The values given are the means of at least two independent experiments. Standard deviations were always less than 10% of the mean. Expression plasmid

OD600

Specific activity (102 U mg1)

Volumetric activity (U l1)

pANH34 (native chi)

1.6 4.7 6.0 7.3

1.2 1.6 1.6 1.6

0.82 0.85 0.67 0.60

pANH32 (mature chi)

1.6 4.7 6.0 7.3

1.2 1.6 1.6 1.3

0.82 0.86 0.70 0.49

pANH94 (native chi)

1.6 4.7 6.0 7.3

2.1 2.6 2.6 1.8

1.02 1.22 0.80 0.70

pANH92 (mature chi)

1.6 4.7 6.0 7.3

2.3 2.8 1.4 1.8

1.56 1.34 0.64 0.81

Table 4 Purification of recombinant chitinase Chi from B. licheniformis and overexpressed in L. plantarum WCFS1 carrying pANH92. A total of 2 l of culture broth was used for the purification, and 2% colloidal chitin was used as substrate for the enzyme assay. Purification steps

Total activity (U)

Total protein (mg)

Specific activity (U mg1)

Recovery (%)

Crude extract Purified enzyme after IMAC

14.8 10.2

600 7.4

0.025 1.38

– 69

(GlcNAc), and with the exception of the last substrate, which mimics a disaccharide, all substrates were degraded well, albeit with varying activities. Based on the specific activities determined, colloidal chitin is the best substrate with a specific activity of 1.38 U mg1, while the specific activities were 0.46 U mg1 for chitosan (both at a concentration of 20 mg ml1) and 0.61 U mg1 for pNP-(GlcNAc)2 at 0.18 mM. pNP-(GlcNAc) gave a specific activity of only 0.02 U mg1 when using this substrate in a concentration of 10 mM. The kinetic constants of Chi were subsequently determined for colloidal chitin as substrate, the concentration of which was varied from 5 to 90 mg ml1. The Km and vmax values were calculated using non-linear regression analysis, and the kcat value was calculated based on the vmax value and using a molecular mass of 65 kDa for the enzyme. Km, vmax and kcat were 28 ± 3 mg ml1, 4.8 ± 0.9 lmol min1 mg1 and 5.2 ± 0.9 s1, respectively.

Effect of temperature and pH on activity and stability of purified enzyme The relative activity of purified Chi was highest in the temperature range of 45–55 °C for the standard 30-min enzyme assay with 2% colloidal chitin used as substrate (Fig. 2A). However, at temperatures above 55 °C the relative activity decreased sharply. The enzyme was very stable at temperatures of up to 50 °C. After 7 days of incubation at 37 and 50 °C, the remaining enzyme

Fig. 1. SDS–PAGE and NATIVE–PAGE analysis of purified recombinant chitinase Chi. (A) SDS–PAGE: lane 1, crude extract of non-induced cells; lane 2, crude extract of induced cell; lane 3, purified enzyme; lane 4, marker proteins (Precision Plus Protein standard, Biorad). (B) Native PAGE: lane 1, purified enzyme; lane 2, high molecular mass protein ladder (GE Healthcare).

66.5 kDa, demonstrating that recChi is a monomeric protein with a molecular mass of 65 kDa, which corresponds well to the theoretical mass of mature Chi at 63.5 kDa. Characterisation of recombinant chitinase Substrate specificity and kinetic analysis The activity of recChi was tested with various known chitinase substrates, i.e., colloidal chitin, chitosan, pNP-(GlcNAc)2 and pNP-

Fig. 2. Effect of temperature on activity (A) and stability (B) of recombinant chitinase Chi from B. licheniformis. Temperature stability was tested at 37 °C (filled circles) and 50 °C (filled triangles).

