Chloramphenicol resistance transposable element TnSs1 of Streptococcus suis, a transposon flanked by IS6-family elements

Plasmid 49 (2003) 143–151 www.elsevier.com/locate/yplas

Chloramphenicol resistance transposable element TnSs1 of Streptococcus suis, a transposon flanked by IS6-family elements Daisuke Takamatsu, Makoto Osaki, and Tsutomu Sekizaki* Molecular Bacteriology Section, National Institute of Animal Health, 3-1-5 Kannondai, Tsukuba, Ibaraki 305-0856, Japan Received 24 June 2002, revised 5 September 2002

Abstract A new transposon, designated TnSs1, which contains a chloramphenicol acetyltransferase gene flanked by direct repeats of an IS6-family element was found in a field isolate of Streptococcus suis. Polymerase chain reaction and hybridization analyses indicated that another field isolate carried the same transposon in a different location on the chromosome. A transposition assay done with a thermosensitive suicide vector showed that, among the seven TnSs1 mutants tested in this study, six formed a cointegrate between the S. suis genome and the vector with the generation of the third copy of the insertion sequence element, and one harbored one copy of TnSs1 on the chromosome as a result of a subsequent resolution step. On transposition, TnSs1 duplicated an 8-bp sequence at the target site. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Streptococcus suis; Chloramphenicol acetyltransferase; Transposon; IS6-family element; TnSs1

1. Introduction Streptococcus suis is a Gram-positive bacterium of increasing importance in pig production throughout the world (Staats et al., 1997). It is also recognized as an important human pathogen that causes meningitis (Arends and Zanen, 1988). Although conjugative transfer of erythromycin, tetracycline, or kanamycin resistance that is possibly mediated by a conjugative transposon has been reported in S. suis (Stuart et al., 1992; Wasteson

* Corresponding author. Fax: +81-298-38-7907. E-mail address: sekizaki@affrc.go.jp (T. Sekizaki).

et al., 1994), genetic organization of any antibiotic resistance transposon isolated from S. suis has not thus far been reported. The antimicrobial susceptibility of S. suis isolates collected from diseased and healthy pigs so far examined indicated frequent occurrences of resistance to tetracycline and aminoglycosides but very rare incidence of chloramphenicol resistance ðCmr Þ1 (Kataoka et al., 2000). Among the S. suis field isolates from diseased pigs 1

Abbreviations used: PCR, polymerase chain reaction; IS, insertion sequence; Ts, thermosensitive; IR, terminal inverted repeat sequence; MIC, minimum inhibitory concentration; ORF, open reading frame; Cmr , chloramphenicol-resistant; Spcr , spectinomycin-resistant; Spcs , spectinomycin-susceptible.

0147-619X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. doi:10.1016/S0147-619X(02)00149-X

144

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

in Japan, we found two Cmr isolates. In this study, we examined the genetic regions conferring Cmr and found a new transposon in the isolates.

2. Materials and methods 2.1. Bacterial strains, plasmids, and culture conditions The bacterial strains and plasmids used in this study are listed in Table 1. S. suis strains were grown in Todd-Hewitt (Difco Laboratories, Becton Dickinson, Sparks, MD) broth or agar medium supplemented with 2% yeast extract (THY). Escherichia coli strain was cultured in LB (Difco Laboratories) broth or agar. If required, antibiotics were added to the media as described previously (Takamatsu et al., 2001a). The minimum inhibitory concentration (MIC) of Cm against S. suis strains was determined on Muller–Hinton agar medium (Difco Laboratories) supplemented with 5% sheep blood by the agar dilution method in accordance with the recommendations of the National Committee for Clinical Laboratory Standards (1997). 2.2. DNA cloning and PCR conditions Unless otherwise mentioned, the DNA manipulations were done as described previously (Osaki

