Chlorophyll synthesis and the photoprotective mechanism in leaves of mulberry (Morus alba L.) seedlings under NaCl and NaHCO3 stress revealed by TMT-based proteomics analyses

Ecotoxicology and Environmental Safety 190 (2020) 110164

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Chlorophyll synthesis and the photoprotective mechanism in leaves of mulberry (Morus alba L.) seedlings under NaCl and NaHCO3 stress revealed by TMT-based proteomics analyses

T

Zhang Huihuia,b,1, Wang Yueb,1, Li Xina,b, He Guoqiangc, Che Yanhuib, Teng Zhiyuanb, Shao Jieyub, Xu Nanb,d,∗, Sun Guangyub,∗∗ a

College of Resources and Environment, Northeast Agricultural University, Harbin, Heilongjiang, China Key Laboratory of Saline-alkali Vegetation Ecology Restoration, Ministry of Education, College of Life Sciences, Northeast Forestry University, Harbin, Heilongjiang, China Mudanjang Tobacco Science Research Institute, Mudanjang, Heilongjiang, China d Natural Resources and Ecology Institute, Heilongjiang Sciences Academy, Harbin, Heilongjiang, China b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Morus alba L. NaCl and NaHCO3 stress Proteomics Photosynthesis Photoprotective mechanism

Chlorophyll (Chl) and effective photoprotective mechanism are important prerequisites to ensure the photosynthetic function of plants under stress. In this study, the effects of 100 mmol L−1 NaCl and NaHCO3 stress on chlorophyll synthesis and photosynthetic function of mulberry seedlings were studied by physiological combined with proteomics technology. The results show that: NaCl stress had little effect on the expression of Chl synthesis related proteins, and there were no significant changes in Chl content and Chl a:b ratio. However, 13 of the 15 key proteins in the process of Chl synthesis were significantly decreased under NaHCO3 stress, and the contents of Chl a and Chl b were significantly decreased (especially Chl a). Although stomatal conductance (Gs) decreased significantly under NaCl stress, net photosynthetic rate (Pn), PSII maximum photochemical efficiency (Fv/Fm) and electron transfer rate (ETR) did not change significantly, but under NaHCO3 stress, not only Gs decreased significantly, PSII activity and photosynthetic carbon were the same. In the photoprotective mechanism under NaCl stress, NAD(P)H dehydrogenase (NDH)-dependent cyclic electron flow (CEF) enhanced, the expression of related proteins subunit, ndhH, ndhI, ndhK, and ndhM, the key enzyme of the xanthophyll cycle, violaxanthin de-epoxidase (VDE) were up-regulated, the ratio of (A + Z)/(V + A + Z) and non-photochemical quenching (NPQ) was increased. The expressions of proteins FTR and Fd-NiR were also significant up-regulated under NaCl stress, Fd-dependent ROS metabolism and nitrogen metabolism can effectively reduce the electronic pressure on Fd. Under NaHCO3 stress, the expressions of NDH-dependent CEF related proteins subunit (ndhH, ndhI, ndhK, ndhM and ndhN), VDE, ZE, FTR, Fd-NiR and Fd-GOGAT, were significant down-regulated, and ZE, CP26, ndhK, ndhM, Fd-NiR, Fd-GOGAT and FTR genes expression also significantly decreased, the photoprotective mechanism, like the xanthophyll cycle，CEF and Fd-dependent ROS metabolism and nitrogen metabolism might be damaged, resulting in the inhibition of PSII electron transfer and carbon assimilation in mulberry leaves under NaHCO3 stress.

Soil salinization is an important limiting factor affecting plant growth and crop yield (Aroca et al., 2012). Soil salt stress not only causes direct ionic toxicity to plants, but also indirectly induces osmotic stress and oxidative stress (Shaheen et al., 2013). Because plants can not move in the growth process, they can only actively adapt to stress. In the long-term evolution process, plants have formed a series of salt-

alkali stress adaptation mechanisms, such as salt rejection of roots (Wang et al., 2006b; Zhao et al., 2016),salt secretion of salt glands (Yuan et al., 2015; Maheshi and Larkin, 2017), or partitioning Na+ into vacuoles to alleviate cell damage (Apse and Blumwald, 2007). Plants can maintain cell swelling pressure by accumulating osmotic regulators such as soluble sugar (SS) (Hong et al., 2000; Zhang et al., 2018a),

∗ Corresponding author. Key Laboratory of Saline-alkali Vegetation Ecology Restoration, Ministry of Education, College of Life Sciences, Northeast Forestry University, Harbin, Heilongjiang, China. ∗∗ Corresponding author. E-mail addresses: [email protected] (X. Nan), [email protected] (S. Guangyu). 1 Equal contributors.

https://doi.org/10.1016/j.ecoenv.2020.110164 Received 5 September 2019; Received in revised form 12 December 2019; Accepted 2 January 2020 0147-6513/ © 2020 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

analyze the intrinsic causes of the great difference in photosynthetic function of mulberry seedlings under NaCl and NaHCO3 stress, we studied chlorophyll synthesis, photosynthetic gas exchange, PSII activity and electron transfer rate of mulberry seedlings under 100 mmol L−1 NaCl and NaHCO3 stress by means of plant physiology combined with proteomics. The changes of CEF, xanthophyll cycle and in other electronic utilization pathways of Fd-related proteins expression in leaves of mulberry seedlings under NaCl and NaHCO3 stress were studied in depth. The mechanism of above-mentioned photoprotective mechanism in regulating mulberry under NaCl and NaHCO3 stress was revealed, which provided a basis for rational planting of mulberry in saline-alkali soil.

proline (Pro) (Sperdouli and Moustakas, 2015; Zahoor et al., 2017), polyamine (PAs) (Ruiz, 2007; Evelin et al., 2009; Cicatelli et al., 2010) and betaine (GB) (Yang et al., 2003; Ashraf and Foolad, 2007) , or inorganic osmotic regulators such as K+ (Ahanger and Agarwal, 2017; Hosseini et al., 2016) and Na+ (Inès et al., 2007; Gattward et al., 2012; Erel et al., 2014). When plants absorb more light than they can utilize under salt and alkali stress, excess light will lead to the decrease of photosystem II (PSII) and photosystem I (PSI) activity, photosynthetic rate, and oxidative damage caused by reactive oxygen species (ROS) burst (Foyer and Noctor, 1999; Lu et al., 2017; Zhang et al., 2018b, 2019a). To scavenging excessive ROS, plants often remove excessive ROS by increasing the activity of antioxidant enzymes (SOD, POD, CAT, APX, and GPX) (Wu et al., 2012) and the content of antioxidants (ASA and GSH) (Nie et al., 2007; Chao and Kao, 2010). In addition, reducing the chances of excess excitation energy or electrons producing ROS，plants also have evolved a series of photoprotective mechanisms under stress, such as the rapid turnover of D1 protein (Yang et al., 2014), cyclic electron flow (CEF) around PSI (Huang et al., 2017, 2018; Zhang et al., 2018c), photorespiration (Messant et al., 2018; Sunil et al., 2018), and the xanthophyll cycle (Ruban et al., 2010; Pieters et al., 2003). Effective photoprotective mechanism can improve plant resistance to stress. At present, it is found that NAD(P)H dehydrogenase (NDH) and proton gradient regulation 5/proton gradient regulation like 1 (PGR5/PGRL1) participate in CEF process in two ways (Munekage et al., 2002, 2004; Shikanai, 2007). CEF generates transthylakoid membrane proton gradient (ΔpH) through proton pumps, thus forming additional ATP resistance to adversity, such as repairing D1 protein (Deng et al., 2003; Golding and Johnson, 2003; Allakhverdiev et al., 2005). The ΔpH established by CEF can be converted into reverse transport of Ca2+ and H+ in thylakoid membranes, increase Ca2+ concentration in thylakoid lumen, and stabilize PSII oxygen-releasing complex (OEC) (Ettinger, 1999; Takahashi et al., 2009). Lower ATP synthesis limits the CalvinBenson cycle under adversity, resulting in the lack of PSI and NADP+ electron acceptors (Takagi et al., 2017), resulting in photoinhibition of PSI, and CEF can reduce the damage of excessive electron flow to PSI (Wang et al., 2006a, b; Tikkanen et al., 2010). Xanthophyll cycle refers to the process of mutual transformation between violaxanthin (V), antheraxanthin (A) and zeaxanthin (Z) under the action of Violaxanthin de-epoxidase (VDE) and Zeaxanthin epoxidase (ZE). Xanthophyll cycle can dissipate excess energy in plants (Demmig-Adams, 1990; Kong et al., 2015; Ding et al., 2017), Ruban and Horton (1999a) and Frank et al. (1994) found that Z can quench chlorophyll directly in vitro. As an antioxidant, Z can also quench excess ROS directly (1999), the increase of Z content can also significantly promote the increase of non-photochemical quenching (NPQ) (Havaux et al., 2007). Therefore, xanthophyll cycle is an important mechanism to protect plant photosynthetic apparatus from excess light damage (Pieters et al., 2003; Takahashi and Badger, 2011; Kress and Jahns, 2017). Mulberry is an important economic tree species. Its leaves can not only be used as silkworm feed, but also have important medicinal value (Doi et al., 2001; Katsube et al., 2006). In addition, mulberry has strong drought resistance, cold resistance and other characteristics, and has important ecological value in fragile ecological environment (Sudhakar et al., 2001; Surabhi et al., 2008; Ahmad and Sharma, 2010). However, we found that although mulberry trees have strong resistance to neutral salt NaCl, the survival rate and growth rate of mulberry trees are very poor under alkaline salt stress, mainly Na2CO3 and NaHCO3, especially the photosynthesis of mulberry leaves is significantly inhibited (Zhang et al., 2011, 2012; Zhang et al., 2018a, b, c, d; Zhang et al., 2019a, b, ). Although a large number of studies have proved that NaHCO3 and other alkaline salts have more harmful effects on some sweet soil plants than neutral salts because of their high pH value (Campbell and Nishio, 2000; Zhang and Mu, 2009; Li et al., 2010; Guo et al., 2015; Pang et al., 2016; Song et al., 2017), there are few studies to explain this phenomenon through the photoprotective mechanisms. In order to deeply

