b binding protein plays a key role in natural and ethylene-induced degreening of Ponkan (Citrus reticulata Blanco)

Scientia Horticulturae 160 (2013) 37–43

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Chlorophyll a/b binding protein plays a key role in natural and ethylene-induced degreening of Ponkan (Citrus reticulata Blanco) Gang Peng, Xiu-Lan Xie, Qian Jiang, Song Song, Chang-Jie Xu ∗ Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou 310058, China

a r t i c l e

i n f o

Article history: Received 25 December 2012 Received in revised form 14 May 2013 Accepted 17 May 2013 Keywords: Chlorophyll a/b binding protein Chlorophyllase Chlorophylls Citrus Ethylene Fruit maturation

a b s t r a c t Chlorophyll content in peel gradually declines during citrus fruit development, and this can be accelerated by applying ethylene. In order to understand the molecular regulation of chlorophyll loss, the expression of several chlorophyll-related genes was determined in Ponkan (Citrus reticulata Blanco) peel during fruit maturation and ethylene-induced degreening. During fruit development, the transcript level of pheophorbide a oxygenase (CitPaO) and stay-green protein (CitSGR) was stable, and no obvious change of chlorophyll b reductase (CitNYC) mRNA was found. In addition, chlorophyllase (CitChlase) mRNA was decreased, indicating the decline of chlorophyll degradation capacity in this process. Only the reduced expression of Mg-chelatase (CitCHLH) and chlorophyll a/b binding protein (CitCAB1, 2) was found to be correlated with the reduction in chlorophyll content. Chlorophyll loss was greatly accelerated by postharvest ethylene fumigation. In this process, the expression of CitCHLH, CitPaO and CitSGR was not affected. However, it greatly increased the expression of CitNYC and CitChlase, and accelerated the decline in CitCAB expression. Taken together, these results indicate that the decrease in expression of CitCAB was highly associated with chlorophyll loss, no matter whether during natural or ethylene-induced degreening. However, the increase in CitChlase and CitNYC transcript abundance was only related to accelerated chlorophyll degradation in ethylene-induced degreening. In conclusion, the higher availability of free chlorophylls for degradation, resulting from down regulated expression of CitCABs, is likely to be a main reason for chlorophyll reduction during natural and ethylene-induced degreening. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Chlorophylls in peel not only influence photosynthesis, but also participate in fruit coloration, which is an important index for fruit maturity. During citrus fruit development, the color changes from green to yellow or red, associated with chlorophyll reduction and carotenoid accumulation. Chlorophyll content can be affected by chlorophyll biosynthesis, chlorophyll a/b interconversion as well as degradation (Tanaka and Tanaka, 2006). Moreover, it was observed that chlorophyll binding condition also influences chlorophyll degradation (Mayfield and Huff, 1986). Therefore, chlorophyll metabolism consists of four main parts: chlorophyll synthesis, chlorophyll a/b interconversion, chlorophyll binding, and chlorophyll degradation (Fig. 1).

Abbreviations: CAB, chlorophyll a/b binding protein; Chlase, chlorophyllase; LHCP, light-harvesting chlorophyll a/b binding protein complex; CHLH, Mgchelatase; NYC, non-yellowing color; PaO, pheophorbide a oxygenase; SGR, stay green protein; WAFB, weeks after full blossom. ∗ Corresponding author. Tel.: +86 571 88982289; fax: +86 571 88982224. E-mail addresses: [email protected], [email protected] (C.-J. Xu). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.05.022

The chlorophyll degradation pathway, catalyzed by four enzymes starting from chlorophyllase (chlase), is considered to play an important role in chlorophyll loss (Hörtensteiner, 2006). For example, levels of PaO transcript, which catalyzes the third steps (Fig. 1), correlates well with chlorophyll reduction in broccoli florets (Fukasawa et al., 2010), Arabidopsis leaf (Schenk et al., 2007) and pepper fruit (Borovsky and Paran, 2008). Chlase expression and activity is induced by ethylene treatment, and its expression is well correlated with chlorophyll reduction in citrus peel (Purvis and Barmore, 1981; Hirschfeld and Goldschmidt, 1983; Jacob-Wilk et al., 1999; Harpaz-Saad et al., 2007; Shemer et al., 2008). Furthermore, this association can be found at all fruit development stages (Jacob-Wilk et al., 1999). However, some other studies suggested that Chlase does not play a key role in chlorophyll catabolism of citrus (Yamauchi et al., 1991; Alós et al., 2006), and similar results were found in Arabidopsis (Todorov et al., 2003; Schenk et al., 2007; Zhou et al., 2007). Furthermore, despite the importance of Chlase in citrus degreening induced by ethylene, there is no obvious relationship between its expression or activity and chlorophyll degradation during citrus and broccoli fruit development, especially during the color-break period (Jacob-Wilk et al., 1999; Chen et al., 2008). Thus, some other factors must be involved in chlorophyll loss, in addition