et al., 2000; Takamatsu et al., 2001a). Primers used in this study are listed in Table 2. The conditions for polymerase chain reaction (PCR) and inverse PCR were essentially the same as described previously (Ochman et al., 1988; Takamatsu et al., 2001a). Genomic Southern hybridization was performed as described previously (Sekizaki et al., 2001), except that hybridization was carried out at 68 °C. Chloramphenicol acetyltransferase (cat) and transposase (tnp) probes were obtained by PCR amplification from the genomic DNA of S. suis 194 with primers CatU plus CatL and Tnp1 plus Tnp2, respectively (Table 2). A genomic library of S. suis 194 was constructed in E. coli DH5a with pUC19 as described previously (Osaki et al., 2002). Electrotransformation of S. suis and E. coli was carried out as described previously (Sambrook et al., 1989; Takamatsu et al., 2001a). 2.3. Nucleotide sequence analysis Nucleotide sequences were determined and analyzed as described previously (Osaki et al., 2000). 2.4. Construction of pTNSS1 A 4.6-kb HindIII fragment containing the TnSs1 of S. suis 194 was ligated with HindIII-digested thermosensitive (Ts) suicide vector pSET4s (Takamatsu et al., 2001b). E. coli DH5a was transformed with the ligation mixture and Cmr –

Table 1 Bacterial strains and plasmids used in this study Strain or plasmid

Relevant features

Source or reference

S. suis strain 194 195 NCTC10234

Field isolate, Cmr Field isolate, Cmr Type strain, Cms

Takamatsu et al. (2002)a Takamatsu et al. (2002)a NCTCb

E. coli strain DH5a

Host for plasmids used in this study

Hanahan (1985)

Plasmid pUC19 pSET4s pTNSS1

E. coli plasmid vector, Apr Thermosensitive suicide vector, Spcr pSET4s with TnSs1 region of strain 194.

Yanisch-Perron et al. (1985) Takamatsu et al. (2001b) This study

Note. Cmr , chloramphenicol resistance; Cms , chloramphenicol susceptibility; Apr , ampicillin resistance; and Spcr , spectinomycin resistance. a Strains 194 and 195 were isolated from different pigs of the same farm in the same year in Japan. b National Collection of Type Cultures, Central Public Health Laboratory, London, UK.

D. Takamatsu et al. / Plasmid 49 (2003) 143–151 Table 2 Oligonucleotide primers used in this study Primer

Sequence (50 –30 )

CmR1 CmR2 CmR3 CmR4 CmR5 CmR6 CmR7 CmR8

TCTCTTCGGGTTTTCGGTCT CTGCTGTAATAATGGGTAGA GTGATGGTTATCATGCAGGA CGTTTCATCCATTTTCCATG ACCAGACGCATTATTGCCAA TACTCGGTCATATACAAGAG TGACATCGGCTTTGCTGTAA TTCCGGATCCTTCTACGCCTTT ATAAGTAC TATCGAAGTAGTTTGGGAGA TTATCGGCAAGAAGTTAGGA TTACCTATGTTTCTCCTAGACTGTT GCTTGTAATCTTGGTATTGA AGGAGGCTGATTTGTCTGCT AGAGGTTTCTGGCGTGTGAT TGCTTCTTTGCCTTGCTCCA AAGCGGCAGAGCGTGCGAAA TTGGCACAAG CTGTAAAGATAGCGGTAAAT CCGAAACATAAAACAAGAAG CGTGGGCTACTATCTTCGTT CTTGATTTCAGTACAGACCG

CmR9 CmR10 CmR12 CmR15 CmR17 CmR18 CmR19 CmR21 CatU CatL Tnp1 Tnp2

Spcr transformants that harbored the recombinant plasmid containing the Cmr determinant were obtained. One was designated pTNSS1. 2.5. Nucleotide sequence accession numbers Nucleotide sequence data of the TnSs1 region in S. suis 194 have been deposited in the DDBJ/ EMBL/GenBank database under the Accession No. AB080798.

3. Results and discussion 3.1. Cloning and characterization of the Cmr gene region The MIC of Cm against S. suis 194 was 16 lg/ ml. For cloning of the Cmr determinant region, a genomic library of S. suis 194 was screened using Cm. Three clones containing genomic fragments of 1.6, 2.0, and 2.4 kb, which shared a common DNA region, were obtained and the fragments were sequenced. On the basis of the sequence, a set of