1. Materials and methods 1.1. Test materials and treatment Mulberry seeds were provided by the Silkworm Research Institute of Heilongjiang Academy of Agricultural Sciences. The tested materials were annual mulberry seedlings with a height of approximately 30 cm. Two seedlings were planted in each pot with a diameter of 30 cm and a height of 28 cm, and covered with the substrates of fully mixed peat soil and perlite (v:v = 1:1). The pots were cultured in an artificial climate chamber with a temperature of 25/23 °C (light/dark), light intensity of 400 μmol m−2·s−1, photoperiod of 12/12 h (light/dark), and 75% relative humidity, and the pots were watered and managed regularly. A total of 15 pots of mulberry seedlings with relatively identical growth were divided into three treatments, with five repeats in each treatment, and treated with 100 mmol L−1 NaCl and NaHCO3 solutions, respectively. Each pot was irrigated with 1 L of NaCl and NaHCO3 solution, and a plastic tray was placed under each pot to prevent the loss of salt solution. The solution flowing into the tray was poured back when the substrate was slightly dry. The same volume of distilled water was irrigated as a control (CK). On the 7th d after irrigation with different NaCl and NaHCO3 solutions, the differences of plants under different treatments were observed and this data was used to calculate the following indexes. 1.2. Determination of parameters and methods Determination of the concentrations of chlorophyll a (Chl a) and chlorophyll b (Chl b): A fresh leaf sample without main vein was sliced and incubated in pigment extraction solution containing acetone, anhydrous ethanol and distilled water (4.5:4.5:1, V:V:V). Contents of Chl a and Chl b were calculated according to Arnon (1949), Chl a:b also were calculated. The determination of each parameter was repeated three times. Measurement of gas exchange parameters of photosynthesis:: Using Li-6400 photosynthetic measuring system (Licor Company, USA), fixing CO2 concentration by CO2 cylinder at 400 μl L−1, setting the light intensity (PFD) of the instrument's own light source to 1800, 1500, 1300, 1100, 900, 700, 500, 400, 150, 75, 50, 25 and 0 μmol m−2·s−1, the mulberry trees of different treatments were measured in the order of light intensity from high to low. The net photosynthetic rate (Pn) and stomatal conductance (Gs) of fully expanded functional leaves under different PFD were plotted, and the response curves of Pn-PFD and Gs -PFD were plotted. The determination of each parameter was repeated three times. Determination of chlorophyll fluorescence parameters: Using dark adaptation clips, the unfolded penultimate leaves treated with different treatments were placed in the dark for 30 min to conduct dark adaptation, and the initial fluorescence (Fo) and maximum fluorescence (Fm) of leaves of mulberries seedling were then measured using a FMS-2 portable modulated fluorometer (UK) to calculate the maximum photochemical efficiency (Fv/Fm) of PSII. Then the maximum fluorescence (Fm’) and steady-state fluorescence (Fs) under light adaptation were 2

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

measured after 3 min of applying 1000 μmol m−2·s−1 acting light (PFD) to the leaves with the built-in light source of FMS-2. Electron transfer rate ETR = 0.5 × 0.85 × (Fm′-Fs)/Fm′ × PFD and non-photochemical quenching NPQ=(Fm–Fm′)/Fm’. The determination of each parameter was repeated three times. NDH-dependent CEF measurement:: FMS-2 portable modulated fluorometer (UK) was used to measure the change of chlorophyll fluorescence signal. After 30 min dark adaptation, the leaf irradiated 54 μmol m−2·s−1 acting light, and turned off the acting light at 300 ms. Because of the existence of NDH-dependent CEF, the chlorophyll fluorescence signal would rise, the drop of the lowest point and the rising point can be used to qualitatively describe NDH-dependent CEF (Han et al., 2017). The determination of each parameter was repeated three times. Extraction and determination of xanthophyll components:: The whole process of extracting pigments was conducted in the dark. Leaves (0.2 g) were placed in a pre-cooled mortar and ground until homogenous with 4 mL 85% acetone and SiO2. After adding another 1 mL 100% acetone and homogenizing for 1 min, the sample was placed on ice for 15 min, then centrifuged for 2 min at 1200×g. Then, the supernatant was removed and filtered through a 0.45 μm microporous membrane filter. The contents of violaxanthin (V), antheraxanthin (A), and zeaxanthin (Z) in the xanthophyll cycle were determined by highperformance liquid chromatography, in which the chromatographic column was Spherisorb C18 (5 μm, 250 mm × 4.6 mm), the liquid A in the mobile phase was acetonitrile and methanol (v:v = 85:15), and liquid B was methanol and ethyl acetate (v:v = 68:32). The flow rate was 1 mL min−1 and the detection wavelength was 445 nm. The deep oxidation state of xanthophyll was expressed by (A + Z)/(V + A + Z). Proteomics determination and analysis: The leaves of mulberry seedlings in different treatments were collected and pre-cooled with liquid nitrogen, and then sent to PTM Biolabs in Hangzhou Eco & Tech Developmental Area (Hangzhou, Zhejiang Province) in an incubator with dry ice for proteomics determination. Testing material passing through protein extraction, trypsin hydrolysis, TMT marker, HPLC classification, liquid chromatography-mass spectrometry (LC-MS), database search，the data of 1.2-fold and P < 0.05 differential proteins (chlorophyll synthesis and photoprotective mechanism related) were analyzed (Zhang et al., 2019b). Three biological repeats were determined. RT-PCR analysis: Based on the findings of proteomics analysis, we chose chlorophyll synthesis and photoprotective mechanism response proteins for RT-PCR analysis for the verification of proteomics data. Total RNA was extracted from approximately 100 mg of plant tissue using OMEGA Plant RNA Kit (Bio-tek, Norcross, Georgia) according to the manufacturer's instructions. Extracted RNA was used for singlestrand cDNA synthesis with PrimeScript RT Reagent Kit (TaKaRa, Japan). Real-time PCR was carried out according to a SYBR Green fluorescence-based procedure using SYBR Premix Ex Taq (TaKaRa, Japan). The PCR cycling protocol consisted of an initial denaturation at 94 °C for 10 min, followed by 40 cycles of 94 °C for 20 s and 60 °C for 20 s. After the final cycle, a melting curve analysis was performed over a temperature range of 60–95 °C in increments of 1 °C to verify the reaction specificity. Using the actin gene as a constitutive reference, relative expression was measured by the 2−ΔΔCt method (Livak and Schmittgen, 2001).Gene specific primers sequences (5′-3′) are as follows: Glu-TR: F: GAGCTGTGCGGTTTGAATC; R: TCTGAAACAGGGATTC CACTTG. ALAD: F: ACTCCTGTGGTCCCTACG; R: CAAATTGGCAGGTGATAA GGTTG. GHLG: F: TCCAACATCAACACCTCACG; R: ATTTTCTCGGCAACCA AACG. CAO: F: AGAGGGTTGTGGAAGTGTTG; R: TGTCTAAAGCAGTGGC AACC. VDE: F: AGACTTGTGCCTGCTTACTC; R: ATCTGGCATTCGGTCTC

