- Email: [email protected]
Chloroplast DNA diversity in Castanopsis hystrix populations in south China
Forest Ecology and Management 243 (2007) 94–101 www.elsevier.com/locate/foreco
Chloroplast DNA diversity in Castanopsis hystrix populations in south China J. Li a,b, X.J. Ge a,c, H.L. Cao a, W.H. Ye a,* a
South China Botanical Garden, The Chinese Academy of Sciences, Guangzhou 510650, PR China b Graduate School of the Chinese Academy of Sciences, Beijing 100049, PR China c School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China Received 8 July 2005; received in revised form 4 February 2007; accepted 23 February 2007
Abstract Nineteen Chinese populations of Castanopsis hystrix were examined to quantify genetic diversity and genetic structure at chloroplast DNA. Microsatellites (SSR) were analyzed by PCR using conserved primers. The average within population gene diversity (HS), the total gene diversity (HT), and the differentiation for unordered alleles (GST) and for ordered alleles (NST) were measured. Fourteen different haplotypes were detected, two of them very common. The level of differentiation among populations (GST = 23.6%) indicates a highly efficient seed dispersal mechanism. In addition, the difference between GST and NST for the species is not significant, suggesting that the phylogeographic structure is weak or absent. The geographical pattern of C. hystrix haplotypes could be attributed to its migration from the numerous and scattered refugia, where the species confined during the last glacial period. These results provide an important insight into patterns of postglacial recolonization of this tree species. # 2007 Elsevier B.V. All rights reserved. Keywords: cpDNA; SSR; Genetic differentiation; Castanopsis hystrix
1. Introduction The modern distribution of plant and animal taxa is determined not only by the current environment, but also by historic events such as the last glacial period (Hengeveld, 1989). Although the land in south China has never been covered by ice sheets, the tremendous temperature and climatic changes might have influenced species’ distributions and evolution. The Holocene postglacial history of many trees is characterized by the northward expansion of southern refugial populations following the retreat of the ice sheets. The last glacial age might have been an important factor in determining the genetic structure and phylogeography of plant species in south China. Fossil pollen deposits can be used to reconstruct long-term vegetation dynamics, such as changes in the distribution and abundance of plant species during the quaternary period. But for the species which produce only small amount of pollen grains, occurrences of their pollen grains in the fossil pollen record may be therefore too infrequent to allow detailed
* Corresponding author. Tel.: +86 20 37252996. E-mail addresses: [email protected] (J. Li), [email protected] (W.H. Ye). 0378-1127/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.foreco.2007.02.012
reconstruction of the species’ past range and migration patterns. An alternative approach to the study of postglacial changes in plant distributions developed in recent years is the use of molecular markers (Ferris et al., 1999; Hewitt, 1999). Currently existing plant populations are expected to retain the genetic traces resulting from the migration routes they followed during the past, which could be revealed by studying the spatial distribution pattern of molecular markers. Chloroplast markers have been widely applied to studies of population history in trees (e.g. Walter and Epperson, 2001; Rendell and Ennos, 2003; Cheng et al., 2005). Firstly, because chloroplast genomes are haploid, their effective population size in monoecious outcrossing plants is half of diploid nuclear genomes. As a result, chloroplast-specific markers are considered good indicators of historical bottlenecks, founder effects and genetic drift. The use of chloroplast microsatellites has allowed the examination of these events at a finer level of detail than it was previously possible. Secondly, because chloroplasts evolve slowly and exhibit little variation at the intraspecific level (Clegg et al., 1994), cpDNA markers have been widely used for phylogenetic inference (Olmstead and Palmer, 1994) and to some extent, for within-species genetic studies (Soltis et al., 1992; Ennos et al., 1999). However, microsatellite markers are
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
also used to find fine-scale polymorphism because of their highly polymorphic nature (Jarne and Lagoda, 1996; Powell et al., 1996). Thirdly, chloroplast DNA is maternally inherited, i.e. through the seeds in most angiosperms (Dumolin et al., 1995; Rajora and Dancik, 1992; Mogensen, 1996). Therefore cpDNA, which generally reflects seed dispersal and maternal gene flow, is an effective tool for genetic variation studies and for identifying postglacial migration routes (McCauley, 1994). Finally, the geographically structured cpDNA variations permit the elucidation of evolutionary history and the study of intraspecific phylogeography (Soltis et al., 1997). Castanopsis hystrix (Fagaceae) is an evergreen tree species, as one of fagaceous species originated in the south China and Indochina (Li, 1996). The present-day distribution of C. hystrix in China extends from Taiwan, along Fujian, Guangdong, Guangxi, Yunnan, to south Tibet, expanding southwards as far as Hainan island. C. hystrix is one of the most important and dominant species of the evergreen broad-leaved forests in subtropical China. The extensive use of C. hystrix wood for many purposes, such as construction and boat building, resulted in the fragmentation of the once continued and broad natural distribution and thus in population shrinkage and possible genetic erosion. For both conservation and forestry management, therefore it is essential to be able to assess C. hystrix’s genetic diversity. Although pollen data show that the C. hystrix forests were present in southern China through the quaternary period, some reduction occurred in glacial period (Zheng, 1991; Sun et al., 1999; Sun and Li, 1999; Zheng and Lei, 1999; Zheng et al., 2004) and the information of its genetic diversity and population history is very limited. Main objective of the present study was to assess the cpDNA variation and diversity among and within C. hystrix natural populations, to investigate whether its genetic diversity follows a geographic pattern and discuss the forces and events that led to this pattern.
95
Table 1 The studied populations of Castanopsis hystrix Population no.
Population name
Province region
Latitude
Longitude
Altitude (m)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Jianfengling Nanjing Nanhuasi Deqing Jintong Zijin Yanyang Huadu Heyuan Enping Luofushan Gongcunzhang Longsheng Jinxiu Damingshan Xishuangbanna Simao Xichou Maguan
Hainan Fujian Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangxi Guangxi Guangxi Yunnan Yunnan Yunnan Yunnan
188440 N 248310 N 248330 N 238130 N 228240 N 238420 N 248150 N 238240 N 238210 N 228150 N 238160 N 238270 N 258500 N 248080 N 238100 N 218520 N 248160 N 238250 N 238060 N
1088520 E 1178210 E 1138410 E 1118560 E 1108440 E 1148540 E 1168110 E 1138110 E 1148320 E 1128060 E 1148030 E 1158230 E 1098530 E 1108110 E 1088160 E 1008260 E 1008480 E 1048410 E 1048020 E
900 300 120 350 350 150 150 200 120 150 100 200 200 300 450 350 1900 1600 1700
2. Materials and methods
grams of the dried leaves were submerged in liquid nitrogen, and then ground into powder, added to 750 ml of 2 CTAB (2% (w/v) hexadecylcetytrimethylammonium bromide) in a 1.5 ml centrifuge tube and incubated at 65 8C for 45–60 min. A volume of 750 ml of 24:1 chloroform:iso-amyl alcohol was added. The tubes were mixed evenly and centrifuged at 10,000 rpm for 10 min. The top layer was pipetted into a clean tube, and the above step was repeated. Finally the supernatant was transferred to a clean tube to which 600 ml of isopropanol and 150 ml of sodium chloride were added. It was kept at 20 8C for more than 30 min and centrifuged at 10,000 rpm for 10 min. The supernatant was discarded and the precipitate was washed with 500 ml of 75% ethanol two times, dried at room temperature and then dissolved in 100 ml of TE (Tris–EDTA buffer, pH 8).
2.1. Collection of samples
2.3. Chloroplast microsatellites
Nineteen populations of C. hystrix (380 individuals), comprising 20 individuals per population, were sampled in south China (Table 1 and Fig. 1). Sample collections covered most of the known populations for this species in mainland China. To avoid sampling clones or close relatives, all individuals chosen were separated by at least 20 m, except for the population Yanyang which is a very small population (the respective number 7), where the least distance between plants was 10 m based on the sample size and the availability. Approximately 15 leaves per individual were sampled. Leaf material collected in the field was dried immediately using silica gel and stored at room temperature until DNA extractions were completed.