38

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43

to the activity of enzymes in the chlorophyll degradation pathway. Research with chlorophyll-retaining mutants indicates existence of a protein outside chlorophyll degradation pathway influencing chlorophyll loss. Recently, several studies confirmed the existence of a stay-green protein (SGR), which can influence chlorophyll catabolism in many ways (Borovsky and Paran, 2008; Hörtensteiner, 2009; Woo et al., 2010). Functional analysis of this protein suggested that it has an effect on chlorophyll catabolism mainly by the disruption of the light-harvesting chlorophyll a/b binding protein complex (LHCP) (Park et al., 2007; Borovsky and Paran, 2008), which is mainly composed of chlorophyll a/b binding protein (CAB). In citrus, the regreening process is paralleled by an increase in CAB content (Mayfield and Huff, 1986), and during Arabidopsis leaf senescence, CAB expression decreases in amount and is regulated by ethylene (Grbic´ and Bleecker, 1995). However, the roles of CAB in chlorophyll degradation during fruit maturation and following ethylene treatment have not been well studied in citrus, one of the most important fruit in the world. Ponkan is a major cultivar of mandarins in China. The fruit produced in the northernmost part of the citrus production area is frequently harvested early to avoid winter frost. However, early harvesting results in poor peel color characterized by the presence of chlorophylls and less accumulation of red-colored carotenoids. To improve the color, citrus fruits are commercially degreened by ethylene or ethephon. In a previous study, the effects of degreening on carotenoid accumulation were evaluated (Zhou et al., 2010). In order to further understand the mechanisms for citrus chlorophyll loss during fruit maturation as well as following ethylene treatment, the expression of seven genes involved in different aspects of chlorophyll metabolism (Fig. 1) was analyzed. It was observed that the expression of chlorophyll a/b binding protein was much more highly associated with reduction in chlorophyll amount than chlorophyllase in Ponkan peel. 2. Materials and methods 2.1. Plant materials Ponkan (Citrus reticulata Blanco cv. Ponkan) fruit were collected at 18, 22, 24, 26, 28 weeks after full blossom (WAFB) from a commercial orchard in Quzhou, Zhejiang (China). The fruit harvested at 28 WAFB was at commercial maturity. For the fruit development samples, fifteen citrus fruit of uniform size and color were divided into three biological replicates, five fruit for each replicate. The peel was cut into pieces, frozen in liquid nitrogen and stored at −80 ◦ C for further analysis. 2.2. Ethylene treatment Fruits collected at 23 WAFB were subjected to ethylene treatment. In each treatment, fifty fruits were selected. The fruits were put into a sealed container, into which ethylene was injected (40 ␮L L−1 ) for 12 h at 20 ◦ C. The control group was also kept in a sealed container without any treatment. The containers were ventilated after 8 h treatment and suitable amounts of ethylene injected again, preventing the excessive buildup of CO2 . The sampling was carried out at 0 h, 12 h, 24 h, 48 h, 72 h. At each time, nine fruits were rationally selected and divided into three biological replicates for sampling and measurement. 2.3. Determination of chlorophyll content in peel Chlorophyll content was determined spectrometrically according to Fadeel (1962). Briefly, 0.5 g of peel powder was extracted

Fig. 1. Summary of chlorophyll metabolism and proteins (enzymes) involved. The expression of genes underlined was analyzed in this study. NYC, non-yellowing color (chlorophyll b reductase); Chlase, chlorophyllase; MCS, metal chelating substance; PaO, pheide a oxygenase; RCCR, red chl catabolite reductase; LHCP, light-harvesting chlorophyll a/b binding protein complex; SGR, stay-green protein; CAB, chlorophyll a/b binding protein. Part I, chlorophyll a synthesis; Part II, chlorophyll interconversion between chlorophyll a and chlorophyll b; Part III, chlorophyll degradation; Part IV, chlorophyll state: bound or free.

with 90% acetone three times to extract pigments. After centrifugation, pigment solutions were mixed and brought to a final volume of 10 mL with 90% acetone. Then one mL of solution was used for detection of chlorophyll content by spectrometer. The concentration of chlorophylls was determined by the equation in Fadeel (1962). 2.4. RNA extraction and real-time PCR Total RNA samples from each biological replicates were extracted following our previously published protocol (Xu et al., 2004). After removal of genomic DNA by DNase I (TaKaRa), 1 ␮g of total RNA was used to synthesize first-strand cDNA by M-MLV (TaKaRa) following the manufacturer’s instructions. The CFX96 instrument (Bio-Rad, USA) and the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, USA) were used for the quantitive realtime PCR. The total reaction volume, primer design, reference selection and Real-time PCR data analysis were performed according to Zhou et al. (2010). Q-PCR primers of other test genes (Table 1) were designed according to known sequences from the citrus genome bank (http://www.citrusgenomedb.org/). The authenticity of Q-PCR amplifications was confirmed by sequencing the PCR products. 2.5. Statistics analysis The data of three biological replicates was analyzed by SigmaStat software, version 3.5, using the Fisher LSD method. 3. Results 3.1. Changes in chlorophyll content in peel during fruit maturation The content of chlorophylls in peel, expressed either as total chlorophyll, or chlorophyll a and chlorophyll b alone, gradually decreased during citrus fruit development (Fig. 2A). The decline was relatively steady during 18–24 WAFB and became more

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43 Table 1 Real-time PCR primer pairs of each gene.