145

primers, CmR2 and CmR3 (Table 2), was designed and used for inverse PCR to amplify the flanking region. A DNA fragment amplified from HindIIIdigested and self-ligated genomic DNA of S. suis 194 was directly sequenced. Subsequently, another set of primers, CmR9 and CmR10 (Table 2), was designed for inverse PCR to amplify the region further downstream. Using XbaI-digested and selfligated genomic DNA of S. suis 194 as a template, the DNA fragment was amplified and sequenced directly. The entire sequence determined was 5656 bp and it contained seven putative open reading frames (ORFs), as shown in Fig. 1A. The results of the database analysis of the deduced amino acid sequences are summarized in Table 3. One of the deduced amino acid sequences showed 95% identity with a Cm acetyltransferase in plasmid pC194 (Byeon and Weisblum, 1984), and the gene was designated cat. The cat in S. suis 194 was flanked by two directly repeated 809-bp insertion sequence (IS)-like elements, designated IS214L and IS214R, which were completely identical to IS214-I of Lactococcus lactis plasmid pK214 (X92946) (Perreten et al., 2001; Teuber et al., 1999), and, therefore, the cat gene and the two ISlike elements formed a transposon. IS214 L and IS214 R possessed 23-bp terminal inverted repeat sequences (IRs) and carried a single ORF. The putative translational products and IRs showed significant similarity to the transposases and IRs, respectively, of the IS6 family. Although many Cmr transposons have hitherto been found (Alton and Vapnek, 1979; Iyobe et al., 1981; Parent and Roy, 1992; Terakado et al., 1981), no transposon consisting of a cat gene sandwiched between two directly repeated IS6-family elements has been reported. The transposon found in S. suis 194 was therefore judged to be a new transposon and designated TnSs1. Since each component of TnSs1 was highly homologous to IS-like elements or antibiotic resistance genes found on other antibiotic resistance plasmids, TnSs1 may have been generated by repetitive integration and recombination events that occurred in their replicons. Members of the IS6 family generate 8-bp duplications of the target sequence on insertion (Mahillon and Chandler, 1998). TnSs1, however, was not flanked by direct repeat sequences.

146

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

Fig. 1. Genetic map of the TnSs1 region of S. suis 194 (A) and schematic representations of the results of PCR analysis of three strains (B). Positions of primers used relative to the genetic map are indicated under the map by gray arrowheads. Closed arrow, cat (chloramphenicol acetyltransferase gene); thin arrows, tnp (transposase gene); open boxes, IS (insertion sequence) elements; open arrowheads facing each other in the boxes, IRs (terminal inverted repeat sequences); gray arrows and box, the other putative genes (sst: S. suis transposon-associated gene); H, HindIII site; solid lines between the closed arrowheads, regions amplified by PCR; broken lines between the open arrowheads, regions that were not amplified using the indicated PCR primers.

The remaining four ORFs, found in the flanking regions of TnSs1 in S. suis 194, were designated sst1, sst2, sst3, and sst4 (S. suis transposon-associated genes) (Fig. 1A). The putative translational products except Sst1 showed homology to those of other transposable elementrelated genes as indicated in Table 3. Comparison with Orf26 of Tn5252 of Streptococcus pneumoniae revealed that sst3 did not possess the upstream region corresponding to the 50 region of Orf26. This finding suggests that TnSs1 in S. suis 194 has a deletion in the sst3-proximal region, resulting in the absence of duplications of the target sequence. Furthermore, the presence of another putative transposase gene and transposon-related genes in the flanking region of TnSs1 suggests that TnSs1 is part of a large complex transposon, although it is not clear whether the strain acquired the genomic region gradually or all at once, leading to establishment of the present structure.

3.2. Comparison of TnSs1 insertion sites The genetic organization of the TnSs1 region in several S. suis strains was examined by PCR analysis using various combinations of primers (Fig. 1A and Table 2). As summarized in Fig. 1B, chromosomal regions corresponding to TnSs1 and the sst3–sst4 region of S. suis 194 were also amplified in the another Cmr isolate, 195 (MIC: 16 lg/ ml), whereas the region corresponding to the sst1– sst2 region of S. suis 194 was not amplified in this strain. However, the combinations of primers CmR3 and CmR18, and CmR3 and CmR15 did not amplify a DNA fragment from the genomic DNA of S. suis 195. Then HindIII-digested genomic DNAs of S. suis 194 and 195 were analyzed by genomic Southern hybridization using the cat or tnp probe. Both strains showed a single DNA fragment hybridized with either cat or tnp probe (data not shown). These results indicate that S. suis 195 also possesses a copy of TnSs1-like transposon

Table 3 Predicted gene products and the homology exhibited by their potential protein products to amino acid sequences in the databasea Predicted gene