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

171

quently we followed the Chi-catalysed hydrolysis of colloidal chitin over time by using HPLC for analysis of the reaction products, albeit with higher enzyme loading. Typical results when using 5% colloidal chitin (corresponding to approximately 2.6 g l1 of solubilised chitin) are shown in Fig. 5 for the reaction temperatures of 37 °C and 50 °C. Colloidal chitin was rapidly degraded to the main hydrolysis product chitobiose, the concentration of which reached a maximum of approximately 1.4 g l1. Chitobiose was then further hydrolysed to GlcNAc as the reaction advanced with prolonged time. Chitotriose could only be detected as a minor reaction product (Fig. 5).

Discussion

Fig. 3. Effect of pH on activity (closed symbols) and stability (open symbols) of recombinant chitinase Chi from B. licheniformis. Stability is expressed as relative activity compared to the maximal activity obtained at the optimal pH value or residual activity after incubation of ChiA at various pH values for 24 h at 37 °C with 100% referring to the initial activity at t = 0.

activity was still 82% and 58%, respectively (Fig. 2B), and the calculated half-life times of stability were 20 and 8.4 days at these two temperatures, respectively. Chi showed rather narrow pH/activity dependence and the pH optimum of chitinase activity was 7.5 (Fig. 3). Chi was inactivated at low pH values (
Table 5 Effect of various metal ions on the activity of recombinant chitinase Chi from B. licheniformis. Activities (mean ± standard deviation) relative to those without any addition of metal ions are given. Metal ion

Control Na+ K+ Ca2+ Mn2+ Mg2+ Cu2+ Zn2+ Co2+

Relative activity (%) 1 mM

5 mM

10 mM

100 98 ± 3 101 ± 4 126 ± 2 110 ± 2 86 ± 1 21 ± 0 5.5 ± 0.1 64 ± 2

100 101 ± 1 99 ± 3 129 ± 5 112 ± 2 18 ± 0 9.0 ± 0.1 5.4 ± 0.1 60 ± 1

100 94 ± 1 109 ± 2 117 ± 0 79 ± 3 8.6 ± 0.1 8.5 ± 0.1 >0.2 63 ± 3

Gram-positive bacteria are receiving increased attention for recombinant protein production as an alternative to the dominant organism in this field, E. coli, as this organism is not the best choice for every use [23]. For food-related applications and the production of food-relevant enzymes, expression systems based on food-grade microorganisms, which have the ‘generally recognised as safe’ status, are of significant interest [24,25]. Lactic acid bacteria (LAB) have the GRAS status and are widely used in industrial fermentations. In addition, significant progress has been made pertaining to the development of novel genetic engineering tools and molecular characterisation of these organisms within the last years. Therefore, LAB are highly attractive as cell factories for the production of recombinant enzymes and proteins in addition to delivery vehicles for proteins such as antibody fragments or antigens [26]. Several inducible and controlled expressions systems for LAB have been developed, of which the nisin-controlled gene expression system (NICE), derived from a two-component bacteriocin system in Lactococcus lactis, is probably the best known [27,28]. In the present study we exploited a bacteriocin-based expression system for lactobacilli, which has been developed using elements of the sakacin-P operon of L. sakei [14,15,19], and L. plantarum WCFS1 as host for the expression of the chitinase gene chi derived from B. licheniformis. This gene, both in its native (including the predicted signal sequence) and its mature form, was inserted into two different expression vectors, pSIP403 and pSIP409, differing only in the promoters PsppA and PsppQ. The expression yields were higher when using the pSIP409-based vectors, however, the differences in chitinase activity obtained with these two promoters (Table 3) were not that pronounced. This is in contrast to recent results, where the PsppQ promoter led to considerably higher levels of b-glucuronidase (GusA) from E. coli and aminopeptidase (PepN) from Lc. lactis. It has been noted in that study that the performance of this expression system strongly depends on the gene that is being expressed [15], and this is again confirmed here. L. plantarum has previously been used as secretion vector of heterologous proteins [29,30], and extracellular production of an enzyme or a protein can be of advantage, e.g. for more straightforward purification. Hence, we attempted to secrete Chi by cloning the chi gene with the native signal peptide (SP) intact. However, none of the L. plantarum systems with these constructs containing the full-length chi gene resulted in detectable extracellular chitinase activity, indicating that no secretion of Chi had occurred. In another attempt to secrete Chi the native SP was replaced with SPs derived from secreted proteins of L. plantarum. The functionality of these selected signal peptides has recently been shown by using the pSIP vectors and nuclease NucA and amylase AmyA as target protein in L. plantarum [29,30]. In the present study we replaced the target gene in three vectors containing L. plantarum signal peptides, pLp_0373sAmyA, pLp_2145sAmyA and pLp_3050sAmyA [29,30], with mature chi. However, no extracellular chitinase activity was detected with these constructs (results