3.2. The expression pattern of genes associated with chlorophyll metabolism in peel during fruit maturation

Gene name

Accession number

Primer sequence (5 –3 )

CitCHLH

orange1.1g001056m

CGATGTTCGTGAAGCAGCAACTC TTGGAATGTGGCGTCTGCTGTGC

CitNYC

orange1.1g010380m

GGCACGGTTTTCCTTTACAGATG TTGTTGTAGTTCTGACGCTTTCTG

CitChlase

orange1.1g020199m

GTGGGATTGTGGTGGCGTTTCT ACTTTTACATGAGTTGTCGTAAGC

CitPaO

orange1.1g009165m

CAGCACACCCTCAAGTGTTCATC AAACAAAGGGAATACTGAGGAAAC

CitSGR

orange1.1g024155m

CAACTGTTGCTTTCCTCCAATGAG CTCTAAAACCCCACCAATACTTTG

CitCAB1

orange1.1g024654m

ATCCATTGGGTTTGGCTGATGAC AACTCTTATCAACCGAAGCTCACT

CitCAB2

orange1.1g024579m

CCGTCTGGCTATGTTCTCCATGT AGATGAAACAGACACCATCAAGTC CATCCCTCAGCACCTTCC CCAACCTTAGCACTTCTCC

CitActin

rapid after that, when the fruit approached the color-break stage. Chlorophyll a accounted for around 70% of total chlorophylls and the ratio of chlorophyll a to chlorophyll b varied between 2.0 and 3.3 with a final value of 2.0 at commercial maturity (Fig. 2B).

Chlorophyll content (µg/g FW)

300

Total chlorophylls Chlorophyll a Chlorophyll b

LSD=11.5

250 200 150 100 50

3.5

Chl a/Chl b ratio

A

B

LSD=0.354

As fruit developed, the expression of CitPaO and CitSGR was relatively stable, despite a small increase in CitPaO transcript at the final stage (Fig. 3C and D). Unexpectedly, the mRNA level of CitChlase in peel gradually decreased, rather than increased from 22 WAFB (Fig. 3B). On the other hand, the gradual decline in transcript of CitCHLH, CitCAB1, and CitCAB2 was observed (Fig. 3E–G), which was in close correlation with the change of chlorophylls in fruit peel. In addition, no consistent trend of CitNYC expression pattern was observed during fruit maturation (Fig. 3A). 3.3. Effects of ethylene on chlorophyll content in peel After detachment of fruit from the tree at 23 WAFB, the content of chlorophylls, either total or chlorophyll a and chlorophyll b alone, in control fruit peel declined gradually, by about 40% over 72 h (Fig. 4A–C). Chlorophyll loss was obviously accelerated by ethylene application, accelerating during 48–72 h and reaching 70% within 72 h after treatment. In addition, ethylene treatment enhanced the increase in the ratio of chlorophyll a to chlorophyll b (Fig. 4D). 3.4. Influences of ethylene on changes in expression pattern of chlorophyll metabolism-related genes The expression patterns of genes related to chlorophyll metabolism in peel of detached fruit (Fig. 5, control) were somewhat different to those in undetached fruit during fruit maturation. In general, the expression of CitNYC, CitChlase, CitPaO and CitSGR was relatively stable or increased slightly after detachment, and either showed no, or even a negative, correlation with chlorophyll loss. On the other hand, the expression of CitCAB1 and CitCAB2 as well as CitCHLH decreased after detachment, and was most pronounced during the 48–72 h period (Fig. 5, control). There was no significant difference in CitCHLH, CitPaO and CitSGR transcript between control and ethylene treatments (Fig. 5C, D and G). Ethylene treatment strongly induced CitChlase expression (Fig. 5B), much more than the degree of ethylene effect on chlorophyll loss (Fig. 4), especially at 12–24 h after detachment. On the other hand, ethylene treatment significantly accelerated the decline in the expression of CitCAB1 and CitCAB2 after fruit detachment (Fig. 5E, 5F). In addition, the transcript of CitNYC gradually increased following ethylene treatment, reaching peak abundance after 24 h, then decreased gradually to the control level (Fig. 5A), and showed a negative correlation with the ratio of chlorophyll a to chlorophyll b (Fig. 4D).