Coding position Start

Stop

Product size aa

c

kDa

Predicted pI

Homology d

BLAST score

aa identity

<1

656

>217

>23.8

7.64

4e ) 68

72/211

sst2

1312

923

129

15.2

10.21

2e ) 44

66/128

tnp

1813

2493

226

27.0

10.29

e ) 112

100/226

cat

2659

3309

216

25.2

8.39

e ) 102

95/215

tnp

3526

4206

226

27.0

10.29

e ) 112

100/226

sst3

4288

4500

70

7.9

9.86

2e ) 26

85/68

sst4

4502

>5656

>385

>44.8

10.73

4e ) 36

39/368

Reference

Putative toxic anion resistance protein of Streptococcus pyogenes M1 GAS [AAK33260] Transposase of IS200 family of S. pneumoniae TIGR4 [AAK75178] Transposase of L. lactis plasmid pK214 [CAA63529]

Ferretti et al. (2001)

Chloramphenicol acetyltransferase of Staphylococcus aureus plasmid pC194 [AAA92251] Transposase of L. lactis plasmid pK214 [CAA63529] Putative protein involved in DNA transfer during conjugal transposition of Tn5252 of S. pneumoniae [AAG38042] Putative protein involved in DNA transfer during conjugal transposition of Tn5252 of S. pneumoniae [AAG38043]

Tettelin et al. (2001) Perreten et al. (2001), Teuber et al. (1999) Byeon and Weisblum (1984) Perreten et al. (2001), Teuber et al. (1999) Alarcon-Chaidez et al. (1997)

Alarcon-Chaidez et al. (1997)

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

sst1

Description and function of closest relativeb

a

Coding region positions are numbered with respect to the entire 5656-bp sequence determined (AB080798) and from the first base of the start codon to the last base of the stop codon. The Genetyx-Mac program (Software Developing, Tokyo, Japan) was used to make predictions of coding regions, molecular masses, and isoelectric points. b Numbers in brackets are protein ID in the DDBJ/EMBL/GenBank database. c Amino acids. d Percent identity/number of amino acids evaluated.

147

148

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

in a different location on the chromosome. Because S. suis 194 and 195 were isolated from different pigs of the same farm in the same year (Table 1), it is plausible that Cmr transposons of both Cmr isolates are the same, although it is not clear whether both strains are descended from a common ancestral strain or each strain gained the same transposon individually. On the other hand, PCR analysis (Fig. 1B) and genomic Southern hybridization (data not shown) demonstrated the complete absence of the TnSs1 region in Cm-susceptible strain NCTC10234 (MIC: 2 lg/ml). 3.3. Transposition of TnSs1 S. suis NCTC10234 was transformed with pTNSS1 and the transformants were selected on THY-Cm plate at 28 °C. After growth of the transformants of S. suis NCTC10234 carrying

pTNSS1 at 37 °C on THY-Cm plates, a number of Cmr temperature-resistant derivatives were obtained at a frequency of approximately 1  1067 per viable cell. Because NCTC10234 completely lacked the genomic region flanking TnSs1 (Fig. 1B), it was expected that these Cmr temperatureresistant derivatives harbored TnSs1 integrated into the genome not by homologous recombination but by transposition. Genomic DNAs were isolated from seven independent such derivatives and the HindIII-digested DNAs were analyzed by genomic Southern hybridization using the cat probe. The seven derivatives showed different hybridization patterns, indicating that TnSs1 can insert into the genome of S. suis at different sites (Fig. 2A). One of the derivatives (Fig. 2A, lane 4) had two DNA fragments that hybridized with the cat probe, suggesting that two copies of TnSs1 had transposed into the genome.

Fig. 2. Genomic Southern hybridization analysis of S. suis NCTC10234 derivatives into which TnSs1 was transposed. Genomic DNAs from seven independent derivatives were digested with HindIII (A and B) or EcoRV and XhoI (C), separated by agarose gel electrophoresis, and probed with cat (A) and tnp (B and C) probes. Molecular sizes are indicated on the right in kilobases. (D) Schematic drawing of possible genetic arrangements deduced from the hybridization patterns. The proposed assignment of each derivative is shown by lane numbers that match those appearing in panels A–C. Closed arrows, cat; thin arrows, tnp; open boxes, IS elements; open arrowheads facing each other in the boxes, IRs; gray line, pSET4s; solid lines, S. suis chromosome; H, HindIII site; E, EcoRV site; X, XhoI site.