172

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

Fig. 4. Thin layer chromatography showing colloidal chitin hydrolysis products of purified recombinant chitinase using 20% colloidal chitin (A), 10 mM triacetyl chitotriose (B) and 10 mM diacetyl chitobiose (C) as substrates. M: a standard mixture of GlcNAc, (GlcNAc)2 and (GlcNAc)3.

Fig. 5. Analysis of reaction products formed during hydrolysis of 5% colloidal chitin by recombinant chitinase Chi from B. licheniformis. High performance anion exchange chromatography with pulsed amperometric detection was used for analysis of reaction products.

not shown). A possible explanation for the failure to secrete Chi could be the size of Chi, 65 kDa, which is larger than the two reporter proteins mentioned above, and hence the size could result in reduced secretion efficiency of Chi. Furthermore, it has been shown that secretion efficiency depends on an optimal combination of signal peptide and target protein [29], and these combinations of Chi with the lactobacillal signal peptides used in this study could be unsuited for secretion. In addition, the overall production of Chi in L. plantarum was relatively low (see below, Table 3), and if the

secretion efficiency is low, no Chi will be detected in the supernatant. Since we did not success in secretion of Chi, the intracellular chitinase activity was measured (Table 3). The volumetric yield of active, recombinant chitinase was rather low, especially when compared to some of our previous work, in which we studied the expression of several lactobacillal b-galactosidases, using the same expression systems and achieving yields of 10–85 mg l1 of recombinant protein [31], and considering the fact that the gene of interest is derived from a related Gram-positive bacterium. Typically, we obtained approximately 5 mg of soluble Chi per litre fermentation medium in larger-scale (2-l) cultivations. Recently, a closely related chi gene from B. licheniformis DSM 8785 was expressed in E. coli using a T7 RNA polymerase-based expression system [11,12]. The authors obtained approximately 20 mg of purified Chi per litre when using this expression system, which is also relatively modest for an E. coli expression system. Gene expression and the effectiveness of a given expression system for a particular gene are hard to predict. These are affected by a number of factors, including mRNA stability, codon usage, protein folding efficiency, or a certain negative effect of the expression product on the host cell, amongst others [15,31]. Effectiveness depends on subtle properties that are defined by the particular combination of the promoter, the gene of interest and the expression host. Apparently, the combination of the lactobacillal expression system (but also the T7 RNA polymerase-based E. coli system) and the bacillal chi gene are not optimal or well compatible. It should, however, be mentioned that no optimisation of the expression, e.g. by optimising culture/induction conditions, was attempted in this study. Purification of the recombinant, His-tagged chitinase from L. plantarum was straightforward, and even though recChi was only forming approximately 2% of the total intracellular soluble protein, it could be purified in one single metal-affinity chromatography