ATC. ZE: F: AACATGGCACCTGGATCGTT; R: CCTGCCCTCATTACTGC ACA. CP26: F: TTACGATCCTTTTGGGCTGAG; R: CACAGTTGGCACCGAA TTTG. ndhK: F: AGCGGGCACAGTAACAATGA; R: AACTGCCTCCGGTTTA GGTG. ndhI: F: TGAAAAGGTAATCGCTGCGGA; R: TTCCAATCAACGACGG GCAG. ndhM: F: CTCACGCTCATTCTCGACC; R: CTATGTCTGAACCAATTA ACCGAAG. Fd-GOGAT: F: TTTGTGGACGCATAGCTGGT; R: CCTCCAGCCATAC CCTTTCC. FTR: F: GAGCCCAAGTGGAACCATCA; R: AAAATCCTTGCCCAGCC TCA. Fd-NiR: F: CAAACTTGCCAAGGAAGTGGA; R: ATCGCCTCTTCACA CCGTTT. Reference genes: F: GGAACGGGTTGAGGAGAAAGAAG; R: GCAAG AACAAGATGAAGCACAGAGC.

1.3. Data processing Excel and SPSS (22.0) were used to analyze the measured data. All data were the mean ± standard error (SE) of three repetitions, and the differences among different treatments were compared by one-way ANOVA and LSD. The level of significance was set at P < 0.05 and very significant difference was set at P < 0.01 for all tests.

2. Results 2.1. Proteins detected by Coomassie blue staining SDS–PAGE analysis of xylem sap (20 μl) followed by Coomassie blue staining revealed different protein compositions in these saps, As shown in Fig. 1, The protein molecular weights ranged from approximately 10 to 250 kDa. The protein bands were clear and uniform, and the trophoresis lanes were well parallel. NaCl stress significantly increased protein abundance at 55 and 25 kDa compared with CK, but under NaHCO3 stress, the protein abundance significantly decreased compared with CK and NaCl stress.

Fig. 1. Protein by SDS-PAGE in leaves of mulberry seedlings under NaCl and NaHCO3 stress. Note: M are protein molecular mass markers (kDa), 1, 2 and 3 represent three repetitions of each treatment, respectively. 3

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

Fig. 2. The chlorophyll contents (A, B, C), chlorophyll fluorescence parameters (D, E, F) and responsive curves of Pn and Gs (G, H) in leaves of mulberry seedlings under NaCl and NaHCO3 stress. Note: significant differences were expressed by different small letters (P < 0.05), and very significant differences were expressed by different capital letters (P < 0.01). The data in the figure is the average of three repetitions.

2.2. Chlorophyll content, chlorophyll fluorescence parameters and photosynthetic gas exchange parameters

stress, its content decreased by 27.08% (P < 0.05). The content of V + A + Z did not change significantly under NaCl and NaHCO3 stress. The proportion of (A + Z)/(V + A + Z) under NaCl stress increased by 62.73% (P < 0.01), but that under NaHCO3 stress decreased by 41.04% (P < 0.01).

As shown in Fig. 2, Under NaCl stress, Chl a, Chl b and Chl a:b did not change significantly compared with CK, but that under NaHCO3 stress decreased by 26.83% (P < 0.01), 21.79% (P < 0.01) and 12.84%(P < 0.05), Chl a reduction of greater than Chl b. Compared with CK, Fv/Fm and ETR showed insignificant differences under NaCl stress, but they decreased by 18.20% (P < 0.01) and 51.57% (P < 0.01), respectively, under NaHCO3 stress. NPQ under NaCl stress increased by 12.76% (P < 0.05), but that under NaHCO3 stress decreased by 49.32% (P < 0.01). NaCl stress had no significant effect on Pn -PFD curve of mulberry leaves, but the Gs under different PFD was significantly lower than that of CK. Under NaHCO3 stress, Pn under different PFD was significantly lower than that under CK and NaCl stress, and Gs was significantly lower than that under NaCl stress.

2.4. Expression of proteins related to chlorophyll synthesis and photoprotective mechanism As shown in Table 1 and Fig. 4-A, the chlorophyll synthesis of mulberry seedlings under NaCl stress showed no significant changes in other proteins except Glu-TR and MgPMEC, but under NaHCO3 stress, the proteins of chlorophyll synthesis expression decreased very significantly except under NaHCO3 stress. As shown in Table 1 and Fig. 4-B, the difference in expression between ndhN expression and CK was not significant, but the expression of ndhH, ndhI, ndhK, and ndhM increased by 20.33% (P < 0.01), 11.59% (P < 0.05), 22.50% (P < 0.01), and 43.10% (P < 0.01) in the CEF pathway under NaCl stress, respectively. However, their expression decreased very significantly under NaHCO3 stress. VDE expression increased by 14.57% (P < 0.01) and ZE expression decreased by 7.65% (P < 0.01) compared with CK under NaCl stress. The expression of VDE and ZE decreased very significantly under NaHCO3 stress. The expression of chlorophyll a-b binding proteins, such as CP24 10A, CP26, and CP29, were also increased to varying degrees compared

2.3. NDH-dependent cyclic electron flow (CEF) and xanthophyll cyclic components As shown in Fig. 3, the transient post-illumination increase in Chl fluorescence increased compared with CK under NaCl stress, but that under NaHCO3 stress decreased significantly. Under NaCl stress, the A + Z content increased by 108.33% (P < 0.01), while under NaHCO3 4

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

Fig. 3. Effects of NaCl and NaHCO3 stress on the transient post-illumination increase in Chl fluorescence (A) and the xanthophyll cycle (B,C, D) in leaves of mulberry seedlings. Note: significant differences were expressed by different small letters (P < 0.05), and very significant differences were expressed by different capital letters (P < 0.01). The data in the figure is the average of three repetitions.

significantly inhibit the synthesis of Chl or accelerate (Car) its degradation, thus affecting the photosynthetic function of plants (Yue et al., 2018; Jin et al., 2019). 15 enzymes encoded by 27 genes are involved in the formation of plant Chl from L-glutamyl-tRNA (GlutRNA) to Chl a and Chl b (Matsumoto et al., 2004; Beale, 2005). NaHCO3 stress can lead to the decrease of proteins or genes expression during Chl synthesis and affect the synthesis of Chl (Gong et al., 2013). In this experiment, under NaCl stress, there was no significant change in the expression of related enzymes during Chl synthesis except Glu-TR and MgPMEC, the genes expression of GluTR, ALAD, CHLG and CAO were consistent with that of their proteins, there were no significant changes in Chl a, Chl b and Chl a:b. NaCl stress had little effect on Chl synthesis, which results in the blockage of Chl synthesis and the decrease of Chl content. However, 13 of the 15 key proteins in the process of Chl synthesis were significantly decreased under NaHCO3 stress, and the contents of Chl a and Chl b were significantly decreased. In addition, the results also showed that Chl a:b under NaHCO3 stress was significantly lower than CK, that is, the effect of NaHCO3 stress on Chl a was greater than that of Chl b. The expression of enzymes related to Chl synthesis in leaves of mulberry seedlings under NaCl and NaHCO3 stress is shown in Fig. 6-A. Under the influence of Chl content and other factors, the photosynthetic gas exchange parameters and Chl fluorescence parameters also changed significantly. Gs decreased significantly under NaCl stress, but Pn, Fv/Fm and ETR did not change significantly. That means NaCl stress can alleviate the adverse effects of photosynthesis by reducing stomatal conductance, which can effectively reduce the excessive evaporation of water and improve water use efficiency, many results are similar (Zhang et al., 2018c, 2018d, 2019b). However, under NaHCO3 stress, not only Gs but also Pn, Fv/Fm and ETR were significantly decreased compared with CK. Therefore, photosynthetic capacity was significantly inhibited, especially PSII function under NaHCO3 stress. In order to further analyze the underlying causes of the above phenomena, we analyzed a series of photoprotective mechanism and the changes of related proteins expression under NaCl and NaHCO3 stress. Stress can induce the expression of NDH protein subunits and promote CEF processes (Lehtimäki et al., 2010; Kato et al., 2018). In