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

Transposition of the transposon containing IS6-family elements is characterized by the formation of cointegrates of the donor and the target replicons, which results in the integration of the entire vector into the genome with generation of a new copy of the IS element at the junction (Mahillon and Chandler, 1998). Following cointegration, a resolution step via recA-dependent homologous recombination between two IS elements is required to separate the donor and target replicons (Mahillon and Chandler, 1998). To determine whether the Cmr temperature-resistant derivatives harbor whole pTNSS1 in their genome as a consequence of cointegration or only TnSs1 as a result of a subsequent resolution step, we assessed the pSET4s-mediated spectinomycin resistance (Spcr ) of the derivatives. Six out of the seven derivatives were Spcr and one was Spc susceptible ðSpcs Þ. The genomic DNAs of the derivatives were digested with HindIII, for which no recognition site is present in TnSs1, or EcoRV and XhoI, for which no recognition site is present in pTNSS1, and analyzed by genomic Southern hybridization using the tnp probe. Five out of the six Cmr –Spcr derivatives showed two HindIII restriction fragments or a single EcoRV and/or XhoI restriction fragment that hybridized with the tnp probe (Fig. 2B and C, lanes 1, 3, and 5–7); one hybridizing HindIII restriction fragment was the same size as that hybridized with the cat probe (Fig. 2A, lanes 1, 3, and 5–7), suggesting the formation of cointegrates of pTNSS1 and their genomes with generation of an extra copy of IS214 (Fig. 2D, a). The remaining one Cmr –Spcr derivative showed three HindIII restriction fragments or two EcoRV and/ or XhoI restriction fragments that hybridized with the tnp probe (Fig. 2B and C, lane 4); two hybridizing HindIII restriction fragments were the same sizes as those that hybridized with the cat probe (Fig. 2A, lane 4). In the EcoRV and XhoIdigested genomic DNA, the smaller fragment was seemed less abundant than the larger one, indicating difference in their copy number. Iida et al. (1982) previously reported that kanamycin resistance transposon Tn2680, which is flanked by directly repeated IS26 elements of the IS6 family, could form tandem oligomers. The amplification of Tn2680 is considered to be the result of re-

149

combination between repeated IS26 elements. The authors also reported loss of the kanamycin resistance due to recombination between the flanking direct repeat. Because the size difference between the two fragments was about 9 kb, which was the same as that of pTNSS1, the simplest and most likely explanation for these results is that postintegrational amplification of pTNSS1 occurred via recombination between directly repeated IS214 elements during the culture of the derivative and then loss of a copy of pTNSS1 occurred via recombination in part of the cells as shown in Fig. 2D, c. On the other hand, the Cmr –Spcs derivative showed a single DNA fragment hybridized with the tnp probe in either case tested in this study (Fig. 2B and C, lane 2); the hybridizing HindIII restriction fragment was the same size as that hybridized with the cat probe (Fig. 2A, lane 2). This indicates that a single copy of TnSs1 was transposed into the chromosome, which is the typical outcome of transposase-mediated cointegration and subsequent resolution of vector and target replicons (Fig. 2D, b). Then the genomic DNA of the Cmr –Spcs derivative was digested with HindIII and ligated to HindIII-digested and dephosphorylated pUC19. E. coli DH5a was transformed with the ligation mixture and screened using Cm. Several Cmr clones containing 3.2-kb HindIII fragment that included the TnSs1 of the Cmr –Spcs derivative were obtained. The HindIII fragment was sequenced and compared with the corresponding sequence of strain NCTC10234. The result showed that an 8-bp target sequence, 50 GAAGTAAA-30 , was duplicated at the junctions. These results demonstrate that TnSs1 is an active mobile genetic element. Recently, a number of IS6like modules have been found to be associated with antibiotic resistance determinants in many bacterial species and proposed to mediate the horizontal spread of antibiotic resistance (Handwerger and Skoble, 1995; Raze et al., 1998; Rice and Marshall, 1994; Teuber et al., 1999). TnSs1mediated transposition events, therefore, may contribute to the horizontal dissemination of the Cmr phenotype among S. suis strains. However, since an individual IS6-family element does not have the capacity of intercellular mobility by itself,