3.0

4. Discussion

2.5

4.1. Chlorophyll synthesis in relation to chlorophyll reduction induced by ethylene and natural development

2.0

1.5

1.0

18

22

39

24

26

28

Development stage (weeks) Fig. 2. Changes in chlorophyll content and composition in peel during citrus fruit development. (A) Chlorophyll content and (B) the ratio of chlorophyll a to b. The data were presented as the mean ± SE (n = 3).

Chlorophyll catabolism is an important part of plant development, since it not only affects the key components of plant photosynthesis systems, but also is responsible for the green color of leaves and fruits. Thus it has been widely studied and has been considered to contain three distinct steps: chlorophyll a synthesis, chlorophyll interconversion between chlorophyll a and chlorophyll b, and chlorophyll degradation (Tanaka and Tanaka, 2006). However, in considering control of chlorophyll catabolism, between the chlorophyll cycle and chlorophyll degradation, a new step is proposed in this study, which reflects the molecular state of chlorophyll, determining whether it is free or bound to a protein (Fig. 1). Mg-chelatase, which regulates protoporphyrin IX flow into the chlorophyll pathway, is considered most important in chlorophyll

40

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43 .16

A

.14

.30

D

LSD=0.021

LSD=0.0551 .25 .20

.10 .15

.08 .06

mRNA level

mRNA level

.12

.10

.04

.05

.02 .07

B

1.6

E

LSD=0.0121

LSD=0.265

1.4

.06

1.0 .04

.8

.03

.6

.02

.4

.01

.2

.08

C

F

LSD=0.0115

mRNA level

mRNA level

1.2 .05

.30

LSD=0.044

.06

.20 .15

.04

mRNA level

mRNA level

.25

.10 .05

.02

18

22

24

26

28

G

.025

LSD=0.0029

Development stages (Weeks)

.015

.010

mRNA level

.020

.005

18

22

24

26

28

0.000

Development stages (Weeks) Fig. 3. Expression patterns of chlorophyll metabolism related genes in peel during citrus fruit development. (A) CitNYC; (B) CitChlase; (C) CitPaO; (D) CitSGR; (E) CitCAB1; (F), CitCAB2; (G) CitCHLH. The data were presented as the mean ± SE (n = 3).

biosynthesis. As one of three subunits for Mg-chelatase (Papenbrock et al., 2000), CHLH not only has an effect on chlorophyll content, but also functions as a plastid signal and ABA receptor (Mochizuki et al., 2001; Shen et al., 2006; Zhang et al., 2006). The decline in its expression during development and detachment (Figs. 3G and 5G) indicates that it is involved in chlorophyll loss through a reduction in chlorophyll biosynthesis capacity (Ren et al., 2011). However, there is no evidence that it was not involved in chlorophyll loss accelerated by ethylene.

4.2. Chlorophyll degradation in related to chlorophyll reduction induced by ethylene and natural development Several genes are involved in the chlorophyll degradation pathway (Hörtensteiner, 2006). In Arabidopsis and pepper, the activity and expression of pheophorbide a oxygenase (PaO), which catalyzes the breaking of the porphyrin ring, are correlated with chlorophyll reduction during fruit maturation and ethyleneinduced senescence (Schenk et al., 2007; Borovsky and Paran, 2008;

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43

Chlorophyll b content (µg/g FW)

35

Chlorophyll a content (µg/g FW)

LSD=3.508

B

LSD=6.992

25 20 15 10 5

80

breakdown can be enhanced by ethylene (Shimokawa et al., 1978; Purvis and Barmore, 1981), which induces the increase in CitChlase expression and enzyme activity (Hirschfeld and Goldschmidt, 1983; Jacob-Wilk et al., 1999). Similar results were obtained in this study (Fig. 3B). Although chlase has been reported to be outside the chloroplasts in Arabidopsis (Schenk et al., 2007), in citrus it is located in the chloroplast (Matile et al., 1997), and silencing its expression delays chlorophyll reduction (Chen et al., 2008). This shows that CitChlase plays an important role in citrus chlorophyll degradation. However, the decline in its expression (Fig. 3B, Yamauchi et al., 1991), as well as constant activity (Yamauchi et al., 1991), during fruit maturation indicates that it was not the key step of chlorophyll reduction during natural degreening, as previously suggested by Jacob-Wilk et al. (1999). During natural degreening, the low expression of Chlase might be sufficient for degradation of free chlorophyll. 4.3. Chlorophyll binding factor in relation to chlorophyll reduction induced by ethylene and natural development

60

40

20

120

C

LSD=22.367

100 80 60 40 20

Control

D 4

Chl a/ Chl b ratio

Control Ethylene

30

100

Total chlorophyll content (µg/g FW)

A

41

Ethylene

LSD=0.386

3

2

1

0

12

24

48

72

Time after treatment (h) Fig. 4. Change in chlorophyll content and composition in peel of detached citrus fruit in response to ethylene treatment. (A) The content of total chlorophylls; (B) the content of chlorophyll a; (C) the content of chlorophyll b; (D) the ratio of chlorophyll a to chlorophyll b. The data were presented as the mean ± SE (n = 3).