Because the chloroplast genome is haploid and does not undergo recombination it can be viewed as a single locus and all sequence variation can be interpreted as giving rise to different haplotypes of the genome. The chloroplast genome may alternatively be viewed as a circular haploid chromosome wherein sequence variation generates different alleles within the individual (nonrecombining loci). In either case, for ease of presentation and discussion, we used the terms ‘locus’ to refer to a cpSSR site (defined by the termini of a PCR primer pair), and ‘alleles’ to refer to length variants at a cpSSR site. Seven universal primers described in Weising and Gardner (1999) and Chung (2002) were used in this study (Table 2). Four of these primers are flanking angiosperm chloroplast microsatellites and the remaining three are flanking cucumber chloroplast microsatellites. PCR amplification was performed in a 20 ml reaction mixture consisting of 50 ng of template DNA, 10 mM of Tris–HCl (pH 9.0), 50 mM of KCl, 0.1%
2.2. DNA extraction Genomic DNA was extracted following the cetyltrimethyl ammonium bromide procedure (Doyle, 1991). One to two
96
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Fig. 1. Relative position of populations sampled and geographic distribution of the haplotypes identified with cpDNA markers. Numbers corresponding to populations are given in Table 1.
Table 2 Primers used in this study Primer
Sequence 50 –30
Annealing temperature(8C)
Reference
Ccmp3 Ccmp4 Ccmp6 Ccmp10 ccSSR3 ccSSR4 ccSSR8
CAGACCAAAAGCTGACATAGGTTTCATTCGGCTCCTTTAT CCAAAATATTBGGAGGACTCTAATGCTGAATCGAYGACCTA CGATGCATATGTAGAAAGCCCATTACGTGCGACTATCTCC TTTTTTTTTAGTGAACGTGTCATTCGTCGDCGTAGTAAATAG CCAAAAGCTGACATAGATGTTATTTCATTCGGCTCCTTTATG AGGTTCAAATCCTATTGGACGCATTTTGAAAGAAGCTATTCARGAAC TTGATCTTTACGGTGCTTCCTCTATCATTACGTGCGACTATCTCC
48 51 49 48 54 53 58
Weising and Gardner Weising and Gardner Weising and Gardner Weising and Gardner Chung (2002) Chung (2002) Chung (2002)
(1999) (1999) (1999) (1999)
temperature, and 72 8C extension for 45 s, followed by 5 min final extension at 72 8C. PCR products were separated on 6% denaturing polyacrylamide gels stained with silver nitrate and were sized by comparison to a 50-base pair (bp) DNA ladder standard (Invitrogen).
Triton X-100, 1.5 mM of MgCl2, 0.2 mM of dNTPs, 0.2 mM of each primer, and 0.7 unit of Taq DNA polymerase. The reaction mixture was subjected to amplification using MJ PTC-100 Thermal Cycler for an initial denaturing step for 1 min at 94 8C, 35 cycles of denaturation at 94 8C for 15 s, 45 s of annealing
Table 3 Haplotype definition resulting from the combination of 18 microsatellite alleles recorded in 7 polymorphic loci (1 denotes the presence and 0 the absence of a fragment from its expected position on a gel) Code
H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14
Ccmp6
Ccmp3
Ccmp4
Ccmp10
ccSSR8
ccSSR3
ccSSR4
1
2
1
2
1
2
3
1
2
1
2
3
1
2
3
1
2
3
0 0 1 0 0 0 0 0 0 0 0 1 0 0
1 1 0 1 1 1 1 1 1 1 1 0 1 1
1 1 1 1 1 1 1 1 1 1 1 1 1 0
0 0 0 0 0 0 0 0 0 0 0 0 0 1
0 0 0 1 1 0 0 0 1 1 0 1 0 0
1 1 1 0 0 1 1 1 0 0 1 0 1 1
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 1 0 0 0 0 0 0 1 0 1 0 0 0
1 0 1 1 1 1 1 1 0 1 0 1 1 1
0 0 0 0 0 0 1 0 0 0 0 0 0 0
1 1 1 1 1 1 0 1 0 1 1 1 1 1
0 0 0 0 0 0 0 0 1 0 0 0 0 0
0 0 0 0 0 0 0 0 0 1 0 0 1 0
1 1 1 1 1 1 1 1 1 0 1 1 0 1
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 1 0 0 0 0 1 0 0 0
1 1 1 1 1 0 1 0 1 1 0 1 1 1
0 0 0 0 0 0 0 1 0 0 0 0 0 0
0.521 0.208 0.016 0.042 0.047 0.042 0.034 0.016 0.024 0.016 0.018 0.003 0.011 0.003 4 4
2
6
10 2 10 2
6 1
1
2 1 2 1
6
1
1
13 1 1 5 1 16 1 4 15 1
4
1 4
4
3
1
1
3
1 1
1
3 3 2
20 9 3 12 5 14 1 13 7 4
1 5
Haplotypes code. Numbers corresponding to populations are given in Table 1. a
b
1 1 2
1 2 5
2
97
2.4. Data analysis
20 15 4 10 4 2 1 13 2 2 12 10 5
H1 H2 17 H3 2 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20)
Population b Ha
Table 4 Haplotypes frequency in 19 populations of C. hystrix
Total (n = 380) (%)
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Diversity and differentiation parameters used in this study included the average intrapopulation diversity (HS), total diversity (HT), and the differentiation for unordered alleles (GST) and for ordered alleles (NST). They were quantified according to Pons and Petit (1995, 1996) using the program PERMUT. GST depends only on haplotype frequencies, whereas NST takes into consideration genetic similarities between haplotypes. These two parameters were compared by a permutation test, using 1000 permutations (Burban et al., 1999). The following population genetic parameters were computed for each population using Arlequin v.2.000 (Schneider et al., 2000): number of haplotypes (nh), number of polymorphic loci (np), and Nei’s unbiased haplotypic diversity (He; Nei, 1987). The population genetic structure of C. hystrix was calculated within the analysis of molecular variance (AMOVA) framework (Excoffer et al., 1992; Excoffier and Smouse, 1994). A hierarchical analysis of variance was used to partition the total variance into covariance components consisting of within population variation, variation among populations within regions, and variation among regions. The significance of covariance components was tested using permutation tests (1000 permutations) at different levels (haplotypes among populations among regions, haplotypes among populations within regions and populations among regions). Only P-values lower than 0.05 were considered significant. Nei’s unbiased genetic distance was calculated for all population pairs (Nei, 1978) using the PopGen1.32 program. To estimate the amount of gene flow among populations, the number of migrants exchanged per generation, Nm, was calculated indirectly from GST values at each locus and from the average values over all loci by applying McDermott and McDonald’s (1993) formula: Nm = (1GST)/2GST, where N is the effective population size and m is the proportion of migrants exchanged per generation. The neighbor joining (Saitou and Nei, 1987) dendrogram was computed using Nei’s (1978) genetic distance based on cpSSRs data with the MEGA 3.0 software (Kumar et al., 2004). Mantel’s test (Mantel, 1967) was applied to examine whether genetic and geographic distance matrices correlate significantly (Bohonak, 2002). 3. Results The number of alleles per polymorphic cpSSR locus ranged from 2 to 3. A total of 18 size variants at the 7 loci were identified. The 18 size variants combined in 14 different haplotypes (Table 3). In Table 4 the frequency of haplotypes in the 19 C. hystrix populations is presented. Fig. 1 showed that Haplotype H1 was particularly common in every population (52.1% for the whole sample) except those in Jianfengling (1) where H1 was not present; and in Jianfengling (1), Nanhuasi (3) and Xishuangbanna (16) where H2 was dominant. H2 was the second most frequent haplotype (20.8%) that occurred in 15 populations throughout the distribution of C. hystrix (Fig. 1).
98
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Table 5 Genetic diversity within different populations of C. hystrix Province region
Population
nh
np
He
Hainan
1
3
6
0.279
Fujian
2
3
6
0.658
3 4 5 6 7 8 9 10 11 12
4 5 6 3 1 5 3 5 5 5
8 8 8 4 0 8 4 7 8 8
0.595 0.574 0.721 0.416 0.000 0.795 0.542 0.505 0.600 0.758
4.2
6.3
0.551
Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Average Guangxi Guangxi Guangxi
13 14 15
Average Yunnan Yunnan Yunnan Yunnan
16 17 18 19
Average
1 5 6
0 8 11
0.000 0.442 0.805
4
6.33
0.416
5 4 4 4
10 4 6 6
0.368 0.537 0.695 0.674
4.25
6.5
0.569
Numbers corresponding to populations are given in Table 1.
Haplotype H12 and H14 were only found in Jinxiu (14) and Jianfengling (1), respectively. Haplotype H8 and H13 were only found in Guangdong. All other haplotypes showed distributions spanning in two to four provinces. Population Yanyang (7) and Longsheng (13) were monomorphic for haplotype 1. Table 5 shows that the haplotypic diversity (He) was the lowest in the population Janfengling (1). At the regional scale (all 19 populations), the total chloroplast DNA diversity (HT) and mean within population diversity (HS) were 0.686 (S.E. = 0.0496) and 0.524 (S.E. = 0.0536), respectively, and the differentiation among populations (GST) was 23.6%. The level of differentiation among populations taking into account of distances between haplotypes was not significantly different from GST (NST = 23.8%). NST was calculated to investigate whether related haplotypes were clustered in their geographical distribution. This result suggested that groups of related C. hystrix haplotypes were not restricted to particular geographical regions. In addition, in Table 6 the AMOVA highlighted the high levels of genetic Table 6 Analysis of molecular variance (AMOVA) Source of variation
d.f.