150

D. Takamatsu et al. / Plasmid 49 (2003) 143–151

the intervention of a conjugative transposon or plasmid would be necessary to disseminate the Cmr phenotype via TnSs1 among S. suis strains. In S. suis, tetracycline resistance transposon Tn916 has been used for mutagenesis (Brassard et al., 2001; Charland et al., 1998). However, the frequent occurrence of resistance to tetracycline would hamper the application of Tn916 in field isolates. On the other hand, no notable target preference has been observed in the transposition of the IS6 family (Mahillon and Chandler, 1998), and in fact, the transposons characterized in this study were randomly transposed into the genome of S. suis NCTC10234 (Fig. 2A). Moreover, by use of TnSs1 in conjunction with Ts vector, the TnSs1 mutants can efficiently be obtained. Therefore, the use of TnSs1 for transposon mutagenesis will facilitate the genetic analysis of S. suis.

Acknowledgments We are grateful to Toshio Fujisawa and Yoshiji Ando for preparing the photographs and to Mitoyo Takahashi for excellent technical assistance. References Alarcon-Chaidez, F., Sampath, J., Srinvivas, P., Vijayakumar, M.N., 1997. TN5252: a model for complex streptococcal conjugative transposons. Adv. Exp. Med. Biol. 418, 1029– 1032. Alton, N.K., Vapnek, D., 1979. Nucleotide sequence analysis of the chloramphenicol resistance transposon Tn9. Nature 282, 864–869. Arends, J.P., Zanen, H.C., 1988. Meningitis caused by Streptococcus suis in humans. Rev. Infect. Dis. 10, 131–137. Brassard, J., Gottschalk, M., Quessy, S., 2001. Decrease of the adhesion of Streptococcus suis serotype 2 mutants to embryonic bovine tracheal cells and porcine tracheal rings. Can. J. Vet. Res. 65, 156–160. Byeon, W.H., Weisblum, B., 1984. Post-transcriptional regulation of chloramphenicol acetyl transferase. J. Bacteriol. 158, 543–550. Charland, N., Harel, J., Kobisch, M., Lacasse, S., Gottschalk, M., 1998. Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiology 144, 325–332. Ferretti, J.J., McShan, W.M., Ajdic, D., Savic, D.J., Savic, G., Lyon, K., Primeaux, C., Sezate, S., Suvorov, A.N., Kenton, S., Lai, H.S., Lin, S.P., Qian, Y., Jia, H.G., Najar, F.Z., Ren, Q., Zhu, H., Song, L., White, J., Yuan, X., Clifton,

S.W., Roe, B.A., McLaughlin, R., 2001. Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 98, 4658–4663. Hanahan, D., 1985. Techniques for transformation of E. coli. In: Glover, D.M. (Ed.), DNA Cloning, vol. 1. IRL Press, Oxford, pp. 109–136. Handwerger, S., Skoble, J., 1995. Identification of chromosomal mobile element conferring high-level vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 39, 2446–2453. Iida, S., Meyer, J., Linder, P., Goto, N., Nakaya, R., Reif, H.J., Arber, W., 1982. The kanamycin resistance transposon Tn2680 derived from the R plasmid Rts1 and carried by phage P1Km has flanking 0.8-kb-long direct repeats. Plasmid 8, 187–198. Iyobe, S., Sagai, H., Mitsuhashi, S., 1981. Tn2001, a transposon encoding chloramphenicol resistance in Pseudomonas aeruginosa. J. Bacteriol. 146, 141–148. Kataoka, Y., Yoshida, T., Sawada, T., 2000. A 10-year survey of antimicrobial susceptibility of Streptococcus suis isolates from swine in Japan. J. Vet. Med. Sci. 62, 1053–1057. Mahillon, J., Chandler, M., 1998. Insertion sequences. Microbiol. Mol. Biol. Rev. 62, 725–774. National Committee for Clinical Laboratory Standards, 1997. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, seventh ed. Approved standard. NCCLS document M7-A4. National Committee for Clinical Laboratory Standards. Wayne, PA. Ochman, H., Gerber, A.S., Hartl, D.L., 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120, 621–623. Osaki, M., Takamatsu, D., Shimoji, Y., Sekizaki, T., 2002. Characterization of Streptococcus suis genes encoding proteins homologous to sortase of Gram-positive bacteria. J. Bacteriol. 184, 971–982, doi:10.1128/JB.184.4.971982.2002. Osaki, M., Takamatsu, D., Tsuji, N., Sekizaki, T., 2000. Cloning and characterization of the gene encoding Oacetylserine lyase from Streptococcus suis. Curr. Microbiol. 40, 67–71, doi:10.1007/s002849910013. Parent, R., Roy, P.H., 1992. The chloramphenicol acetyltransferase gene of Tn2424: a new breed of cat. J. Bacteriol. 174, 2891–2897. Raze, D., Dardenne, O., Hallut, S., Martinez-Bueno, M., Coyette, J., Ghuysen, J.-M., 1998. The gene encoding the low-affinity penicillin-binding protein 3r in Enterococcus hirae S185R is borne on a plasmid carrying other antibiotic resistance determinants. Antimicrob. Agents Chemother. 42, 534–539. Perreten, V., Schwarz, F.V., Teuber, M., Levy, S.B., 2001. Mdt(A), a new efflux protein conferring multiple antibiotic resistance in Lactococcus lactis and Escherichia coli. Antimicrob. Agents Chemother. 45, 1109–1114. Rice, L.B., Marshall, S.H., 1994. Insertions of IS256-like element flanking the chromosomal b-lactamase gene of Enterococcus faecalis CX19. Antimicrob. Agents Chemother. 38, 693–701.