with the CK, but that of CP24 10A, CP26, and CP29 decreased by 34.37% (P < 0.01), 37.62% (P < 0.01) and 45.38% (P < 0.01) under NaHCO3 stress. Compared with CK, the expression of FTR (W9SEM5 and W9RQM9) under NaCl stress increased by 39.23% (P < 0.01) and 7.95% (P < 0.05), respectively. In addition, Fd-NiR expression increased by 9.96% (P < 0.05), but the expression of FTR and Fd-NiR under NaHCO3 stress decreased very significantly. The expression of Fd-GOGAT and Fd-GOGAT2 decreased significantly under NaCl stress compared with CK, but the reduction of their expression under NaHCO3 stress was much greater than that under NaCl stress. 2.5. qRT-PCR analysis of the key gene expression of chlorophyll synthesis and photoprotective mechanism As shown in Fig. 5-A, In the process of chlorophyll synthesis, GluTR, ALAD, CHLG and CAO genes expression did not change under NaCl stress compared with CK, but they were significantly lower than CK under NaHCO3 stress. There were no significant difference VDE and ZE genes expression, CP26 gene expression increased significantly compared with CK under NaCl stress, VDE, ZE and CP26 genes expression under NaHCO3 stress decreased significantly (Fig. 5-B). As shown in Fig. 5-C, NaCl stress increased ndhK, ndhI and ndhM expression by 17.59% (P > 0.05), 35.32% (P < 0.05) and 156.72% (P < 0.01) compared with CK, respectively. Under NaHCO3 stress, the genes expression of ndhK and ndhM were significantly lower than CK except that ndhI gene. Compared with CK, there was no significant difference FdGOGAT genes expression under NaCl stress, the genes expression of FTR and Fd-NiR under NaHCO3 stress increased by 53.81% (P < 0.01) and 19.61% (P < 0.05), respectively. Fd-GOGAT, FTR and Fd-NiR genes expression under NaHCO3 stress decreased very significantly compared with CK. 3. Discussion Chl is an important pigment for photosynthesis in plants. Its function is to capture light energy and drive electrons to the reaction center and transform light energy (Fromme et al., 2003). Salt stress can 5

6

Glutamyl-tRNA reductase (Glu-TR) Glutamate-1-semialdehyde 2,1-aminomutase 1 (GSA-AM) Delta-aminolevulinic acid dehydratase (ALAD) Porphobilinogen deaminase (PBGD) Uroporphyrinogen III decarboxylase (UROD) Uroporphyrinogen III decarboxylase (UROD) Coproporphyrinogen-III oxidase (CPOX) Protoporphyrinogen oxidase (PPOX) Magnesium-chelatase subunit H (CHLH) Magnesium-protoporphyrin IX monomethyl ester cyclase (MgPMEC) Branched-chain-amino-acid aminotransferase (DVR) NADPH-protochlorophyllide oxidoreductase (POR) NADPH-protochlorophyllide oxidoreductase (POR) Chlorophyll synthase (CHLG) Chlorophyllide a oxygenase (CAO) NAD(P)H-quinone oxidoreductase subunit H (ndhH) NAD(P)H-quinone oxidoreductase subunit I (ndhI) NAD(P)H-quinone oxidoreductase subunit K (ndhK) NAD(P)H-quinone oxidoreductase subunit M (ndhM) NAD(P)H-quinone oxidoreductase subunit N (ndhN) Violaxanthin de-epoxidase (VDE) Zeaxanthin epoxidase (ZE) Chlorophyll a-b binding protein CP24 (CP24 10A) Chlorophyll a-b binding protein CP26 (CP26) Chlorophyll a-b binding protein CP29 (CP29) Ferredoxin-dependent glutamate synthase (Fd-GOGAT) Ferredoxin-dependent glutamate synthase 2(Fd-GOGAT2) Ferredoxin–nitrite reductase(Fd-NiR) Ferredoxin-thioredoxin reductase (FTR) Ferredoxin-thioredoxin reductase (FTR)

W9RNS6 W9R5H4 W9QZ73 W9SZ70 W9QCD4 W9QXH5 W9S1H4 W9QNJ2 W9RWM1 W9SI76 W9RKD9 W9RXN6 W9RAC2 W9SCK2 W9SD87 Q09WW2 W9QPC3 Q09X13 W9QMA9 W9RKW4 W9S244 A0A0A0QZ09 W9SBB4 W9S9S7 W9QYC0 W9SAH2 W9RZU3 W9RY59 W9SEM5 W9RQM9

Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus Morus

notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis indica notabilis indica notabilis notabilis notabilis alba var. multicaulis notabilis notabilis notabilis notabilis notabilis notabilis notabilis notabilis

Species L484_025530 L484_008822 L484_013359 L484_007545 L484_012310 L484_012311 L484_012704 L484_013889 L484_001481 L484_027977 L484_007773 L484_025670 L484_011586 L484_016390 L484_025466 ndhH ndhI ndhK ndhM ndhN L484_006461 – L484_024124 L484_012656 L484_026409 L484_01938 L484_019389 L484_027526 L484_003491 L484_011027

Gene name 59.04 50.83 46.75 40.92 26.33 30.62 44.67 58.08 153.59 47.33 44.89 43.02 43.36 31.92 60.66 45.58 16.50 25.40 24.75 25.44 57.66 73.92 27.45 39.28 30.55 116.28 61.56 65.21 16.25 18.45

MW [kDa] 1.03 1.28 1.30 1.28 1.23 1.31 1.23 1.21 1.25 1.07 1.09 1.37 1.37 1.21 1.15 1.02 1.09 1.02 0.92 1.20 1.16 1.11 0.96 1.01 1.19 1.25 1.26 1.11 1.03 1.17

CK ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.06bA 0.03aA 0.13aA 0.04aA 0.08aA 0.08aA 0.01aA 0.05aA 0.06aA 0.03bB 0.03aA 0.05aA 0.06aA 0.21aA 0.12aA 0.03bB 0.07bA 0.03bB 0.09aA 0.05aA 0.05bB 0.01aA 0.04bB 0.00bB 0.00bA 0.01aA 0.02aA 0.08bA 0.03bB 0.05bA

Note: significant differences were expressed by different small letters (P < 0.05), and very significant differences were expressed by different capital letters (P < 0.01).

Protein description

Protein accession

Table 1 Expression of chlorophyll synthase and photoprotective mechanism -related proteins in M. alba seedling leaves under NaCl and NaHCO3 stress.

1.32 1.23 1.28 1.12 1.18 1.16 1.06 1.12 1.10 1.39 1.09 1.15 1.19 1.18 1.24 1.23 1.22 1.25 1.32 1.17 1.33 1.07 1.56 1.44 1.27 1.17 1.18 1.23 1.44 1.26

NaCl ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.18aA 0.04aA 0.06aA 0.02aA 0.04aA 0.03bB 0.02bB 0.03bA 0.10bA 0.03aA 0.02aA 0.06bA 0.06aA 0.03aA 0.34aA 0.03aA 0.08aA 0.06aA 0.05aA 0.02bB 0.04aA 0.02bA 0.03aA 0.01aA 0.05aA 0.01bB 0.02bB 0.09aA 0.03aA 0.06aA

0.74 0.60 0.54 0.69 0.71 0.64 0.83 0.76 0.74 0.65 0.88 0.58 0.60 0.71 0.70 0.85 0.79 0.83 0.82 0.72 0.84 0.88 0.60 0.63 0.65 0.66 0.66 0.75 0.64 0.66

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

NaHCO3 0.15cB 0.01bB 0.06bB 0.04bB 0.04bB 0.04cC 0.04cC 0.01cC 0.09cC 0.05cC 0.03bB 0.02cB 0.03bB 0.04bB 0.20bB 0.02cC 0.02cC 0.05bB 0.04bB 0.05cC 0.01cC 0.02cB 0.07cC 0.04cC 0.01cB 0.02cC 0.02cC 0.02cB 0.05cC 0.04cB

Z. Huihui, et al.

Ecotoxicology and Environmental Safety 190 (2020) 110164

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

Fig. 4. Calorimetric map of chlorophyll synthase-related enzymes (A) and photoprotective mechanism-related proteins (B) expression in leaves of mulberry seedlings under NaCl and NaHCO3 stress.