Variance
%
F statistics
P
Among regions Among populations within regions Within populations
4 14
0.05 0.20
5.01 19.98
FCT = 0.05 FSC = 0.21
0.1554 <0.001
361
0.76
75.01
FST = 0.25
<0.001
Fig. 2. The neighbor-joining dendrogram computed using Nei’s (1978) genetic distance based on cpSSRs data showing genetic differentiation levels. Numbers corresponding to populations are given in Table 1.
differentiation among populations within regions (19.98% of the total variation; FSC = 0.21) and within populations (75.01%; FST = 0.25). Only 5.01% (FCT = 0.05) of the total variation existed among regions. The genetic distance between populations ranged from 0.0002 to 0.1203 (Table 7). The negative genetic distance values may be caused by sampling error (Nei, 1978). From the Nei’s matrix, it was interesting to note that the highest genetic distance was between Jianfenglin (1) and Heyuan (9), 0.1203 (Table 7), although geographical distance between them was not the largest. The neighbor-joining dendrogram (Fig. 2) showed genetic relationships among populations and clustered into two groups. The upper one included 15 populations, in which population Huadu (8), Maguan (19), Gongcunzhang (12), Jinxiu (14), Simao (17) formed a subgroup, followed by a subgroup composed of population Heyuan (9), Yanyang (7), Longsheng (13). Then all these populations plus population Deqing (4), Enping (10), and Xichou (18) connected with population Zijin (6), Luofushan (11), Jintong (5), Nanjing (2) hierarchically. Instead, the lower one included four populations. Except population Nanhuasi (3), population Jianfengling (1), Xishaungbanna (16) and Damingshan (15) distributed in the southern part of the sampling area and along coast line. Effects of geographical isolation on population structure can be studied through the correlation of genetic and geographical distances and also through the application of the nested clade analysis. The Mantel tests for independence between geographic and genetic distance were nonsignificant (P > 0.10). Therefore, simple differentiation models as isolation by distance or stepping-stone colonization models can be rejected. The physiography of the territory or differences in dispersal across the sea (i.e. between islands and lands) and across land (i.e. among populations within lands) could confound simple isolation by distance models.
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
99
Table 7 Nei’s unbiased measures of genetic distance Population no. 1
2
3
4
5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
0.0174 0.0271 0.0186 0.0214 0.0409 0.0243 0.0518 0.0234 0.0192 0.0307 0.0409 0.0313 0.0352 0.0320 0.0438 0.0366 0.0289
0.0415 0.0215 0.0302 0.0560 0.0527 0.0603 0.0462 0.0229 0.0431 0.0560 0.0489 0.0003 0.0133 0.0549 0.0400 0.0609
0.0074 0.0019 0.0021 0.0158 0.0047 0.0013 0.0031 0.0022 0.0021 0.0003 0.0531 0.0896 0.0116 0.0053 0.0113
0.0019 0.0117 0.0039 0.0261 0.0215 0.0247 0.0191 0.0109 0.0058 0.0270 0.0074 0.0026 0.0042 0.0184 0.0119 0.0010 0.0009 0.0064 0.0206 0.0110 0.0045 0.0066 0.0057 0.0048 0.0110 0.0089 0.0059 0.0062 0.0117 0.0039 0.0000 0.0247 0.0058 0.0042 0.0064 0.0048 0.0102 0.0047 0.0021 0.0121 0.0081 0.0031 0.0065 0.0006 0.0021 0.0295 0.0420 0.0681 0.0710 0.0692 0.0595 0.0328 0.0521 0.0681 0.0609 0.0522 0.0679 0.1089 0.0900 0.1193 0.0918 0.0593 0.0923 0.1089 0.1003 0.0235 0.0065 0.0105 0.0100 0.0306 0.0177 0.0140 0.0125 0.0043 0.0100 0.0090 0.0637 0.0967 0.0089 0.0065 0.0081 0.0337 0.0114 0.0040 0.0062 0.0092 0.0081 0.0086 0.0436 0.0962 0.0184 0.0278 0.0198 0.0187 -0.0008 0.0236 0.0138 0.0209 0.0092 0.0187 0.0074 0.0795 0.1069 0.0296 0.0285 ****
0.0383 0.0177 0.0917 0.0515 0.0683 0.1088 0.0943 0.1203 0.0945 0.0603 0.0932 0.1088 0.1021 0.0283 0.0002 0.0926 0.0998 0.1118
6
7
8
9
10
11
12
13
14
15
16
17
18
19
Numbers corresponding to populations are given in Table 1. The negative genetic distance values may be caused by sampling error. ****represents no genetic distance.
4. Discussion 4.1. Chloroplast haplotype diversity Population genetic diversity in C. hystrix was indicated using cpSSR markers. The highest level of haplotypic diversity was concentrated in population Damingshan (15), Guangxi province. Populations distributed in Guangdong province (Jintong (5), Huadu (8), Gongcunzhang (12)) were also the hotspots of haplotypic diversity. It is generally believed that regions with high levels of diversity could either be identified as potential refugia, i.e. areas with stable ecological habitat during environmental changes harboring the accumulated genetic diversity, or as intermediate zones where organisms from different sources or regions intermix, resulting in higher genetic diversity than that recorded in the original sources (Tzedakis et al., 2002; Petit et al., 2003). Thus, these populations should be among the first ones considered for conservation in the framework of a conservation strategy for C. hystrix. An important result of this study was the maintenance of a high within population diversity for cpDNA in C. hystrix, compared with low between population differentiation (GST = 0.24). The lack of genetic structure in C. hystrix might be the consequence of several factors. C. hystrix’s nuts are high in starch and protein, which make them good food resources for birds and animals. Ingestion of these fruits by animals allows long distance nuts dissemination (Fineschi et al., 2005). It has been reported that birds often prey nuts on the crown of trees of C. hystrix (Xiao et al., 2001) and thus they play an important role in long-seed dispersal. In addition, a number of acorns of species in Fagaceae fall on ground and remain in the litter, which become important food resources for little mammals, especially rodents. Rodents are generally believed to prefer loose substrates and can travel long distances to find the right
place to secure their food. A previous study found that some mice such as Niviventer confucianus, N. fulvescens, Berylmys bowersi can transport acorns (Xiao et al., 2001). Above all, the large potential for gene flow through nut dispersal between populations would reduce genetic drift and population differentiation of C. hystrix. In addition to high gene flow, biological (time to sexual reproduction) and historical (glaciation) factors had effects on the genetic structure of cpSSRs in C. hystrix. Under different colonization models, Austerlitz et al. (2000) demonstrated that founder effects were reduced by delayed reproduction in forest trees, and thus resulted in small genetic differentiation among populations before glaciation and colonization of refugia. In C. hystrix, the high Nm between populations and low genetic differentiation due to shared dominant alleles and heterogeneous composition of organelle DNAs within each population were consistent with a migrant-pool model (Wade and McCauley, 1988). This unusual model presented a migratory pattern with colonists recruited from a random sample of previously existing populations and was believed to be associated with glaciation or vicariance events (Wade and McCauley, 1988). 4.2. Geographical distribution of cpDNA and colonization history In the present study, none of the populations clustered together according to their geographical location, which could be due to several reasons. First, disjunctive distribution of haplotypes arose from the disappearance of intermediate populations as a consequence of climate deterioration (Csaikl et al., 2002). Second, it was likely due to the colonization of these regions from different source populations. Finally, a different seed-dispersal condition also contributed to this discontinuity between adjacent populations.