Pruˇzinská et al., 2005; Gomez-Lobato et al., 2012). The delay of chlorophyll loss by gibberellin and cytokinin is due to inhibition of PaO expression (Alós et al., 2006; Li et al., 2010; Gomez-Lobato et al., 2012). In addition, some stay-green phenotypes are due to loss of PaO function (Vicentini et al., 1995; Ren et al., 2007). However, the stable expression of CitPaO in our results suggested it may be not a limiting factor for citrus chlorophyll catabolism (Figs. 3C and 5C). In citrus, the degreening process and chlorophyll

Chlorophyll reduction in natural and ethylene-induced senescence cannot simply be due to the decrease of chlorophyll synthesis or increase of chlorophyll degradation. This stimulated our interest in binding factors in our work. Recently, the disruption of pigment-protein complexes within the thylakoid membrane has been considered to be a crucial early step in the chlorophyll degradation pathway (Barry, 2009). The stay-green, or chlorophyllretaining, phenotypes have been observed in many plants and a stay-green protein (SGR) has been identified (Hörtensteiner, 2009). Furthermore, chlorophyll degradation can be delayed through silencing SGR expression (Yang et al., 2009; Hu et al., 2011; Zhou et al., 2011). However, further studies showed that silencing SGR expression did not influence the expression of genes encoding enzymes in chlorophyll degradation pathway (Sato et al., 2007; Alós et al., 2008). Thus, SGR acts independently and upstream of chlorophyll degradation (Aubry et al., 2008) by aiding the disaggregation of light-harvesting chlorophyll a/b binding protein (LHCP) (Park et al., 2007; Borovsky and Paran, 2008; Jiang et al., 2011; Sakurada et al., 2012). The CitCAB proteins can bind pigments, and therefore, a large drop in CitCAB transcript level during citrus fruit development (Fig. 3E and F), after detachment and especially following ethylene treatment of detached fruit (Fig. 5E and F) probably favors the accumulation of free chlorophylls over bound ones, facilitating the start of chlorophyll degradation (Alós et al., 2008), and this is associated with the chlorophyll content (Mayfield and Huff, 1986; Grbic´ and Bleecker, 1995; Fujii et al., 2007). Unlike the situation with CitChlase, CAB protein has not been detected in chromoplasts containing only a trace of chlorophyll (Hirschfeld and Goldschmidt, 1983; Kuntz et al., 1989). Similar results have also been found in the yellow leaves of chlorophylldeficient seedlings, which have no detectable LHCPs (Mayfield and Taylor, 1984). On the other hand, it has been concluded that the effect of ethylene on the expression of CitCABs and the stabilization of CAB protein caused chlorophyll reduction (Shimokawa et al., 1978; Barry, 2009). However, the reduction in expression of CitCABs closely paralleled chlorophyll reduction during citrus fruit maturation (Woo et al., 2010; Yang et al., 2012) (Fig. 3E and F), where the ethylene production was quite low for this nonclimacteric fruit, indicating that ethylene is not the only factors having an effect on CitCAB expression (Ren et al., 2010; Xu et al., 2012) (Fig. 5E and F). Nevertheless, it can be concluded that chlorophyll reduction is influenced by the expression of CitCAB during natural degreening, though how the expression is regulated still remains unknown. One possible explanation would be that this CitCAB expression is controlled by one or several developmental factors and the factors can be further influenced by ethylene.

42

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43 1.0

A

Control Ethylene

LSD=0.12

D

.8

LSD=0.0838

.6 .6 .4 .4

mRNA level

mRNA level

.8

.2

.2

B

E

LSD=0.0256

LSD=0.196

1.2

.4

.8

.3

.6 .1

mRNA level

mRNA level

1.0

.4 .2

C

F

LSD=0.0136

.08

LSD=0.0104

mRNA level

.12

.06

.10 .04

.08 .06

mRNA level

.14

.02

.04 0

12

24

48

72

Time after treatment (h)

0.00

G

.025

LSD=0.0037

.015

.010

m RNA level

.020

.005 0

12

24

48

72

Time after treatment (h) Fig. 5. Change in expression of chlorophyll metabolism related genes in peel of detached citrus fruit in response to ethylene treatment. (A) CitNYC; (B) CitChlase; (C) CitPaO; (D) CitSGR; (E) CitCAB1; (F) CitCAB2; (G) CitCHLH. The data were presented as the mean ± SE (n = 3).