D. Takamatsu et al. / Plasmid 49 (2003) 143–151 Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sekizaki, T., Otani, Y., Osaki, M., Takamatsu, D., Shimoji, Y., 2001. Evidence for horizontal transfer of Ssu DAT1I restriction-modification genes to the Streptococcus suis genome. J. Bacteriol. 183, 500–511, doi:10.1128/JB.183.2.500-511.2001. Staats, J.J., Feder, I., Okwumabua, O., Chengappa, M.M., 1997. Streptococcus suis: past and present. Vet. Res. Commun. 21, 381–407. Stuart, J.G., Zimmerer, E.J., Maddux, R.L., 1992. Conjugation of antibiotic resistance in Streptococcus suis. Vet. Microbiol. 30, 213–222. Takamatsu, D., Osaki, M., Sekizaki, T., 2001a. Construction and characterization of Streptococcus suis–Escherichia coli shuttle cloning vectors. Plasmid 45, 101–113, doi:10.1006/ plas.2000.1510. Takamatsu, D., Osaki, M., Sekizaki, T., 2001b. Thermosensitive suicide vectors for gene replacement in Streptococcus suis. Plasmid 46, 140–148, doi:10.1006/plas.2001.1532. Takamatsu, D., Osaki, M., Sekizaki, T., 2002. Evidence for lateral transfer of the suilysin gene region of Streptococcus suis. J. Bacteriol. 184, 2050–2057, doi:10.1128/ JB.10.184.7.2050-2057.2002. Terakado, N., Sekizaki, T., Hashimoto, K., Yamagata, S., Yamamoto, T., 1981. Chloramphenicol transposons found in

151

Salmonella naestved and Escherichia coli of domestic animal origin. Antimicrob. Agents Chemother. 20, 382–386. Tettelin, H., Nelson, K.E., Paulsen, I.T., Eisen, J.A., Read, T.D., Peterson, S., Heidelberg, J., DeBoy, R.T., Haft, D.H., Dodson, R.J., Durkin, A.S., Gwinn, M., Kolonay, J.F., Nelson, W.C., Peterson, J.D., Umayam, L.A., White, O., Salzberg, S.L., Lewis, M.R., Radune, D., Holtzapple, E., Khouri, H., Wolf, A.M., Utterback, T.R., Hansen, C.L., McDonald, L.A., Feldblyum, T.V., Angiuoli, S., Dickinson, T., Hickey, E.K., Holt, I.E., Loftus, B.J., Yang, F., Smith, H.O., Venter, J.C., Dougherty, B.A., Morrison, D.A., Hollingshead, S.K., Fraser, C.M., 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science, 293,498–506. Teuber, M., Meile, L., Schwarz, F., 1999. Acquired antibiotic resistance in lactic acid bacteria from food. Antonie Van Leeuwenhoek 76, 115–137. Wasteson, Y., Høie, S., Roberts, M.C., 1994. Characterization of antibiotic resistance in Streptococcus suis. Vet. Microbiol. 41, 41–49. Yanisch-Perron, C., Vieria, J., Messing, J., 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. Communicated by C.J. Smith