100
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
The coalescent theory states that the most frequent and widespread haplotypes are ancestral and indicate the location of refugial populations (Crandall and Templeton, 1993). The most frequent cpDNA haplotype H1 with a cumulative frequency of 52.1% was present in all populations except for the population Jianfengling (1), suggesting that it was the ancestral haplotype and there were many scattered refugia for C. hystrix in south China. Meantime, most rare haplotypes refer to recent mutational derivatives of some other haplotypes because they are of recent evolutionary origin (Donnelly and Tavare´, 1986). Presumably, the patchy distribution of rare haplotypes H12–14 suggested recent mutation events and the haplotype H13 found in population Heyuan (9) and Luofushan (11) had been distributed during population expansion from refugia. Human activities were suggested to play an important role in shaping the present distribution pattern of cpDNA haplotypes of C. hystrix. The introduction of nonautochthonous material is particularly evident where there is a large geographic distance between the stand and the region where the corresponding haplotype occurs at high frequency (Ko¨nig et al., 2002). Our data supported the influence of human activities on the geographic distribution of cpDNA haplotypes. For instance, haplotype H2 was dominant in populations Jianfengling (1), Nanhuasi (3) and Xishuangbanna (16). These three populations distributed far away from each other. Among them, population Nanhuasi (3) distributed in the almost northernmost part of the distribution area of C. hystrix. It could not have grown there with large amount under normal conditions. On the contrary, our observation indicated that population Nanhuasi (3) was a Fengshui woods (forests near villages preserved for reasons of fengshui—Chinese geomantic practice for configuration of sites) with a large size. Considering that C. hystrix as a precious timber tree species has been used for thousands of years (Zheng, 2000), the case of population Nanhuasi (3) strongly suggested that it was the remnants of forests planted by people in history. Therefore, human activities could become another significant factor contributing to the disjunctive distributions of haplotypes. This geographical pattern of haplotypes of C. hystrix could be related to the quaternary history of the subtropical broadleaved evergreen forests. During ice ages, subtropical forests could retreat into wet and warmer lowland areas or on rainy slopes of mountainous areas, namely refugia. These areas might have been numerous and scattered, contrary to the situation in Europe, where refugia were restricted to three zones in southern latitudes (Bennett et al., 1991). This situation was also different from the results of study on C. carlesii, one congeneric species with C. hystrix, in Taiwan (Cheng et al., 2005), showing that two potential refugia for C. carlesii were separated by the Central Mountain Range (CMR) during the last glaciation in Taiwan. By contrast, the southern part of mainland China was relatively flat with hills <150 m a.s.l., with some isolated mountains during the last glacial maximum (LGM) (Sun et al., 2000). Thus, the distribution of C. hystrix in mainland China was unlikely isolated by the high mountain barrier because its distribution
was considerably higher than 150 m. Instead, zones of high specific richness and endemism have been reported, which could represent refugia of quaternary in south China. Longdistance seed dispersal during the glacial maximum, which allowed surviving individuals to invade these numerous refugia, played a key role in maintaining genetic heterogeneity within geographical populations. Colonists from different source populations were forced to migrate into refugia. During the interglacial periods, subtropical forests expanded again from refugia. Because of the scattered distribution of refugial zones in the subtropics and the admixture of different source populations, the geographical pattern of cpDNA haplotyps was expected to be more complex. 4.3. Future work The current work sampled a large distribution range of C. hystrix. Unfortunately, two important regions (Tibet and Taiwan) remain unsampled. Current work provided an initial suggestion of the genetic diversity and structure. In order to illustrate them more clearly and discover the consequences of alternating glacial/post-glacial events, it is necessary for a further sampling effort in the whole distribution range. Acknowledgements The authors thank Dr. Jian-Wen Zou, Andrew Lowe, ZhangMing Wang, Zheng-Feng Wang, Summer Nijjer for revising the manuscript. The authors are grateful to two anonymous reviewers for helpful comments on the manuscript. This work is supported by the Director Fund of South China Botanical Garden, the Chinese Academy of Sciences. References Austerlitz, F., Mariette, S., Machon, N., Gouyon, P.H., Godelle, B., 2000. Effects of colonization processes on genetic diversity: differences between annual plants and tree species. Genetics 154, 1309–1321. Bennett, K.D., Tzedakis, P.C., Willis, K.J., 1991. Quaternary refugia of the North European trees. J. Biogeogr. 18, 103–115. Bohonak, A.J., 2002. IBD (isolation by distance): a program for analyses of isolation by distance. J. Hered. 93 (2), 153–154. Burban, C., Petit, R.J., Carcreff, E., Jactel, H., 1999. Rangewide variation of the maritime pine bast scale Matsucoccus feytaudi Duc. (Homoptera: Matsucoccidae) in relation to the genetic structure of its host. Mol. Ecol. 8, 1593–1602. Cheng, Y.P., Hwang, S.Y., Lin, T.P., 2005. Potential refugia in Taiwan revealed by the phylogeographical study of Castanopsis carlesii Hayata (Fagaceae). Mol. Ecol. 14, 2075–2085. Chung, S., 2002. The use of cpDNA SSR markers and sequenced fragments for comparative analysis of genetic relationships within the Cucurbitaceae and the inheritance of chilling injury in cucumber (Cucumis sativus L.). PhD Thesis. Plant Breeding and Plant Genetics, University of Wisconsin, Madison, WI. Clegg, M.T., Gaut, B.S., Learn, G.H., Morton, R.R., 1994. Rates and pattern of chloroplast DNA evolution. Proc. Natl. Acad. Sci. U.S.A. 91, 6795– 6801. Crandall, K.A., Templeton, A.R., 1993. Empirical tests of some predictions from coalescent theory with applications to intrasepcfic phylogeny reconstruction. Genetics 134, 959–969.
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101 Csaikl, U.M., Glaz, I., Baliuckas, V., Petit, R.J., Jensen, J.S., 2002. Chloroplast DNA variation of white oak in the Baltic countries and Poland. Forest Ecol. Manage. 156, 211–222. Donnelly, P., Tavare´, 1986. The ages of alleles and a coalescent. Adv. Appl. Probab. 18, 1–19. Doyle, J.J., 1991. DNA protocols for plants—CTAB total DNA isolation. In: Hewitt, G.M., Johnston, A. (Eds.), Molecular Techniques in Taxonomy. Springer, Berlin, pp. 283–293. Dumolin, S., Demesure, B., Petit, R.J., 1995. Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Theor. Appl. Genet. 91, 1253–1256. Ennos, R.A., Sinclair, W.T., Hu, X.S., Langdon, A., 1999. Using organelle markers to elucidate the history, ecology and evolution of plant populations. In: Hollingsworth, P.M., Bateman, R.M., Gornall, R.J. (Eds.), Molecular Systematics and Plant Evolution of Plant Populations. Taylor & Francis Ltd., London, pp. 1–19. Excoffier, L., Smouse, P.E., 1994. Using allele frequencies and geographic subdivision to reconstruct gene trees within a species: molecular variance parsimony. Genetics 136, 343–359. Excoffer, L., Smouse, P.E., Quattro, L.M., 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes, applications to human mitochondrial DNA restriction data. Genetics 131, 479–491. Ferris, C., King, R.A., Hewitt, G.M., 1999. Isolation within species and history of glacial refugia. In: Hollingsworth, P.M., Bateman, R.M., Gornall, R.J. (Eds.), Molecular Systematics and Plant Evolution. Taylor & Francis, London, pp. 20–34. Fineschi, S., Salvini, D., Turchini, D., Pastorelli, R., Vendramin, G.G., 2005. Crataegus monogyna Jacq. and C. laevigata (Poir.) DC. (Rosaceae, Maloideae) display low level of genetic diversity assessed by chloroplast markers. Plant Syst. Evol. 250, 187–196. Hengeveld, R., 1989. Dynamics of Biological Invasions. Chapman & Hall, London. Hewitt, G.M., 1999. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc. 68, 87–112. Jarne, P., Lagoda, P.J.L., 1996. Microsatellites, from molecules to populations and back. Trends Ecol. Evol. 11, 424–429. Ko¨nig, A.O., Ziegenhagen, B., van Dam, B., Csaikl, U.M., Coart, E., Burg, K., Degen, B., de Vries, S.M.G., Petit, R.J., 2002. Chloroplast DNA variation of oaks in western central Europe and the genetic consequences of human influences. Forest Ecol. Manage. 156, 147–166. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Li, J.Q., 1996. The origin and distribution of the family Fageceae. Acta Phytotaxon. Sin. 34 (4), 376–396. Mantel, N., 1967. The detection of disease clustering and a generalized regression approach. Cancer Res. 27, 209–220. McCauley, D.E., 1994. Contrasting the distribution of chloroplast DNA and allozyme polymorphism among local populations of Silene alba: implications for studies of gene flow in plants. Proc. Natl. Acad. Sci. U.S.A. 91, 8127–8131. McDermott, J.M., McDonald, B.A., 1993. Gene flow in plant pathosystems. Annu. Rev. Phytopathol. 31, 353–373. Mogensen, H.L., 1996. The hows and whys of cytoplasmic inheritance in seed plants. Am. J. Bot. 83, 383–404. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Nei, M., 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. Olmstead, R.G., Palmer, J.D., 1994. Chloroplast DNA systematics: a review of methods and data analysis. Am. J. Bot. 81, 1205–1224.