this experiment, the transient post-illumination increase in Chl fluorescence increased compared with CK under NaCl stress, except for the not significant change in ndhN expression, the expression of ndhH, ndhI, ndhK, and ndhM were all significantly increased under NaCl stress, the expression of the above proteins subunit were significantly decreased under NaHCO3 stress. ndhI and ndhM genes expression also significantly decreased under NaCl stress compared with CK, but ndhK and ndhM genes expression significantly decreased under NaHCO3 stress.This indicated that NDH-dependent CEF was enhanced under NaCl stress, but this protective mechanism was inhibited under NaHCO3 stress. In addition to driving ATP synthase to synthesize ATP, the transthylakoid membrane proton gradient (ΔpH) produced by CEF plays an important role in protecting PSII and PSI (Wang et al., 2006a, b; Zhang et al., 2018c). Therefore, the reason for insignificant influence of ETR under NaCl stress in this experiment may be related to the promotion of CEF processes, which is similar to the results of Hakala et al. (2005) and Wu et al. (2019) who found that CEF has protective effect on PSII and PSI. Our previous research found that the OEC related proteins OEE3-1and PPD4 increased, PSI activity and the expression of

PSI core proteins (PsaF, PsaG, PsaH, PsaN, Ycf4) also increased in mulberry seedling leaves under NaCl stress (Zhang et al., 2019b), this may also be related to the enhancement of CEF induced by NaCl stress. CEF is usually not stimulated under weak light, or relative linear electron transfer is maintained at a relatively low level (Miyake et al., 2005; Nandha et al., 2007; Huang et al., 2012). However, when the ratio of NADPH/ATP is high, CEF is easily stimulated. For example, the increase of photorespiration leads to ATP consumption, or the CO2 concentration in chloroplasts decreases and photorespiration increases as stomatal conductance decreases, resulting in more ATP supply than what is needed for CO2 fixation, which leads to the increase of NADPH/ ATP ratio and promotes CEF (Joët et al., 2000; Golding and Johnson, 2003; Wang et al., 2006a, b). In this experiment, although Gs was significantly lower than CK under NaCl stress, the net photosynthetic rate (Pn) did not change. The utilization of ATP by leaves of M. alba seedlings under NaCl stress may increase, which may lead to the increase of the NADPH/ATP ratio, thus promoting CEF. In this experiment, we only identified the changes of CEF-related proteins expression in NDH pathway, but did not identify the differentially expressed CEF in PGR5/

Fig. 5. Effects of NaCl and NaHCO3 stress on gene expression of chlorophyll synthesis and photoprotective mechanism in leaves of mulberry seedlings. Note: ns indicates no significant difference with CK, * indicates significant difference with CK, ** indicates significant difference with CK. 7

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

Fig. 6. Expression of chlorophyll synthase-related enzymes (A) and photoprotective mechanism-related proteins (B) in leaves of mulberry seedlings under NaCl and NaHCO3 stress. Note: 6-A: Glu-tRNA: L-glutamyl-tRNA; GSA: L-glutamic acid 1-semialdehyde; ALA: δ-aminolevulinic acid; PBG: porphobilinogen; HMB: hydroxymethylbilane; Urogen III: uroporphyrinogen III; Coprogen III: Coproporphyrinogen III; Protogen IX: Protoporphyrinogen IX; Proto IX: Protoporphyrin IX; Mg-proto IX: Mg-protoporphyrin IX; MgPME: Mg-protoporphyrin IX monomethylester; DV-Pchlide: divinyl protochlorophyllide; Pchlide a: protochlorophyllide a; Chlide a: Chlophyllide a; Chl a: Chlorophyll a; Chlideb: Chlorophyllide b; Chl b: Chlorophyll b; Glu-TR: Glutamyl-tRNA reductase; GSA-AM: Glutamate-1-semialdehyde 2,1aminomutase 1; ALAD: Delta-aminolevulinic acid dehydratase; PBGD: Porphobilinogen deaminase; UROS: Uroporphyrinogen III synthase; UROD: Uroporphyrinogen III decarboxylase; CPOX: Coproporphyrinogen-III oxidase; PPOX: Protoporphyrinogen oxidase; CHLH: Magnesium-chelatase subunit H; MgPTM: Magnesium-protoporphyrin IX monomethyl ester cyclase; DVR: Branched-chain-amino-acid aminotransferase; POR: NADPH-protochlorophyllide oxidoreductase; CHLG: Chlorophyll synthase; CAO: Chlorophyllide a oxygenase. 6-B: PSII: photosystem II, LHCII: light harvesting pigment protein complexe II, PQ: plastoquinone, Cytb6f: cytochrome b6f, PC: plastocyanin, PSI: photosystem I, Fd: ferredoxin, FNR: ferredoxin-NADP reductase, V: Violaxanthin, Z: Zeaxanthin, VDE: violaxanthin de-epoxidase, ZE: zeaxanthin epoxidase, CP24 10A: Chlorophyll a-b binding protein CP24 10A, CP26: chlorophyll a-b binding protein CP26, ndhH: NAD(P)H-quinone oxidoreductase subunit H, ndhI: NAD(P)H-quinone oxidoreductase subunit I, ndhK: NAD(P)H-quinone oxidoreductase subunit K, ndhM: NAD(P)H-quinone oxidoreductase subunit M, ndhN: NAD(P)H-quinone oxidoreductase subunit N, FTR: ferredoxin-thioredoxin reductase, NR: nitrate reductase, Fd-NiR: ferredoxin-nitrite reductase, FdGOGAT: ferredoxin-dependent glutamate synthase, Fd-GOGAT2: ferredoxin-dependent glutamate synthase 2, Glu: glutamate.

not fully used to promote ATP production, the energy dissipation mechanism of the xanthophyll cycle depending on ΔpH will be activated. In addition, the ΔpH established by CEF will also drive the process of the xanthophyll cycle. The xanthophyll cycle exists in all advanced plants and some algae (Lohr and Wilhelm, 2001). Salt stress can lead to the transformation of V to Z (Yuan et al., 2017), and it is reported that NPQ is positively correlated with heat dissipation dependent on the xanthophyll cycle (Li et al., 2000; Liu et al., 2004; Kalituho et al.,

PGRL1 pathway, and lacked relevant instruments and equipment for the determination of CEF in PGR5/PGRL1 pathway. Therefore, the role of CEF in NaCl and NaHCO3 stress of mulberry trees through PGR5/ PGRL1 pathway needs further study. Under stress, if the electron transfer on the PSII electron transfer chain is blocked, the proton gradient (ΔpH) of the transthylakoid membrane can still be formed due to the continuous production of H+ by PSII photolysis of H2O in the thylakoid cavity. However, if ΔpH is 8

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

photosynthetic function in mulberry leaves. Enhancement of CEF, xanthophyll cycle and Fd-dependent ROS metabolism and nitrogen metabolism play an important role in alleviating photoinhibition under NaCl stress. However, 100 mmol L−1 NaHCO3 stress significantly down-regulated key enzyme or proteins expression related to chlorophyll synthesis. CEF, xanthophyll cycle, and FTR, Fd-NiR and FdGOGAT expression decreased very significantly. This is the important reason for the inhibition of photosynthesis in mulberry leaves under NaHCO3 stress significantly greater than that under NaCl.