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

step to electrophoretic homogeneity in high yields. The yield of 69% recovery stems from very strict pooling of only those fractions that showed a very high specific activity; if purity is not the main issue then higher yields of (partially) purified chitinase Chi can be obtained by using this approach. The properties of recombinant Chi produced in L. plantarum, e.g., temperature/pH dependence, stability or substrate specificity, are essentially similar to those reported for a wild-type chitinase isolated from B. licheniformis Mb-2 [10] or a chitinase from B. licheniformis DSM8785 heterologously expressed in E. coli [11], indicating that L. plantarum is a suitable expression host for obtaining active chitinase. The enzyme rapidly hydrolyses colloidal chitin to chitobiose (GlcNAc)2 as the main product during the initial phase of hydrolysis (Figs. 4A and 5). Chitobiose was, however, only transiently formed, and upon prolonged incubation with increased enzyme loads, chitobiose was further cleaved into N-acetyl glucosamine, even though chitobiose is only a poor substrate as is evident from the hydrolysis experiment using pure chitobiose, where reaction with that substrate was negligible under the reaction conditions selected (lower enzyme loading, shorter reaction time). In conclusion, we showed the inducible production of a recombinant chitinase in L. plantarum using expression vectors based on bacteriocin operons from L. sakei. The chitinase could be isolated easily with high purity from the Lactobacillus vector, indicating that lactobacilli can be very suitable expression hosts when enzyme production/purification is intended. These vectors can be easily adapted for specific needs, such as constitutive formation of the recombinant protein through introduction of a suitable promoter or the production of food-grade enzymes, by exchanging parts of the vector including the selection marker, which was still based on antibiotic resistance in the vectors used in this study. Recently, we showed that a complementation approach making use of the alanine racemase gene can be successfully applied to obtain an antibiotic-free selectable system [32]. Lactobacilli and LAB are still seldom used for enzyme production, even though they may have significant advantages of alternative expression systems, most prominently E. coli. In addition to food-grade production of an enzyme [25], Lactobacillus can be used as system for the formation of heterologous enzymes or proteins that are difficult to express in E. coli, since inclusion body formation is not a typical problem for these hosts. Several examples showed that LAB can indeed be used for the production of soluble, active enzymes that were mainly obtained in insoluble form in E. coli [33,34]. Acknowledgments The authors are grateful to the Austrian Government and ASEAUninet for financial support (Technology Grant Southeast Asia) to HAN. This work was supported by the Federal Ministry of Economy, Family and Youth (BMWFJ), the Federal Ministry of Traffic, Innovation and Technology (bmvit), the Styrian Business Promotion Agency SFG, the Standortagentur Tirol and ZIT – Technology Agency of the City of Vienna through the COMETFunding Program managed by the Austrian Research Promotion Agency FFG. Appendix Supplementary. material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.pep.2011.10.005. References [1] F. Khoushab, M. Yamabhai, Chitin research revisited, Mar. Drugs 8 (2010) 1988–2012.