101
Petit, R.J., Aguinagalde, I., de Beaulieu, J.L., Bittkau, C., Brewer, S., Cheddadi, R., Ennos, R., Fineschi, S., Grivet, D., Lascoux, M., Mohanty, A., Mu¨llerStarck, G., Demesure-Musch, B., Palme´, A., Martı´n, J.P., Rendell, S., Vendramin, G.G., 2003. Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300, 1563–1565. Pons, O., Petit, R.J., 1995. Estimation, variance and optimal sampling of gene diversity. I. Haploid locus. Theor. Appl. Genet. 90, 462–470. Pons, O., Petit, R.J., 1996. Measuring and testing genetic differentiation with ordered versus unordered alleles. Genetics 144, 1237–1245. Powell, W., Machray, G., Provan, J., 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1, 215–222. Rajora, O.P., Dancik, B.P., 1992. Chloroplast DNA inheritance in Populus. Theor. Appl. Genet. 84, 280–285. Rendell, S., Ennos, R.A., 2003. Chloroplast DNA diversity of the dioecious European tree Ilex aquifolium L. (English holly). Mol. Ecol. 12, 2681–2688. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schneider, S., Roessli, D., Excoffier, L., 2000. ARLEQUIN ver. 2.000: A Software for Population Genetic Data Analysis. Genetics and Biometry Laboratory. University of Geneva, Geneva, Switzerland. Soltis, D.E., Gitzendanner, M.A., Strenge, D.D., Soltis, P.S., 1997. Chloroplast DNA intraspecific phylogeography of plants from the Pacific Northwest of North America. Plant Syst. Evol. 206, 353–373. Soltis, D.E., Soltis, P.S., Milligan, B.G., 1992. Intraspecific cpDNA variation: systematic and phylogenetic implications. In: Soltis, P.S., Soltis, D.E., Doyle, J.J. (Eds.), Molecular Systematics of Plants. Chapman & Hall, New York, pp. 117–150. Sun, X.J., Li, X., 1999. A pollen record of the last 37 ka in deep sea core 17940 from the northern slope of the South China Sea. Mar. Geol. 156, 227–244. Sun, X.J., Li, X., Beug, H.J., 1999. Pollen distribution in hemipelagic surface sediments of the South China Sea and its relation to modern vegetation distribution. Mar. Geol. 156, 211–226. Sun, X.J., Li, X., Luo, Y.L., Chen, X.D., 2000. The vegetation and climate at the last glaciation on the emerged continental shelf of the south China sea. Palaeogeogr. Palaeoclimatol. Palaeoecol. 160, 301–316. Tzedakis, P.C., Lawson, I.T., Frogley, M.R., Hewitt, G.M., 2002. Buffered tree population changes in Quaternary refugium: evolutionary implication. Science 292, 267–269. Wade, M.J., McCauley, D.E., 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42, 995–1005. Walter, R., Epperson, B.K., 2001. Geographic pattern of genetic variation in Pinus resinosa: area of greatest diversity is not the origin of postglacial populations. Mol. Ecol. 10, 103–111. Weising, K., Gardner, R.C., 1999. A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42, 9–19. Xiao, Z.S., Wang, Y.S., Zhang, Z.B., 2001. Seed bank and the factors influencing on for three Fagaceae species in Dujiangyan Region, Sichuan. Biodivers. Sci. 9 (4), 373–381. Zheng, Z., 1991. Pollen flora and paleoclimate of the Chaoshan plain during the last 50000 years. Acta Micropaleontol. Sin. 8, 461–480. Zheng, Z., 2000. Late quaternary vegetational and climatic changes in the tropical and subtropical areas of China. Acta Micropalaeontol. Sin. 17 (2), 125–146. Zheng, Z., Deng, Y., Zhang, H., Yu, R.C., Chen, Z.X., 2004. Holocene environmental changes in the tropical and subtropical areas of the south China and the relation to human activities. Quat. Sci. 24 (4), 387–393. Zheng, Z., Lei, Z.Q., 1999. A 400,000 year record of vegetational and climatic changes from a volcanic basin, Leizhou Peninsula, southern China. Palaeogeogr. Palaeoclimatol. Palaeoecol. 145, 339–362.
Chloroplast DNA diversity in Castanopsis hystrix populations in south China J. Li a,b, X.J. Ge a,c, H.L. Cao a, W.H. Ye a,* a
South China Botanical Garden, The Chinese Academy of Sciences, Guangzhou 510650, PR China b Graduate School of the Chinese Academy of Sciences, Beijing 100049, PR China c School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China Received 8 July 2005; received in revised form 4 February 2007; accepted 23 February 2007
Abstract Nineteen Chinese populations of Castanopsis hystrix were examined to quantify genetic diversity and genetic structure at chloroplast DNA. Microsatellites (SSR) were analyzed by PCR using conserved primers. The average within population gene diversity (HS), the total gene diversity (HT), and the differentiation for unordered alleles (GST) and for ordered alleles (NST) were measured. Fourteen different haplotypes were detected, two of them very common. The level of differentiation among populations (GST = 23.6%) indicates a highly efficient seed dispersal mechanism. In addition, the difference between GST and NST for the species is not significant, suggesting that the phylogeographic structure is weak or absent. The geographical pattern of C. hystrix haplotypes could be attributed to its migration from the numerous and scattered refugia, where the species confined during the last glacial period. These results provide an important insight into patterns of postglacial recolonization of this tree species. # 2007 Elsevier B.V. All rights reserved. Keywords: cpDNA; SSR; Genetic differentiation; Castanopsis hystrix
1. Introduction The modern distribution of plant and animal taxa is determined not only by the current environment, but also by historic events such as the last glacial period (Hengeveld, 1989). Although the land in south China has never been covered by ice sheets, the tremendous temperature and climatic changes might have influenced species’ distributions and evolution. The Holocene postglacial history of many trees is characterized by the northward expansion of southern refugial populations following the retreat of the ice sheets. The last glacial age might have been an important factor in determining the genetic structure and phylogeography of plant species in south China. Fossil pollen deposits can be used to reconstruct long-term vegetation dynamics, such as changes in the distribution and abundance of plant species during the quaternary period. But for the species which produce only small amount of pollen grains, occurrences of their pollen grains in the fossil pollen record may be therefore too infrequent to allow detailed
* Corresponding author. Tel.: +86 20 37252996. E-mail addresses: [email protected] (J. Li), [email protected] (W.H. Ye). 0378-1127/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.foreco.2007.02.012
reconstruction of the species’ past range and migration patterns. An alternative approach to the study of postglacial changes in plant distributions developed in recent years is the use of molecular markers (Ferris et al., 1999; Hewitt, 1999). Currently existing plant populations are expected to retain the genetic traces resulting from the migration routes they followed during the past, which could be revealed by studying the spatial distribution pattern of molecular markers. Chloroplast markers have been widely applied to studies of population history in trees (e.g. Walter and Epperson, 2001; Rendell and Ennos, 2003; Cheng et al., 2005). Firstly, because chloroplast genomes are haploid, their effective population size in monoecious outcrossing plants is half of diploid nuclear genomes. As a result, chloroplast-specific markers are considered good indicators of historical bottlenecks, founder effects and genetic drift. The use of chloroplast microsatellites has allowed the examination of these events at a finer level of detail than it was previously possible. Secondly, because chloroplasts evolve slowly and exhibit little variation at the intraspecific level (Clegg et al., 1994), cpDNA markers have been widely used for phylogenetic inference (Olmstead and Palmer, 1994) and to some extent, for within-species genetic studies (Soltis et al., 1992; Ennos et al., 1999). However, microsatellite markers are
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
also used to find fine-scale polymorphism because of their highly polymorphic nature (Jarne and Lagoda, 1996; Powell et al., 1996). Thirdly, chloroplast DNA is maternally inherited, i.e. through the seeds in most angiosperms (Dumolin et al., 1995; Rajora and Dancik, 1992; Mogensen, 1996). Therefore cpDNA, which generally reflects seed dispersal and maternal gene flow, is an effective tool for genetic variation studies and for identifying postglacial migration routes (McCauley, 1994). Finally, the geographically structured cpDNA variations permit the elucidation of evolutionary history and the study of intraspecific phylogeography (Soltis et al., 1997). Castanopsis hystrix (Fagaceae) is an evergreen tree species, as one of fagaceous species originated in the south China and Indochina (Li, 1996). The present-day distribution of C. hystrix in China extends from Taiwan, along Fujian, Guangdong, Guangxi, Yunnan, to south Tibet, expanding southwards as far as Hainan island. C. hystrix is one of the most important and dominant species of the evergreen broad-leaved forests in subtropical China. The extensive use of C. hystrix wood for many purposes, such as construction and boat building, resulted in the fragmentation of the once continued and broad natural distribution and thus in population shrinkage and possible genetic erosion. For both conservation and forestry management, therefore it is essential to be able to assess C. hystrix’s genetic diversity. Although pollen data show that the C. hystrix forests were present in southern China through the quaternary period, some reduction occurred in glacial period (Zheng, 1991; Sun et al., 1999; Sun and Li, 1999; Zheng and Lei, 1999; Zheng et al., 2004) and the information of its genetic diversity and population history is very limited. Main objective of the present study was to assess the cpDNA variation and diversity among and within C. hystrix natural populations, to investigate whether its genetic diversity follows a geographic pattern and discuss the forces and events that led to this pattern.