5. Conclusions In the present study, it is concluded that the levels of CitCAB1 and CitCAB2 transcripts were highly related to chlorophyll reduction, no matter whether during the natural degreening process or following ethylene treatment. During fruit natural degreening, expression of CitCABs, as well as that of CitPaO and CitChlase, was down regulated, indicating the critical role of CitCABs in regulating chlorophyll reduction. During ethylene-induced degreening, the expression of CitCABs was even lower which enhanced the conversion of bound

chlorophyll molecules into free ones. Following this, the increased level of CitNYC and CitChlase mRNA induced by ethylene further accelerates chlorophyll reduction through increased chlorophyll degradation capacity. Acknowledgments We are grateful to Professor Don Grierson for critical reading of the manuscript. This research was supported by the National Basic Research Program of China (973 Program) [2011CB100600],

G. Peng et al. / Scientia Horticulturae 160 (2013) 37–43

the Special Scientific Research Fund of Agricultural Public Welfare Profession of China [200903044], and the Fundamental Research Funds for the Central Universities [2012FZA6013]. References Alós, E., Cercós, M., Rodrigo, M.J., Zacarías, L., Talón, M., 2006. Regulation of color break in citrus fruits. Changes in pigment profiling and gene expression induced by gibberellins and nitrate, two ripening retardants. J. Agric. Food Chem. 54, 4888–4895. Alós, E., Roca, M., Iglesias, D.J., Mínguez-Mosquera, M.I., Damasceno, C.M.B., Thannhauser, T.W., Rose, J.K.C., Talón, M., Cerós, M., 2008. An evaluation of the basis and consequences of a stay-green mutation in the navel negra citrus mutant using transcriptomic and proteomic profiling and metabolite analysis. Plant Physiol. 147, 1300–1315. Aubry, S., Mani, J., Hörtensteiner, S., 2008. Stay-green protein, defective in Mendel’s green cotyledon mutant, acts independent and upstream of pheophorbide a oxygenase in the chlorophyll catabolic pathway. Plant Mol. Biol. 67, 243–256. Barry, C.S., 2009. The stay-green revolution: recent progress in deciphering the mechanisms of chlorophyll degradation in higher plants. Plant Sci. 176, 325–333. Borovsky, Y., Paran, I., 2008. Chlorophyll breakdown during pepper fruit ripening in the chlorophyll retainer mutation is impaired at the homolog of the senescenceinducible stay-green gene. Theor. Appl. Genet. 117, 235–240. Chen, L.F.O., Lin, C.H., Kelkar, S.M., Chang, Y.M., Shaw, J.F., 2008. Transgenic broccoli (Brassica oleracea var. italica) with antisense chlorophyllase (BoCLH1) delays postharvest yellowing. Plant Sci. 174, 25–31. Fadeel, A.A., 1962. Location and property of chloroplasts and pigment determination in roots. Plant Physiol. 15, 130–147. Fujii, H., Shimada, T., Sugiyama, A., Nishikawa, F., Endo, T., Nakano, M., Ikoma, Y., Shimizu, T., Omura, M., 2007. Profiling ethylene-responsive genes in mature mandarin fruit using a citrus 22 K oligoarray. Plant Sci. 173, 340–348. Fukasawa, A., Suzuki, Y., Terai, H., Yamauchi, N., 2010. Effects of postharvest ethanol vapor treatment on activities and gene expression of chlorophyll catabolic enzymes in broccoli florets. Postharvest Biol. Technol. 