2007). Therefore, as an important way to dissipate excitation energy, NPQ plays an important role in reducing the pressure of the PSII reaction center and improving photosynthetic capacity of plants under stress (Xu et al., 2018; Liu et al., 2019). In this study, under NaCl stress, NPQ increased compared with CK, and the expression of the key enzyme VDE in the xanthophyll cycle was up-regulated. However, ZE expression was down-regulated, resulting in a significant increase in the proportion of (A + Z)/(V + A + Z), which initiated the xanthophyll cycle to dissipate excess excitation energy. Han et al. (2010) demonstrated that overexpression of the VDE gene can effectively reduce the production of ROS in tomato leaves under low temperature stress to alleviate oxidative damage, and Qiu et al. (2003) also found that the xanthophyll cycle plays an important role in improving salt tolerance of Atriplex centralasiatica. In addition, it has been reported that the xanthophyll cycle exists in the antenna pigment protein complex of plant thylakoid membranes, and its pigments are mainly localized on LHCII and some small chlorophyll-binding proteins (CP24, CP26, and CP29) (Gilmore, 2010; Pan et al., 2011; Daskalakis, 2018). CP24, CP26, and CP29 may also be one of the oxidases in the xanthophyll cycle (Schaller et al., 2011). In this study, the expression of the LHCII proteins CP24 10A, CP26, and CP29 in PSII was up-regulated under NaCl stress, which further demonstrated that the xanthophyll cycle played an important role in dissipating excess energy under NaCl stress, and the stability of the xanthophyll cycle was improved by enhancing the up-regulation of the xanthophyll cyclic attachment proteins. Under NaHCO3 stress, the expression of VDE and ZE was down-regulated, and the proportion of (A + Z)/(V + A + Z) was also significantly reduced. The expression of CP24 10A, CP26, and CP29 also decreased, and CP26 gene expression was very significantly reduced compared with CK under NaHCO3 stress. Therefore, the decrease of ETR under NaHCO3 stress was related to the inhibition of the xanthophyll cycle. In addition to transferring electrons to FNR to promote the synthesis of ATP and NADPH, nitrogen metabolism, photorespiration, and ROS scavenging processes can also act as electron receptors for Fd. Some studies have found that these metabolic processes play a competitive role in the synthesis of NADPH, leading to a reduction in plant photosynthetic rate, but the absence of receptors for excess electrons in Fd can lead to the production of ROS around PSI under stress (Asada, 2006; Hong et al., 2017). Therefore, other electronic utilization pathways of Fd are also an important protective mechanism. In this experiment, the expression of FTR and Fd-NiR was significantly increased, and FTR gene expression also increased compared with CK under NaCl stress. The proportion of electrons transferred to Fd used in nitrite reduction and the ROS scavenging metabolic pathway increased, which showed a positive effect on the reduction of ROS production caused by excess electrons. Wang et al. (2019) also found that the increase of nitrogen metabolism in chloroplast dependent on Fd could significantly increase the activities of PSII and PSI in mulberry leaves by consuming excess light energy. In addition, under NaHCO3 stress, the reduction of NO2−, the assimilation of NH4+ during nitrogen metabolism in chloroplasts, and the expression of the key enzymes Fd-NiR, Fd-GOGAT, and Fd-GOGAT2 were all significantly reduced, The change of Fd-NiR and Fd-GOGAT genes expression were consistent with that of proteins, which may lead to the accumulation of NO2− and NH4+ in chloroplasts and produce toxic effects. The changes of proteins related to the photoprotective mechanism of M. alba seedlings under NaCl and NaHCO3 stress are shown in Fig. 6B. The expression of related proteins are under NaCl and NaHCO3 treatments from left to right. Red represents up-regulated expression, and green indicates for down-regulated expression.

Author contributions Zhang HH, Xu N and Sun GY conceived and designed the experiments. Zhang HH and Wang Y wrote the manuscript and prepared the figures and/or tables. . Li X, He GQ, Che YH, Shao JY, Teng ZY performed the experiments and analyzed the data. Declaration of competing interest The authors declared that they have no conflicts of interest to this work.We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted. Acknowledgments: This research was supported by “Young Talents” Project of Northeast Agricultural University (18QC12) and The National Natural Science Fund (31901088). References Ahanger, M.A., Agarwal, R.M., 2017. Potassium up-regulates antioxidant metabolism and alleviates growth inhibition under water and osmotic stress in wheat (Triticum aestivum L.). Protoplasma 254 (4), 1471–1486. Ahmad, P., Sharma, S., 2010. Physio-biochemical attributes in two cultivars of mulberry (Morus alba L.) under NaHCO3 stress. Int. J. Plant Prod. 4 (2), 79–86. Allakhverdiev, S.I., Nishiyama, Y., Takahashi, S., et al., 2005. Systematic analysis of the relation of electron transport and ATP synthesis to the photodamage and repair of photosystem II in Synechocystis. Plant Physiol. 137 (1), 263–273. Apse, M.P., Blumwald, E., 2007. Na+ transport in plants. FEBS (Fed. Eur. Biochem. Soc.) Lett. 581 (12), 2247–2254. Arnon, D.I., 1949. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24, 1–15. Aroca, R., Porcel, R., Ruiz-Lozano, J.M., 2012. Regulation of root water uptake under abiotic stress conditions. J. Exp. Bot. 63 (1), 43–57. Asada, K., 2006. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 141 (2), 391–396. Ashraf, M., Foolad, M.R., 2007. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 59 (2), 206–216. Beale, S.I., 2005. Green genes gleaned. Trends Plant Sci. 10 (7), 309–312. Campbell, S.A., Nishio, J.N., 2000. Iron deficiency studies of sugar beet using an improved sodium bicarbonate-buffered hydroponic growth system. J. Plant Nutr. 23 (6), 741–757. Chao, Y.Y., Kao, C.H., 2010. Heat shock-induced ascorbic acid accumulation in leaves increases cadmium tolerance of rice (Oryza sativa L.) seedlings. Plant Soil 336 (1–2), 39–48. Cicatelli, A., Lingua, G., Todeschini, V., et al., 2010. Arbuscular mycorrhizal fungi restore normal growth in a white poplar clone grown on heavy metal-contaminated soil, and this is associated with upregulation of foliar metallothionein and polyamine biosynthetic gene expression. Ann. Bot. 106 (5), 791–802. Daskalakis, V., 2018. Protein–protein interactions within photosystem II under photoprotection: the synergy between CP29 minor antenna, subunit S (PsbS) and zeaxanthin at all-atom resolution. Phys. Chem. Chem. Phys. 20, 11843–11855. Demmig-Adams, B., 1990. Carotenoids and photoprotection in plants. A role for the xanthophyll zeaxanthin. Biochim. Biophys. Acta 1020, 1–24. Deng, Y., Ye, J.Y., Mi, H.L., 2003. Effects of low CO2 on NAD(P)H dehydrogenase, a mediator of cyclic electron transport around photosystem I in the cyanobacterium synechocystis PCC6803. Plant Cell Physiol. 44 (5), 534. Ding, F., Wang, M.L., Liu, B., et al., 2017. Exogenous melatonin mitigates photoinhibition by accelerating non-photochemical quenching in tomato seedlings exposed to moderate light during chilling. Front. Plant Sci. 8, 244. Doi, K., Kojima, T., Makino, M., et al., 2001. Studies on the constituents of the leaves of Morus alba L. Chem. Pharmaceut. Bull. 49 (2), 151. Erel, R., Ben-Gal, A., Dag, A., et al., 2014. Sodium replacement of potassium in physiological processes of olive trees (var. Barnea) as affected by drought. Tree Physiol. 34