95
Table 1 The studied populations of Castanopsis hystrix Population no.
Population name
Province region
Latitude
Longitude
Altitude (m)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Jianfengling Nanjing Nanhuasi Deqing Jintong Zijin Yanyang Huadu Heyuan Enping Luofushan Gongcunzhang Longsheng Jinxiu Damingshan Xishuangbanna Simao Xichou Maguan
Hainan Fujian Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangxi Guangxi Guangxi Yunnan Yunnan Yunnan Yunnan
188440 N 248310 N 248330 N 238130 N 228240 N 238420 N 248150 N 238240 N 238210 N 228150 N 238160 N 238270 N 258500 N 248080 N 238100 N 218520 N 248160 N 238250 N 238060 N
1088520 E 1178210 E 1138410 E 1118560 E 1108440 E 1148540 E 1168110 E 1138110 E 1148320 E 1128060 E 1148030 E 1158230 E 1098530 E 1108110 E 1088160 E 1008260 E 1008480 E 1048410 E 1048020 E
900 300 120 350 350 150 150 200 120 150 100 200 200 300 450 350 1900 1600 1700
2. Materials and methods
grams of the dried leaves were submerged in liquid nitrogen, and then ground into powder, added to 750 ml of 2 CTAB (2% (w/v) hexadecylcetytrimethylammonium bromide) in a 1.5 ml centrifuge tube and incubated at 65 8C for 45–60 min. A volume of 750 ml of 24:1 chloroform:iso-amyl alcohol was added. The tubes were mixed evenly and centrifuged at 10,000 rpm for 10 min. The top layer was pipetted into a clean tube, and the above step was repeated. Finally the supernatant was transferred to a clean tube to which 600 ml of isopropanol and 150 ml of sodium chloride were added. It was kept at 20 8C for more than 30 min and centrifuged at 10,000 rpm for 10 min. The supernatant was discarded and the precipitate was washed with 500 ml of 75% ethanol two times, dried at room temperature and then dissolved in 100 ml of TE (Tris–EDTA buffer, pH 8).
2.1. Collection of samples
2.3. Chloroplast microsatellites
Nineteen populations of C. hystrix (380 individuals), comprising 20 individuals per population, were sampled in south China (Table 1 and Fig. 1). Sample collections covered most of the known populations for this species in mainland China. To avoid sampling clones or close relatives, all individuals chosen were separated by at least 20 m, except for the population Yanyang which is a very small population (the respective number 7), where the least distance between plants was 10 m based on the sample size and the availability. Approximately 15 leaves per individual were sampled. Leaf material collected in the field was dried immediately using silica gel and stored at room temperature until DNA extractions were completed.
Because the chloroplast genome is haploid and does not undergo recombination it can be viewed as a single locus and all sequence variation can be interpreted as giving rise to different haplotypes of the genome. The chloroplast genome may alternatively be viewed as a circular haploid chromosome wherein sequence variation generates different alleles within the individual (nonrecombining loci). In either case, for ease of presentation and discussion, we used the terms ‘locus’ to refer to a cpSSR site (defined by the termini of a PCR primer pair), and ‘alleles’ to refer to length variants at a cpSSR site. Seven universal primers described in Weising and Gardner (1999) and Chung (2002) were used in this study (Table 2). Four of these primers are flanking angiosperm chloroplast microsatellites and the remaining three are flanking cucumber chloroplast microsatellites. PCR amplification was performed in a 20 ml reaction mixture consisting of 50 ng of template DNA, 10 mM of Tris–HCl (pH 9.0), 50 mM of KCl, 0.1%
2.2. DNA extraction Genomic DNA was extracted following the cetyltrimethyl ammonium bromide procedure (Doyle, 1991). One to two
96
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Fig. 1. Relative position of populations sampled and geographic distribution of the haplotypes identified with cpDNA markers. Numbers corresponding to populations are given in Table 1.
Table 2 Primers used in this study Primer
Sequence 50 –30
Annealing temperature(8C)
Reference
Ccmp3 Ccmp4 Ccmp6 Ccmp10 ccSSR3 ccSSR4 ccSSR8
CAGACCAAAAGCTGACATAGGTTTCATTCGGCTCCTTTAT CCAAAATATTBGGAGGACTCTAATGCTGAATCGAYGACCTA CGATGCATATGTAGAAAGCCCATTACGTGCGACTATCTCC TTTTTTTTTAGTGAACGTGTCATTCGTCGDCGTAGTAAATAG CCAAAAGCTGACATAGATGTTATTTCATTCGGCTCCTTTATG AGGTTCAAATCCTATTGGACGCATTTTGAAAGAAGCTATTCARGAAC TTGATCTTTACGGTGCTTCCTCTATCATTACGTGCGACTATCTCC
48 51 49 48 54 53 58
Weising and Gardner Weising and Gardner Weising and Gardner Weising and Gardner Chung (2002) Chung (2002) Chung (2002)
(1999) (1999) (1999) (1999)
temperature, and 72 8C extension for 45 s, followed by 5 min final extension at 72 8C. PCR products were separated on 6% denaturing polyacrylamide gels stained with silver nitrate and were sized by comparison to a 50-base pair (bp) DNA ladder standard (Invitrogen).
Triton X-100, 1.5 mM of MgCl2, 0.2 mM of dNTPs, 0.2 mM of each primer, and 0.7 unit of Taq DNA polymerase. The reaction mixture was subjected to amplification using MJ PTC-100 Thermal Cycler for an initial denaturing step for 1 min at 94 8C, 35 cycles of denaturation at 94 8C for 15 s, 45 s of annealing
Table 3 Haplotype definition resulting from the combination of 18 microsatellite alleles recorded in 7 polymorphic loci (1 denotes the presence and 0 the absence of a fragment from its expected position on a gel) Code
H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14
Ccmp6
Ccmp3
Ccmp4
Ccmp10
ccSSR8
ccSSR3
ccSSR4
1
2
1
2
1
2
3
1
2
1
2
3
1
2
3
1
2
3
0 0 1 0 0 0 0 0 0 0 0 1 0 0
1 1 0 1 1 1 1 1 1 1 1 0 1 1
1 1 1 1 1 1 1 1 1 1 1 1 1 0
0 0 0 0 0 0 0 0 0 0 0 0 0 1
0 0 0 1 1 0 0 0 1 1 0 1 0 0
1 1 1 0 0 1 1 1 0 0 1 0 1 1
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 1 0 0 0 0 0 0 1 0 1 0 0 0
1 0 1 1 1 1 1 1 0 1 0 1 1 1
0 0 0 0 0 0 1 0 0 0 0 0 0 0
1 1 1 1 1 1 0 1 0 1 1 1 1 1
0 0 0 0 0 0 0 0 1 0 0 0 0 0
0 0 0 0 0 0 0 0 0 1 0 0 1 0
1 1 1 1 1 1 1 1 1 0 1 1 0 1
0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 1 0 0 0 0 1 0 0 0
1 1 1 1 1 0 1 0 1 1 0 1 1 1
0 0 0 0 0 0 0 1 0 0 0 0 0 0
0.521 0.208 0.016 0.042 0.047 0.042 0.034 0.016 0.024 0.016 0.018 0.003 0.011 0.003 4 4
2
6
10 2 10 2
6 1
1
2 1 2 1
6
1
1
13 1 1 5 1 16 1 4 15 1
4
1 4
4
3
1
1
3
1 1
1
3 3 2
20 9 3 12 5 14 1 13 7 4
1 5
Haplotypes code. Numbers corresponding to populations are given in Table 1. a
b
1 1 2
1 2 5
2
97
2.4. Data analysis
20 15 4 10 4 2 1 13 2 2 12 10 5
H1 H2 17 H3 2 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20) (n = 20)
Population b Ha
Table 4 Haplotypes frequency in 19 populations of C. hystrix
Total (n = 380) (%)
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Diversity and differentiation parameters used in this study included the average intrapopulation diversity (HS), total diversity (HT), and the differentiation for unordered alleles (GST) and for ordered alleles (NST). They were quantified according to Pons and Petit (1995, 1996) using the program PERMUT. GST depends only on haplotype frequencies, whereas NST takes into consideration genetic similarities between haplotypes. These two parameters were compared by a permutation test, using 1000 permutations (Burban et al., 1999). The following population genetic parameters were computed for each population using Arlequin v.2.000 (Schneider et al., 2000): number of haplotypes (nh), number of polymorphic loci (np), and Nei’s unbiased haplotypic diversity (He; Nei, 1987). The population genetic structure of C. hystrix was calculated within the analysis of molecular variance (AMOVA) framework (Excoffer et al., 1992; Excoffier and Smouse, 1994). A hierarchical analysis of variance was used to partition the total variance into covariance components consisting of within population variation, variation among populations within regions, and variation among regions. The significance of covariance components was tested using permutation tests (1000 permutations) at different levels (haplotypes among populations among regions, haplotypes among populations within regions and populations among regions). Only P-values lower than 0.05 were considered significant. Nei’s unbiased genetic distance was calculated for all population pairs (Nei, 1978) using the PopGen1.32 program. To estimate the amount of gene flow among populations, the number of migrants exchanged per generation, Nm, was calculated indirectly from GST values at each locus and from the average values over all loci by applying McDermott and McDonald’s (1993) formula: Nm = (1GST)/2GST, where N is the effective population size and m is the proportion of migrants exchanged per generation. The neighbor joining (Saitou and Nei, 1987) dendrogram was computed using Nei’s (1978) genetic distance based on cpSSRs data with the MEGA 3.0 software (Kumar et al., 2004). Mantel’s test (Mantel, 1967) was applied to examine whether genetic and geographic distance matrices correlate significantly (Bohonak, 2002). 3. Results The number of alleles per polymorphic cpSSR locus ranged from 2 to 3. A total of 18 size variants at the 7 loci were identified. The 18 size variants combined in 14 different haplotypes (Table 3). In Table 4 the frequency of haplotypes in the 19 C. hystrix populations is presented. Fig. 1 showed that Haplotype H1 was particularly common in every population (52.1% for the whole sample) except those in Jianfengling (1) where H1 was not present; and in Jianfengling (1), Nanhuasi (3) and Xishuangbanna (16) where H2 was dominant. H2 was the second most frequent haplotype (20.8%) that occurred in 15 populations throughout the distribution of C. hystrix (Fig. 1).