55, 97–102. Gomez-Lobato, M.E., Civello, P.M., Martínez, G.A., 2012. Effects of ethylene, cytokinin and physical treatment on BoPaO gene expression of harvested broccoli. J. Sci. Food Agric. 92, 151–158. ´ V., Bleecker, A.B., 1995. Ethylene regulates the timing of leaf senescence in Grbic, Arabidopsis. Plant J. 8, 595–602. Harpaz-Saad, S., Azoulay, T., Arazi, T., Yaakov, E.B., Mett, A., Shiboleth, Y.M., Hrtensteiner, S., Gidoni, D., On, A.G., Goldschmidt, E.E., Eyal, Y., 2007. Chlorophyllase is a rate-limiting enzyme in chlorophyll catabolism and is posttranslationally regulated. Plant Cell 19, 1007–1022. Hirschfeld, K.R., Goldschmidt, E.E., 1983. Chlorophyllase activity in chlorophyll-free citrus chromoplasts. Plant Cell Rep. 2, 117–118. Hörtensteiner, S., 2006. Chlorophyll degradation during senescence. Annu. Rev. Plant Biol. 57, 55–77. Hörtensteiner, S., 2009. Stay-green regulates chlorophyll and chlorophyll-binding protein degradation during senescence. Trends Plant Sci. 14, 155–162. Hu, Z.L., Deng, L., Yan, B., Pan, Y., Luo, M., Chen, X.Q., Hu, T.Z., Chen, G.P., 2011. Silencing of the LeSGR1 gene in tomato inhibits chlorophyll degradation and exhibits a stay-green phenotype. Biol. Plant. 55, 27–34. Jacob-Wilk, D., Holland, D., Goldschmidt, E.E., Riov, J., Eyal, Y., 1999. Chlorophyll breakdown by chlorophyllase: isolation and functional expression of the Chlase1 gene from ethylene-treated citrus fruit and its regulation during development. Plant J. 20, 653–661. Jiang, H.W., Chen, Y.P., Li, M.R., Xu, X.L., Wu, G.J., 2011. Overexpression of SGR results in oxidative stress and lesion-mimic cell death in rice seedlings. J. Integr. Plant Biol. 53, 375–387. Kuntz, M., Evrard, J.L., D’Harlingue, A., Weil, J.H., Camara, B., 1989. Expression of plastid and nuclear genes during chromoplast differentiation in bell pepper (Capsicum annuum) and sunflower (Helianthus annuus). Mol. Gen. Genet. 216, 156–163. Li, J.R., Yu, K., Wei, J.R., Ma, Q., Wang, B.Q., Yu, D., 2010. Gibberellin retards chlorophyll degradation during senescence of Paris polyphylla. Biol. Plant. 54, 395–399. Matile, P., Schellenberg, M., Vicentini, F., 1997. Localization of chlorophyllase in the chloroplast envelope. Planta 201, 96–99. Mayfield, S.P., Huff, A., 1986. Accumulation of chlorophyll, chloroplastic proteins, and thylakoid membranes during reversion of chromoplasts to chloroplasts in Citrus sinensis epicarp. Plant Physiol. 81, 30–35. Mayfield, S.P., Taylor, W.C., 1984. Carotenoid-deficient maize seedlings fail to accumulate light-harvesting chlorophyll a/b binding protein (LHCP) mRNA. J. Biochem. 144, 79–84. Mochizuki, N., Brusslan, J.A., Larkin, R., Nagatani, A., Chory, J., 2001. Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. PNAS 98, 2053–2058. Papenbrock, J., Pfündel, E., Mock, H.P., Grimm, B., 2000. Decreased and increased expression of the subunit CHL I diminishes Mg chelatase activity and reduces chlorophyll synthesis in transgenic tobacco plants. Plant J. 22, 155–164. Park, S.Y., Yu, J.W., Park, J.S., Li, J.J., Yoo, S.C., Lee, N.Y., Lee, S.K., Jeong, S.W., Seo, H.S., Koh, H.J., Jeon, J.S., Park, Y.I., Paek, N.C., 2007. The senescence-induced staygreen protein regulates chlorophyll degradation. Plant Cell 19, 1649–1664.