173

[2] K. Kurita, Chitin and chitosan: functional biopolymers from marine crustaceans, Mar. Biotechnol. 8 (2006) 203–226. [3] Y.S. Lee, I.H. Park, J.S. Yoo, S.Y. Chung, Y.C. Lee, Y.S. Cho, S.C. Ahn, C.M. Kim, Y.L. Choi, Cloning, purification, and characterization of chitinase from Bacillus sp. DAU101, Bioresour. Technol. 98 (2007) 2734–2741. [4] B.B. Aam, E.B. Heggset, A.L. Norberg, M. Sørlie, K.M. Varum, V.G. Eijsink, Production of chitooligosaccharides and their potential applications in medicine, Mar. Drugs 8 (2010) 1482–1517. [5] D. Bhattacharya, A. Nagpure, R.K. Gupta, Bacterial chitinases: properties and potential, Crit. Rev. Biotechnol. 27 (2007) 21–28. [6] H.C. Chen, C.C. Chang, W.J. Mau, L.S. Yen, Evaluation of Nacetylchitooligosaccharides as the main carbon sources for the growth of intestinal bacteria, FEMS Microbiol. Lett. 209 (2002) 53–56. [7] V. Eijsink, I. Hoell, G. Vaaje-Kolstada, Structure and function of enzymes acting on chitin and chitosan, Biotechnol. Genet. Eng. Rev. 27 (2010) 331–366. [8] M.B. Brurberg, A.J. Haandrikman, K.J. Leenhouts, G. Venema, I.F. Nes, Expression of a chitinase gene from Serratia marcescens in Lactococcus lactis and Lactobacillus plantarum, Appl. Microbiol. Biotechnol. 42 (1994) 108–115. [9] B. Veith, C. Herzberg, S. Steckel, J. Feesche, K.H. Maurer, P. Ehrenreich, S. Baumer, A. Henne, H. Liesegang, R. Merkl, A. Ehrenreich, G. Gottschalk, The complete genome sequence of Bacillus licheniformis DSM13, an organism with great industrial potential, J. Mol. Microbiol. Biotechnol. 7 (2004) 204–211. [10] A. Toharisman, M.T. Suhartono, M. Spindler-Barth, J.K. Hwang, Y.R. Pyun, Purification and characterization of a thermostable chitinase from Bacillus licheniformis Mb-2, World J. Microb. Biotechnol. 21 (2005) 733–738. [11] C. Songsiriritthigul, S. Lapboonrueng, P. Pechsrichuang, P. Pesatcha, M. Yamabhai, Expression and characterization of Bacillus licheniformis chitinase (ChiA), suitable for bioconversion of chitin waste, Bioresour. Technol. 101 (2010) 4096–4103. [12] M. Yamabhai, S. Emrat, S. Sukasem, P. Pesatcha, N. Jaruseranee, B. Buranabanyat, Secretion of recombinant Bacillus hydrolytic enzymes using Escherichia coli expression systems, J. Biotechnol. 133 (2008) 50–57. [13] G. Mathiesen, K. Huehne, L. Kroeckel, L. Axelsson, V.G.H. Eijsink, Characterization of a new bacteriocin operon in sakacin P-producing Lactobacillus sakei, showing strong translational coupling between the bacteriocin and immunity genes, Appl. Environ. Microbiol. 71 (2005) 3565– 3574. [14] G. Mathiesen, E. Sørvig, J. Blatny, K. Naterstad, L. Axelsson, V.G.H. Eijsink, Highlevel gene expression in Lactobacillus plantarum using a pheromone-regulated bacteriocin promoter, Lett. Appl. Microbiol. 39 (2004) 137–143. [15] E. Sørvig, G. Mathiesen, K. Naterstad, V.G.H. Eijsink, L. Axelsson, High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors, Microbiology 151 (2005) 2439–2449. [16] W.K. Roberts, C.P. Selitrennikoff, Plant and bacterial chitinases differ in antifungal activity, J. Gen. Microbiol. 134 (1988) 169–176. [17] M. Kleerebezem, J. Boekhorst, R. van Kranenburg, D. Molenaar, O.P. Kuipers, R. Leer, R. Tarchini, S.A. Peters, H.M. Sandbrink, M.W. Fiers, W. Stiekema, R.M. Lankhorst, P.A. Bron, S.M. Hoffer, M.N. Groot, R. Kerkhoven, M. de Vries, B. Ursing, W.M. de Vos, R.J. Siezen, Complete genome sequence of Lactobacillus plantarum WCFS1, Proc. Natl. Acad. Sci. 100 (2003) 1990–1995. [18] T.-H. Nguyen, B. Splechtna, M. Yamabhai, D. Haltrich, C. Peterbauer, Cloning and expression of the -galactosidase genes from Lactobacillus reuteri in Escherichia coli, J. Biotechnol. 129 (2007) 581–591. [19] E. Sørvig, S. Gronqvist, K. Naterstad, G. Mathiesen, V.G.H. Eijsink, L. Axelsson, Construction of vectors for inducible gene expression in Lactobacillus sakei and L. plantarum, FEMS Microbiol. Lett. 229 (2003) 119–126. [20] T. Aukrust, H. Blom, Transformation of Lactobacillus strains used in meat and vegetable fermentations, Food Res. Int. 25 (1992) 253–261. [21] J. Rauvolfová, M. Kuzma, L. Weignerová, P. Fialová, V. Prikrylová, A. Pisvejcová, M. Macková, V. Kren, b-N-acetylhexosaminidase-catalysed synthesis of nonreducing oligosaccharides, J. Mol. Catal. B Enzym. 29 (2004) 233–239. [22] B. Splechtna, T.-H. Nguyen, M. Steinböck, K.D. Kulbe, W. Lorenz, D. Haltrich, Production of prebiotic galacto-oligosaccharides from lactose using bgalactosidases from Lactobacillus reuteri, J. Agric. Food Chem. 54 (2006) 4999–5006. [23] H. Billman-Jacobe, Expression in bacteria other than Escherichia coli, Curr. Opin. Biotechnol. 7 (1996) 500–504. [24] W.N. Konings, J. Kok, O.P. Kuipers, B. Poolman, Lactic acid bacteria: the bugs of the new millennium, Curr. Opin. Biotechnol. 3 (2000) 276–282. [25] C. Peterbauer, T. Maischberger, D. Haltrich, Food-grade gene expression in lactic acid bacteria, Biotechnol. J. 6 (2011) 1147–1161. [26] D.B. Diep, G. Mathiesen, V.G.H. Eijsink, I.F. Nes, Use of lactobacilli and their pheromone-based regulatory mechanism in gene expression and drug delivery, Curr. Pharm. Biotechnol. 10 (2009) 62–73. [27] I. Mierau, M. Kleerebezem, 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis, Appl. Microbiol. Biotechnol. 68 (2005) 705– 717. [28] X.X. Zhou, W.F. Li, G.X. Ma, Y.J. Pan, The nisin-controlled gene expression system: construction, application and improvements, Biotechnol. Adv. 24 (2006) 285–295. [29] G. Mathiesen, A. Sveen, M.B. Brurberg, L. Fredriksen, L. Axelsson, V.G.H. Eijsink, Genome-wide analysis of signal peptide functionality in Lactobacillus plantarum WCFS1, BMC Genom. 10 (2009) 425. [30] G. Mathiesen, A. Sveen, J.C. Piard, L. Axelsson, V.G.H. Eijsink, Heterologous protein secretion by Lactobacillus plantarum using homologous signal peptides, J. Appl. Microbiol. 105 (2008) 215–226.