98
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
Table 5 Genetic diversity within different populations of C. hystrix Province region
Population
nh
np
He
Hainan
1
3
6
0.279
Fujian
2
3
6
0.658
3 4 5 6 7 8 9 10 11 12
4 5 6 3 1 5 3 5 5 5
8 8 8 4 0 8 4 7 8 8
0.595 0.574 0.721 0.416 0.000 0.795 0.542 0.505 0.600 0.758
4.2
6.3
0.551
Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Guangdong Average Guangxi Guangxi Guangxi
13 14 15
Average Yunnan Yunnan Yunnan Yunnan
16 17 18 19
Average
1 5 6
0 8 11
0.000 0.442 0.805
4
6.33
0.416
5 4 4 4
10 4 6 6
0.368 0.537 0.695 0.674
4.25
6.5
0.569
Numbers corresponding to populations are given in Table 1.
Haplotype H12 and H14 were only found in Jinxiu (14) and Jianfengling (1), respectively. Haplotype H8 and H13 were only found in Guangdong. All other haplotypes showed distributions spanning in two to four provinces. Population Yanyang (7) and Longsheng (13) were monomorphic for haplotype 1. Table 5 shows that the haplotypic diversity (He) was the lowest in the population Janfengling (1). At the regional scale (all 19 populations), the total chloroplast DNA diversity (HT) and mean within population diversity (HS) were 0.686 (S.E. = 0.0496) and 0.524 (S.E. = 0.0536), respectively, and the differentiation among populations (GST) was 23.6%. The level of differentiation among populations taking into account of distances between haplotypes was not significantly different from GST (NST = 23.8%). NST was calculated to investigate whether related haplotypes were clustered in their geographical distribution. This result suggested that groups of related C. hystrix haplotypes were not restricted to particular geographical regions. In addition, in Table 6 the AMOVA highlighted the high levels of genetic Table 6 Analysis of molecular variance (AMOVA) Source of variation
d.f.
Variance
%
F statistics
P
Among regions Among populations within regions Within populations
4 14
0.05 0.20
5.01 19.98
FCT = 0.05 FSC = 0.21
0.1554 <0.001
361
0.76
75.01
FST = 0.25
<0.001
Fig. 2. The neighbor-joining dendrogram computed using Nei’s (1978) genetic distance based on cpSSRs data showing genetic differentiation levels. Numbers corresponding to populations are given in Table 1.
differentiation among populations within regions (19.98% of the total variation; FSC = 0.21) and within populations (75.01%; FST = 0.25). Only 5.01% (FCT = 0.05) of the total variation existed among regions. The genetic distance between populations ranged from 0.0002 to 0.1203 (Table 7). The negative genetic distance values may be caused by sampling error (Nei, 1978). From the Nei’s matrix, it was interesting to note that the highest genetic distance was between Jianfenglin (1) and Heyuan (9), 0.1203 (Table 7), although geographical distance between them was not the largest. The neighbor-joining dendrogram (Fig. 2) showed genetic relationships among populations and clustered into two groups. The upper one included 15 populations, in which population Huadu (8), Maguan (19), Gongcunzhang (12), Jinxiu (14), Simao (17) formed a subgroup, followed by a subgroup composed of population Heyuan (9), Yanyang (7), Longsheng (13). Then all these populations plus population Deqing (4), Enping (10), and Xichou (18) connected with population Zijin (6), Luofushan (11), Jintong (5), Nanjing (2) hierarchically. Instead, the lower one included four populations. Except population Nanhuasi (3), population Jianfengling (1), Xishaungbanna (16) and Damingshan (15) distributed in the southern part of the sampling area and along coast line. Effects of geographical isolation on population structure can be studied through the correlation of genetic and geographical distances and also through the application of the nested clade analysis. The Mantel tests for independence between geographic and genetic distance were nonsignificant (P > 0.10). Therefore, simple differentiation models as isolation by distance or stepping-stone colonization models can be rejected. The physiography of the territory or differences in dispersal across the sea (i.e. between islands and lands) and across land (i.e. among populations within lands) could confound simple isolation by distance models.
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
99
Table 7 Nei’s unbiased measures of genetic distance Population no. 1
2
3
4
5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
0.0174 0.0271 0.0186 0.0214 0.0409 0.0243 0.0518 0.0234 0.0192 0.0307 0.0409 0.0313 0.0352 0.0320 0.0438 0.0366 0.0289
0.0415 0.0215 0.0302 0.0560 0.0527 0.0603 0.0462 0.0229 0.0431 0.0560 0.0489 0.0003 0.0133 0.0549 0.0400 0.0609
0.0074 0.0019 0.0021 0.0158 0.0047 0.0013 0.0031 0.0022 0.0021 0.0003 0.0531 0.0896 0.0116 0.0053 0.0113
0.0019 0.0117 0.0039 0.0261 0.0215 0.0247 0.0191 0.0109 0.0058 0.0270 0.0074 0.0026 0.0042 0.0184 0.0119 0.0010 0.0009 0.0064 0.0206 0.0110 0.0045 0.0066 0.0057 0.0048 0.0110 0.0089 0.0059 0.0062 0.0117 0.0039 0.0000 0.0247 0.0058 0.0042 0.0064 0.0048 0.0102 0.0047 0.0021 0.0121 0.0081 0.0031 0.0065 0.0006 0.0021 0.0295 0.0420 0.0681 0.0710 0.0692 0.0595 0.0328 0.0521 0.0681 0.0609 0.0522 0.0679 0.1089 0.0900 0.1193 0.0918 0.0593 0.0923 0.1089 0.1003 0.0235 0.0065 0.0105 0.0100 0.0306 0.0177 0.0140 0.0125 0.0043 0.0100 0.0090 0.0637 0.0967 0.0089 0.0065 0.0081 0.0337 0.0114 0.0040 0.0062 0.0092 0.0081 0.0086 0.0436 0.0962 0.0184 0.0278 0.0198 0.0187 -0.0008 0.0236 0.0138 0.0209 0.0092 0.0187 0.0074 0.0795 0.1069 0.0296 0.0285 ****
0.0383 0.0177 0.0917 0.0515 0.0683 0.1088 0.0943 0.1203 0.0945 0.0603 0.0932 0.1088 0.1021 0.0283 0.0002 0.0926 0.0998 0.1118
6
7
8
9
10
11
12
13
14
15
16
17
18
19
Numbers corresponding to populations are given in Table 1. The negative genetic distance values may be caused by sampling error. ****represents no genetic distance.