43

Pruˇzinská, A., Tanner, G., Aubry, S., Anders, I., Moser, S., Müller, T., Ongania, K.H., Kräutler, B., Youn, J.Y., Liljegren, S.J., Hörtensteiner, S., 2005. Chlorophyll breakdown in senescent Arabidopsis leaves. Characterization of chlorophyll catabolites and of chlorophyll catabolic enzymes involved in the degreening reaction. Plant Physiol. 139, 52–63. Purvis, A.C., Barmore, C.R., 1981. Involvement of ethylene in chlorophyll degradation in peel of citrus fruits. Plant Physiol. 68, 854–856. Ren, G.D., An, K., Liao, Y., Zhou, X., Cao, Y.J., Zhao, H.F., Ge, X.C., Kuai, B.K., 2007. Identification of a novel chloroplast protein AtNYE1 regulating chlorophyll degradation during leaf senescence in Arabidopsis. Plant Physiol. 144, 1429–1441. Ren, G.F., Zhou, Q., Wu, S.X., Zhang, Y.F., Zhang, L.G., Huang, J.R., Sun, Z.F., Kuai, B.K., 2010. Reverse genetic identification of CRN1 and its distinctive role in chlorophyll degradation in Arabidopsis. J. Integr. Plant Biol. 52, 496–504. Ren, J., Sun, L., Wang, C.L., Zhao, S.L., Leng, P., 2011. Expression analysis of the cDNA for magnesium chelatase H subunit (CHLH) during sweet cherry fruit ripening and under stress conditions. Plant Growth Regul. 63, 301–307. Sakurada, Y., Schelbert, S., Park, S.Y., Han, S.H., Lee, B.D., Adrès, C.B., Kessler, F., Hörtensteiner, S., Paek, N.C., 2012. STAY-GREEN and chlorophyll catabolic enzymes interact at light-harvesting complex II for chlorophyll detoxification during leaf senescence in Arabidopsis. Plant Cell 24, 507–518. Sato, Y., Morita, R., Nishimura, M., Hiroyasu, Y., Kusaba, M., 2007. Mendel’s green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway. PNAS 104, 14169–14174. Schenk, N., Schelbert, S., Kanwischer, M., Goldschmidt, E.E., Dörmann, P., Hörtensteiner, S., 2007. The chlorophyllases AtCLH1 and AtCLH2 are not essential for senescence-related chlorophyll breakdown in Arabidopsis thaliana. FEBS Lett. 581, 5517–5525. Shemer, T.A., Harpaz-Saad, S., Belausov, E., Lovat, N., Krokhin, O., Spicer, V., Standing, K.G., Goldschmidt, E.E., Eyal, Y., 2008. Citrus chlorophyllase dynamics at ethylene-induced fruit color-break: a study of chlorophyllase expression, posttranslational processing kinetics, and in situ intracellular localization. Plant Physiol. 148, 108–118. Shen, Y.Y., Wang, X.F., Wu, F.Q., Du, S.Y., Cao, Z., Shang, Y., Wang, X.L., Peng, C.C., Yu, X.C., Zhu, S.Y., Fan, R.C., Xu, Y.H., Zhang, D.P., 2006. The Mg-chelatase H subunit is an abscisic acid receptor. Nature 443, 823–826. Shimokawa, K., Sakanoshita, A., Horiba, K., 1978. Ethylene-induced changes of chloroplast structure in Satsuma mandarin (Citrus unshiu Marc.). Plant Cell Physiol. 19, 229–236. Tanaka, A., Tanaka, R., 2006. Chlorophyll metabolism. Curr. Opin. Plant Biol. 9, 248–255. Todorov, D.T., Karanov, E.N., Smith, A.R., Hall, M.A., 2003. Chlorophyllase activity and chlorophyll content in wild type and eti 5 mutant of Arabidopsis thaliana subjected to low and high temperatures. Biol. Plant. 46, 633–636. Vicentini, F., Hörtensteiner, S., Schellenberg, M., Thomas, H., Matile, P., 1995. Chlorophyll breakdown in senescent leaves: identification of the biochemical lesion in a stay-green genotype of Festuca pratensis Hud. New Phytol. 129, 247–252. Woo, H.R., Kim, J.H., Kim, J.Y., Kim, J.S., Lee, U., Song, I.J., Kim, J.H., Lee, H.Y., Nam, H.G., Lim, P.O., 2010. The RAV1 transcription factor positively regulates leaf senescence in Arabidopsis. J. Exp. Bot. 61, 3947–3957. Xu, Y.H., Liu, R., Yan, L., Liu, Z.Q., Jiang, S.C., Shen, Y.Y., Wang, X.F., Zhang, D.P., 2012. Light-harvesting chlorophyll a/b-binding proteins are required for stomatal response to abscisic acid in Arabidopsis. J. Exp. Bot. 63, 1095–1106. Xu, C.J., Chen, K.S., Zhang, B., Wang, Q.J., Ye, W.J., 2004. A study on methods for RNA extraction from citrus tissues. J. Fruit Sci. 21, 136–140 (in Chinese). Yamauchi, N., Hashinaga, F., Itoo, S., 1991. Chlorophyll degradation with degreening of kabosu (Citrus sphaerocarpa Hort. ex Tanaka) fruits. J. Jpn. Soc. Hortic. Sci. 59, 869–975. Yang, S.G., Zeng, X.Q., Li, T., Liu, M., Zhang, S.C., Gao, S.J., Wang, Y.Q., Peng, C.L., Li, L., Yang, C.W., 2012. AtACDO1, an ABC1-like kinase gene, is involved in chlorophyll degradation and the response to photooxidative stress in Arabidopsis. J. Exp. Bot. 60, 3959–3973. Yang, X.T., Pang, X.Q., Xu, L.Y., Fang, R.Q., Huang, X.M., Guan, P.J., Lu, W.J., Zhang, Z.Q., 2009. Accumulation of soluble sugars in peel at high temperature leads to stay-green ripe banana fruit. J. Exp. Bot. 60, 4051–4062. Zhang, H.T., Li, J.J., Yoo, J.H., Yoo, S.C., Cho, S.H., Koh, H.J., Seo, H.S., Paek, N.C., 2006. Rice chlorina-1 and chlorina-9 encode ChlD and ChI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol. Biol. 62, 325–337. Zhou, C.N., Han, L., Pislariu, C., Nakashima, J., Fu, C.X., Jiang, Q.Z., Quan, L., Blancaflor, E.B., Tang, Y.H., Bouton, J.H., Udvardi, M., Xia, G.M., Wang, Z.Y., 2011. From model to crop: functional analysis of a STAY-GREEN GENE in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement. Plant Physiol. 157, 1483–1496. Zhou, J.Y., Sun, C.D., Zhang, L.L., Dai, X., Xu, C.J., Chen, K.S., 2010. Preferential accumulation of orange-colored carotenoids in Ponkan (Citrus reticulata) fruit peel following postharvest application of ethylene or ethephon. Sci. Hortic. 126, 229–235. Zhou, X., Liao, Y., Ren, G.D., Zhang, Y.Y., Chen, W.J., Kuai, B.K., 2007. Repression of AtCLH1 expression results in a decrease in the ratio of chlorophyll a/b but doesn’t affect the rate of chlorophyll degradation during leaf senescence. J. Plant Physiol. Mol. Biol. 33, 596–606.