174

H.A. Nguyen et al. / Protein Expression and Purification 81 (2012) 166–174

[31] E. Halbmayr, G. Mathiesen, T.-H. Nguyen, T. Maischberger, C.K. Peterbauer, V.G.H. Eijsink, D. Haltrich, High-level expression of recombinant bgalactosidases in Lactobacillus plantarum and Lactobacillus sakei using a Sakacin P-based expression system, J. Agric. Food Chem. 56 (2008) 4710–4719. [32] T.T. Nguyen, G. Mathiesen, L. Fredriksen, R. Kittl, T.H. Nguyen, V.G.H. Eijsink, D. Haltrich, C.K. Peterbauer, A food-grade system for inducible gene expression in Lactobacillus plantarum using an alanine racemase-encoding selection marker, J. Agric. Food Chem. 59 (2011) 5617–5624.

[33] A. Frelet-Barrand, S. Boutigny, L. Moyet, A. Deniaud, D. Seigneurin-Berny, D. Salvi, F. Bernaudat, P. Richaud, E. Pebay-Peyroula, J. Joyard, N. Rolland, Lactococcus lactis, an alternative system for functional expression of peripheral and intrinsic Arabidopsis membrane proteins, PLoS One 5 (2010) e8746. [34] D. Straume, L. Axelsson, I.F. Nes, D.B. Diep, Improved expression and purification of the correctly folded response regulator PlnC from lactobacilli, J. Microbiol. Meth. 67 (2006) 193–201.