4. Conclusions 100 mmol L−1 NaCl had no significant effect on Chl synthesis and 9

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

Liu, Z.F., Yan, H.C., Wang, K.B., et al., 2004. Crystal structure of spinach major lightharvesting complex at 2.72A resolution. Natrue 428 (6980), 287–292. Liu, J., Lu, Y., Hua, W., et al., 2019. A new light on photosystem II maintenance in oxygenic photosynthesis. Front. Plant Sci. 10, 975. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative pcr and the 2−ΔΔCt method. Methods 25 (4), 402–408. Lohr, M., Wilhelm, C., 2001. Xanthophyll synthesis in diatoms: quantification of putative intermediates and comparison of pigment conversion kinetics with rate constants derived from a model. Planta 212 (3), 382–391. Lu, T., Shi, J.W., Sun, Z.P., et al., 2017. Response of linear and cyclic electron flux to moderate high temperature and high light stress in tomato. J. Zhejiang Univ. - Sci. B 18 (7), 635–648. Maheshi, D., Larkin, J.C., 2017. Making plants break a sweat: the structure, function, and evolution of plant salt glands. Front. Plant Sci. 8, 406. Matsumoto, F., Obayashi, T., Sasaki-Sekimoto, Y., et al., 2004. Gene expression profiling of the tetrapyrrole metabolic pathway in Arabidopsis with a mini-array system. Plant Physiol. 135 (4), 2379–2391. Messant, M., Timm, S., Fantuzzi, A., et al., 2018. Glycolate induces redox tuning of photosystem II in vivo: study of a photorespiration mutant. Plant Physiol. 177 (3), 1277–1285. Miyake, C., Miyata, M., Shinzaki, Y., et al., 2005. CO2 response of cyclic electron flow around PSI (CEF-PSI) in tobacco leaves–relative electron fluxes through PSI and PSII determine the magnitude of non-photochemical quenching (NPQ) of Chl fluorescence. Plant Cell Physiol. 46 (4), 629–637. Munekage, Y., Hojo, M., Meurer, J., Endo, T., Tasaka, M., Shikanai, T., 2002. PGR5 is involved in cyclic electron flow around photosystem I and is essential for photoprotection in Arabidopsis. Cell 110 (3), 361–371. Munekage, Y., Hashimoto, M., Miyake, C., et al., 2004. Cyclic electron flow around photosystem I is essential for photosynthesis. Nature 429 (6991), 579–582. Nandha, B., Finazzi, G., Joliot, P., et al., 2007. The role of PGR5 in the redox poising of photosynthetic electron transport. Biochim. Biophys. Acta Bioenerg. 1767 (10), 1252–1259. Nie, Z.J., Hu, C.X., Sun, X.C., et al., 2007. Effects of molybdenum on ascorbate-glutathione cycle metabolism in Chinese cabbage (Brassica campestris L. ssp. pekinensis). Plant Soil 295 (1–2), 13–21. Pan, X., Li, M., Wan, T., et al., 2011. Structural insights into energy regulation of lightharvesting complex CP29 from spinach. Nat. Struct. Mol. Biol. 18 (3), 309–315. Pang, Q.Y., Zhang, A.Q., Zang, W., et al., 2016. Integrated proteomics and metabolomics for dissecting the mechanism of global responses to salt and alkali stress in Suaeda corniculata. Plant Soil 402 (1–2), 1–16. Pieters, A.J., Tezara, W., Herrera, A., 2003. Operation of the xanthophyll cycle and degradation of D1 protein in the inducible CAM plant, Talinum triangulare, under water deficit. Ann. Bot. 92 (3), 393–399. Qiu, N., Lu, Q., Lu, C., 2003. Photosynthesis, photosystem II efficiency and the xanthophyll cycle in the salt‐adapted halophyte Atriplex centralasiatica. New Phytol. 159 (2), 479–486. Ruban, A.V., Horton, M.P., 1999a. The xanthophyll cycle modulates the kinetics of nonphotochemical energy dissipation in isolated light-harvesting complexes, intact chloroplasts, and leaves of spinach. Plant Physiol. 119 (2), 531–542. Ruban, A.V., Johnson, M.P., Landrum, J.T., et al., 2010. Xanthophylls as modulators of membrane protein function. Arch. Biochem. Biophys. 504 (1), 78–85. Ruiz, O.A., 2007. Modulation of polyamine balance in Lotus glaber by salinity and arbuscular mycorrhiza. Plant Physiol. Biochem. 45 (1), 39–46. Schaller, S., Latowski, D., Jemioła-Rzemińska, M., et al., 2011. Regulation of LHCII aggregation by different thylakoid membrane lipids. Biochim. Biophys. Acta Bioenerg. 1807 (3), 326–335. Shaheen, S., Naseer, S., Ashraf, M., et al., 2013. Salt stress affects water relations, photosynthesis, and oxidative defense mechanisms in Solanum melongena L. J. Plant Interact. 8 (1), 85–96. Shikanai, T., 2007. Cyclic electron transport around photosystem I: genetic approaches. Annu. Rev. Plant Biol. 58 (1), 199–217. Song, T., Xu, H., Sun, N., et al., 2017. Metabolomic analysis of alfalfa (Medicago sativa L.) root-symbiotic rhizobia responses under alkali Stress. Front. Plant Sci. 8, 1208. Sperdouli, I., Moustakas, M., 2015. Differential blockage of photosynthetic electron flow in young and mature leaves of Arabidopsis thalianaby exogenous proline. Photosynthetica 53 (3), 471–477. Sudhakar, C., Lakshmi, A., Giridarakumar, S., 2001. Changes in the antioxidant enzyme efficacy in two high yielding genotypes of mulberry (Morus alba L.) under NaCl salinity. Plant Sci. 161 (3), 613–619. Sunil, B., Saini, D., Bapatla, R.B., et al., 2018. Photorespiration is complemented by cyclic electron flow and the alternative oxidase pathway to optimize photosynthesis and protect against abiotic stress. Photosynth. Res. 1–13. Surabhi, G.K., Reddy, A.M., Kumari, G.J., et al., 2008. Modulations in key enzymes of nitrogen metabolism in two high yielding genotypes of mulberry (Morus alba L.) with differential sensitivity to salt stress. Environ. Exp. Bot. 64 (2), 171–179. Takagi, D., Amako, K., Hashiguchi, M., et al., 2017. Chloroplastic ATP synthase builds up proton motive force for preventing reactive oxygen species production in photosystem I. Plant J. 91 (2), 306–324. Takahashi, S., Badger, M.R., 2011. Photoprotection in plants: a new light on photosystem II damage. Trends Plant Sci. 16 (1), 53–60. Takahashi, S., Milward, S.E., Fan, D.Y., et al., 2009. How does cyclic electron flow alleviate photoinhibition in Arabidopsis? Plant Physiol. 149 (3), 1560–1567. Tikkanen, M., Grieco, M., Kangasjärvi, S., et al., 2010. Thylakoid protein phosphorylation in higher plant chloroplasts optimizes electron transfer under fluctuating light. Plant Physiol. 152 (2), 723–735. Wang, P., Duan, W., Takabayashi, A., et al., 2006a. Chloroplastic NAD(P)H

(10), 1102–1117. Ettinger, W.F., 1999. Identification of a Ca2+/H+ antiport in the plant chloroplast thylakoid membrane. Plant Physiol. 119 (4), 1379–1386. Evelin, H., Kapoor, R., Giri, B., 2009. Arbuscular mycorrhizal fungi in alleviation of salt stress: a review. Ann. Bot. 104 (7), 1263–1280. Foyer, C.H., Noctor, G., 1999. Leaves in the dark see the light. Science 284 (5414), 599–601. Frank, H.A., Cua, A., Chynwat, V., et al., 1994. Photophysics of the carotenoids associated with the xanthophyll cycle in photosynthesis. Photosynth. Res. 41, 389–395. Fromme, P., Melkozernov, A., Jordan, P., et al., 2003. Structure and function of photosystem I：interaction with its soluble electron carriers and external antenna systems. FEBS (Fed. Eur. Biochem. Soc.) Lett. 555 (1), 40–44. Gattward, J.N., Almeida, A.A.F., José, O., et al., 2012. Sodium-potassium synergism in Theobroma cacao: stimulation of photosynthesis, water-use efficiency and mineral nutrition. Physiol. Plant. 146, 350–362. Gilmore, A.M., 2010. Mechanistic aspects of xanthophyll cycle-dependent photoprotection in higher plant chloroplasts and leaves. Physiol. Plant. 99 (1), 197–209. Golding, A., Johnson, G., 2003. Down-regulation of linear and activation of cyclic electron transport during drought. Planta 218 (1), 107–114. Gong, B., Dan, W., Vandenlangenberg, K., et al., 2013. Comparative effects of NaCl and NaHCO3 stress on photosynthetic parameters, nutrient metabolism, and the antioxidant system in tomato leaves. Sci. Hortic. 157 (3), 1–12. Guo, R., Yang, Z.Z., Li, F., et al., 2015. Comparative metabolic responses and adaptive strategies of wheat (Triticum aestivum) to salt and alkali stress. BMC Plant Biol. 15 (1), 170. Hakala, M., Tuominen, I., Keränen, M., et al., 2005. Evidence for the role of the oxygenevolving manganese complex in photoinhibition of Photosystem II. Biochim. Biophys. Acta Bioenerg. 1706 (1), 68–80. Han, H., Gao, S., Li, B., Dong, X.C., Feng, H.L., Meng, Q.W., 2010. Overexpression of violaxanthin de-epoxidase gene alleviates photoinhibition of PSII and PSI in tomato during high light and chilling stress. J. Plant Physiol. 167 (3), 176–183. Han, X., Sun, N., Xu, M., Mi, H., 2017. Co-ordination of NDH and Cup proteins in CO2 uptake in cyanobacterium Synechocystis sp. PCC 6803. J. Exp. Bot. 68 (14), 3869–3877. Havaux, M., Dall, L., Bassi, R., 2007. Zeaxanthin has enhanced antioxidant capacity with respect to al other xanthophylls in Arabidopsis leaves and functions independent of binding to PSII antennae. Plant Physiol. 145, 1506–1520. Hong, Z., Lakkineni, K., Zhang, Z., et al., 2000. Removal of feedback inhibition of Δ1pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. Plant Physiol. 122 (4), 1129–1136. Hong, S.H., Lee, S.S., Chung, J.M., et al., 2017. Site-specific mutagenesis of yeast 2-Cys peroxiredoxin improves heat or oxidative stress tolerance by enhancing its chaperone or peroxidase function. Protoplasma 254 (1), 327–335. Hosseini, S.A., Hajirezaei, M.R., Christiane, S., et al., 2016. A potential role of flag leaf potassium in conferring tolerance to drought-induced leaf senescence in barley. Front. Plant Sci. 7, 206. Huang, W., Yang, S.J., Zhang, S.B., et al., 2012. Cyclic electron flow plays an important role in photoprotection for the resurrection plant Paraboea rufescens under drought stress. Planta 235 (4), 819–828. Huang, W., Yang, Y.J., Zhang, S.B., 2017. Specific roles of cyclic electron flow around photosystem I in photosynthetic regulation in immature and mature leaves. J. Plant Physiol. 209 (2), 76–83. Huang, W., Yang, Y.J., Zhang, S.B., et al., 2018. Cyclic electron flow around photosystem I promotes ATP synthesis possibly helping the rapid repair of photodamaged photosystem II at low light. Front. Plant Sci. 9, 239. Inès, S., Ghnaya, T., Messedi, D., et al., 2007. Effect of sodium chloride on the response of the halophyte species Sesuvium portulacastrum grown in mannitol-induced water stress. J. Plant Res. 120 (2), 291–299. Jin, X., Liu, T., Xu, J., et al., 2019. Exogenous GABA enhances muskmelon tolerance to salinity-alkalinity stress by regulating redox balance and chlorophyll biosynthesis. BMC Plant Biol. 19 (1), 48. Joët, T., Rumeau, D., Cournac, L., et al., 2000. Targeted inactivation of the plastid ndhB gene in tobacco results in an enhanced sensitivity of photosynthesis to moderate stomatal closure. Plant Physiol. 123 (4), 1337–1349. Kalituho, L., Beran, K.C., Jahns, P., 2007. The transiently generated nonphotochemical quenching of excitation energy in arabidopsis leaves is modulated by zeaxanthin. Plant Physiol. 143 (4), 1861–1870. Kato, Y., Sugimoto, K., Shikanai, T., 2018. NDH-PSI supercomplex assembly precedes full assembly of the NDH complex in chloroplast. Plant Physiol. 176 (2), 1728–1738. Katsube, T., Imawaka, N., Kawano, Y., et al., 2006. Antioxidant flavonol glycosides in mulberry (Morus alba L.) leaves isolated based on LDL antioxidant activity. Food Chem. 97 (1), 25–31. Kong, L., Sun, M., Xie, Y., et al., 2015. Photochemical and antioxidative responses of the glume and flag leaf to seasonal senescence in wheat. Front. Plant Sci. 6, 358. Kress, E., Jahns, P., 2017. The dynamics of energy dissipation and xanthophyll conversion in Arabidopsis indicate an indirect photoprotective role of zeaxanthin in slowly inducible and relaxing components of non-photochemical quenching of excitation energy. Front. Plant Sci. 8, 2094. Lehtimäki, N., Lintala, M., Allahverdiyeva, Y., et al., 2010. Drought stress-induced upregulation of components involved in ferredoxin-dependent cyclic electron transfer. J. Plant Physiol. 167 (12), 1018–1022. Li, X.P., Björkman, O., Shih, C., Grossman, A.R., et al., 2000. A pigment- binding protein essential for regulation of photosynthetic light harvesting. Nature 403, 391–395. Li, R., Shi, F., Fukuda, K., 2010. Interactive effects of various salt and alkali stresses on growth, organic solutes, and cation accumulation in a halophyte Spartina alterniflora (Poaceae). Environ. Exp. Bot. 68 (1), 66–74.

10

Ecotoxicology and Environmental Safety 190 (2020) 110164

Z. Huihui, et al.

functional leaf under drought stress. J. Plant Physiol. 215, 30–38. Zhang, J.T., Mu, C.S., 2009. Effects of saline and alkaline stress on the germination, growth, photosynthesis, ionic balance and anti-oxidant system in alkali-tolerant leguminous forage Lathyrus quinquenervius. Soil Sci. Plant Nutr. 55 (5), 685–697. Zhang, H.H., Zhang, X.L., Zhu, W.X., et al., 2011. Responses of photosystem II in leaves of mulberry to NaCl and Na2CO3 stress. J. Beijing For. Univ. 33 (6), 121–126. Zhang, H.H., Zhang, X.L., Li, X., et al., 2012. Effects of NaCl and Na2CO3 stresses on the growth and photosynthesis characteristics of Morus alba seedlings. Chin. J. Appl. Ecol. 23 (3), 625–631. Zhang, W.J., Yu, X.X., Li, M., et al., 2018a. Silicon promotes growth and root yield of Glycyrrhiza uralersis under salt and drought stresses through enhancing osmotic adjustment and regulating antioxidant metabolism. Crop Protect. 107, 1–11. Zhang, H.H., Li, X., Zhang, S.B., et al., 2018b. Rootstock alleviates salt stress in grafted mulberry seedlings: physiological and PSII Function responses. Front. Plant Sci. 9, 1806. Zhang, M.M., Fan, D.Y., Sun, G.Y., Chow, W.S., 2018c. Optimising the linear electron transport rate measured by chlorophyll a fluorescence to empirically match the gross rate of oxygen evolution in white light: towards improved estimation of the cyclic electron flux around photosystem I in leaves. Funct. Plant Biol. 45, 1138–1148. Zhang, Y., Kaiser, E., Zhang, Y., et al., 2018d. Short-term salt stress strongly affects dynamic photosynthesis, but not steady-state photosynthesis in tomato (Solanum lycopersicum). Environ. Exp. Bot. 149, 109–119. Zhang, H.H., Xu, N., Teng, Z.Y., et al., 2019a. 2-Cys Prx plays a critical role in scavenging H2O2 and protecting photosynthetic function in leaves of tobacco seedlings under drought stress. J. Plant Interact. 14 (1), 119–128. Zhang, H.H., Shi, G.L., Shao, J.Y., et al., 2019b. Photochemistry and proteomics of mulberry (Morus alba L.) seedlings under NaCl and NaHCO3 stress. Ecotoxicol. Environ Saf. 184 (30), 109624. Zhao, N., Wang, S., Ma, X., et al., 2016. Extracellular ATP mediates cellular K+/Na+, homeostasis in two contrasting poplar species under NaCl stress. Trees (Berl.) 30 (3), 825–837.

dehydrogenase in tobacco leaves functions in alleviation of oxidative damage caused by temperature stress. Plant Physiol. 141 (2), 465–474. Wang, R., Chen, S., Ma, H., et al., 2006b. Genotypic differences in antioxidative stress and salt tolerance of three poplars under salt stress. Front. For. China 1 (1), 82–88. Wang, Y., Jin, W.W., Che, Y.H., et al., 2019. Atmospheric nitrogen dioxide improves photosynthesis in mulberry leaves via effective utilization of excess absorbed light energy. Forests 10 (4), 312. Wu, H.F., Liu, X.L., You, L.P., et al., 2012. Effects of salinity on metabolic profiles, gene expressions, and antioxidant enzymes in halophyte Suaeda salsa. J. Plant Growth Regul. 31 (3), 332–341. Wu, X.Y., Shu, S., Wang, Y., et al., 2019. Exogenous putrescine alleviates photoinhibition caused by salt stress through cooperation with cyclic electron flow in cucumber. Photosynth. Res. 141 (3), 304–314. Xu, N., Zhang, H.H., Zhong, H.X., et al., 2018. The response of photosynthetic functions of F1 cutting seedlings from Physocarpus amurensis Maxim (♀) × Physocarpus opulifolius “Diabolo” (♂) and the parental leaves to salt stress. Front. Plant Sci. 9, 714. Yang, W.J., Rich, P.J., Axtell, J.D., et al., 2003. Genotypic variation for glycinebetaine in sorghum. Crop Sci. 43 (1), 162–169. Yang, C., Zhang, Z.S., Gao, H.Y., et al., 2014. The mechanism by which NaCl treatment alleviates PSI photoinhibition under chilling-light treatment. J. Photochem. Photobiol. B Biol. 140, 286–291. Yuan, F., Lyu, M.J.A., Leng, B.Y., et al., 2015. Comparative transcriptome analysis of developmental stages of the Limonium bicolor leaf generates insights into salt gland differentiation. Plant Cell Environ. 38 (8), 1637–1657. Yuan, R.N., Shu, S., Guo, S.R., et al., 2017. The positive roles of exogenous putrescine on chlorophyll metabolism and xanthophyll cycle in salt-stressed cucumber seedlings. Photosynthetica 56 (2), 1–10. Yue, W., Xin, J., Weibiao, L., et al., 2018. 5-aminolevulinic acid (ALA) alleviated salinity stress in cucumber seedlings by enhancing chlorophyll synthesis pathway. Front. Plant Sci. 9, 635. Zahoor, R., Zhao, W., Abid, M., et al., 2017. Title: potassium application regulates nitrogen metabolism and osmotic adjustment in cotton (Gossypium hirsutum L.)

11