4. Discussion 4.1. Chloroplast haplotype diversity Population genetic diversity in C. hystrix was indicated using cpSSR markers. The highest level of haplotypic diversity was concentrated in population Damingshan (15), Guangxi province. Populations distributed in Guangdong province (Jintong (5), Huadu (8), Gongcunzhang (12)) were also the hotspots of haplotypic diversity. It is generally believed that regions with high levels of diversity could either be identified as potential refugia, i.e. areas with stable ecological habitat during environmental changes harboring the accumulated genetic diversity, or as intermediate zones where organisms from different sources or regions intermix, resulting in higher genetic diversity than that recorded in the original sources (Tzedakis et al., 2002; Petit et al., 2003). Thus, these populations should be among the first ones considered for conservation in the framework of a conservation strategy for C. hystrix. An important result of this study was the maintenance of a high within population diversity for cpDNA in C. hystrix, compared with low between population differentiation (GST = 0.24). The lack of genetic structure in C. hystrix might be the consequence of several factors. C. hystrix’s nuts are high in starch and protein, which make them good food resources for birds and animals. Ingestion of these fruits by animals allows long distance nuts dissemination (Fineschi et al., 2005). It has been reported that birds often prey nuts on the crown of trees of C. hystrix (Xiao et al., 2001) and thus they play an important role in long-seed dispersal. In addition, a number of acorns of species in Fagaceae fall on ground and remain in the litter, which become important food resources for little mammals, especially rodents. Rodents are generally believed to prefer loose substrates and can travel long distances to find the right
place to secure their food. A previous study found that some mice such as Niviventer confucianus, N. fulvescens, Berylmys bowersi can transport acorns (Xiao et al., 2001). Above all, the large potential for gene flow through nut dispersal between populations would reduce genetic drift and population differentiation of C. hystrix. In addition to high gene flow, biological (time to sexual reproduction) and historical (glaciation) factors had effects on the genetic structure of cpSSRs in C. hystrix. Under different colonization models, Austerlitz et al. (2000) demonstrated that founder effects were reduced by delayed reproduction in forest trees, and thus resulted in small genetic differentiation among populations before glaciation and colonization of refugia. In C. hystrix, the high Nm between populations and low genetic differentiation due to shared dominant alleles and heterogeneous composition of organelle DNAs within each population were consistent with a migrant-pool model (Wade and McCauley, 1988). This unusual model presented a migratory pattern with colonists recruited from a random sample of previously existing populations and was believed to be associated with glaciation or vicariance events (Wade and McCauley, 1988). 4.2. Geographical distribution of cpDNA and colonization history In the present study, none of the populations clustered together according to their geographical location, which could be due to several reasons. First, disjunctive distribution of haplotypes arose from the disappearance of intermediate populations as a consequence of climate deterioration (Csaikl et al., 2002). Second, it was likely due to the colonization of these regions from different source populations. Finally, a different seed-dispersal condition also contributed to this discontinuity between adjacent populations.
100
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101
The coalescent theory states that the most frequent and widespread haplotypes are ancestral and indicate the location of refugial populations (Crandall and Templeton, 1993). The most frequent cpDNA haplotype H1 with a cumulative frequency of 52.1% was present in all populations except for the population Jianfengling (1), suggesting that it was the ancestral haplotype and there were many scattered refugia for C. hystrix in south China. Meantime, most rare haplotypes refer to recent mutational derivatives of some other haplotypes because they are of recent evolutionary origin (Donnelly and Tavare´, 1986). Presumably, the patchy distribution of rare haplotypes H12–14 suggested recent mutation events and the haplotype H13 found in population Heyuan (9) and Luofushan (11) had been distributed during population expansion from refugia. Human activities were suggested to play an important role in shaping the present distribution pattern of cpDNA haplotypes of C. hystrix. The introduction of nonautochthonous material is particularly evident where there is a large geographic distance between the stand and the region where the corresponding haplotype occurs at high frequency (Ko¨nig et al., 2002). Our data supported the influence of human activities on the geographic distribution of cpDNA haplotypes. For instance, haplotype H2 was dominant in populations Jianfengling (1), Nanhuasi (3) and Xishuangbanna (16). These three populations distributed far away from each other. Among them, population Nanhuasi (3) distributed in the almost northernmost part of the distribution area of C. hystrix. It could not have grown there with large amount under normal conditions. On the contrary, our observation indicated that population Nanhuasi (3) was a Fengshui woods (forests near villages preserved for reasons of fengshui—Chinese geomantic practice for configuration of sites) with a large size. Considering that C. hystrix as a precious timber tree species has been used for thousands of years (Zheng, 2000), the case of population Nanhuasi (3) strongly suggested that it was the remnants of forests planted by people in history. Therefore, human activities could become another significant factor contributing to the disjunctive distributions of haplotypes. This geographical pattern of haplotypes of C. hystrix could be related to the quaternary history of the subtropical broadleaved evergreen forests. During ice ages, subtropical forests could retreat into wet and warmer lowland areas or on rainy slopes of mountainous areas, namely refugia. These areas might have been numerous and scattered, contrary to the situation in Europe, where refugia were restricted to three zones in southern latitudes (Bennett et al., 1991). This situation was also different from the results of study on C. carlesii, one congeneric species with C. hystrix, in Taiwan (Cheng et al., 2005), showing that two potential refugia for C. carlesii were separated by the Central Mountain Range (CMR) during the last glaciation in Taiwan. By contrast, the southern part of mainland China was relatively flat with hills <150 m a.s.l., with some isolated mountains during the last glacial maximum (LGM) (Sun et al., 2000). Thus, the distribution of C. hystrix in mainland China was unlikely isolated by the high mountain barrier because its distribution
was considerably higher than 150 m. Instead, zones of high specific richness and endemism have been reported, which could represent refugia of quaternary in south China. Longdistance seed dispersal during the glacial maximum, which allowed surviving individuals to invade these numerous refugia, played a key role in maintaining genetic heterogeneity within geographical populations. Colonists from different source populations were forced to migrate into refugia. During the interglacial periods, subtropical forests expanded again from refugia. Because of the scattered distribution of refugial zones in the subtropics and the admixture of different source populations, the geographical pattern of cpDNA haplotyps was expected to be more complex. 4.3. Future work The current work sampled a large distribution range of C. hystrix. Unfortunately, two important regions (Tibet and Taiwan) remain unsampled. Current work provided an initial suggestion of the genetic diversity and structure. In order to illustrate them more clearly and discover the consequences of alternating glacial/post-glacial events, it is necessary for a further sampling effort in the whole distribution range. Acknowledgements The authors thank Dr. Jian-Wen Zou, Andrew Lowe, ZhangMing Wang, Zheng-Feng Wang, Summer Nijjer for revising the manuscript. The authors are grateful to two anonymous reviewers for helpful comments on the manuscript. This work is supported by the Director Fund of South China Botanical Garden, the Chinese Academy of Sciences. References Austerlitz, F., Mariette, S., Machon, N., Gouyon, P.H., Godelle, B., 2000. Effects of colonization processes on genetic diversity: differences between annual plants and tree species. Genetics 154, 1309–1321. Bennett, K.D., Tzedakis, P.C., Willis, K.J., 1991. Quaternary refugia of the North European trees. J. Biogeogr. 18, 103–115. Bohonak, A.J., 2002. IBD (isolation by distance): a program for analyses of isolation by distance. J. Hered. 93 (2), 153–154. Burban, C., Petit, R.J., Carcreff, E., Jactel, H., 1999. Rangewide variation of the maritime pine bast scale Matsucoccus feytaudi Duc. (Homoptera: Matsucoccidae) in relation to the genetic structure of its host. Mol. Ecol. 8, 1593–1602. Cheng, Y.P., Hwang, S.Y., Lin, T.P., 2005. Potential refugia in Taiwan revealed by the phylogeographical study of Castanopsis carlesii Hayata (Fagaceae). Mol. Ecol. 14, 2075–2085. Chung, S., 2002. The use of cpDNA SSR markers and sequenced fragments for comparative analysis of genetic relationships within the Cucurbitaceae and the inheritance of chilling injury in cucumber (Cucumis sativus L.). PhD Thesis. Plant Breeding and Plant Genetics, University of Wisconsin, Madison, WI. Clegg, M.T., Gaut, B.S., Learn, G.H., Morton, R.R., 1994. Rates and pattern of chloroplast DNA evolution. Proc. Natl. Acad. Sci. U.S.A. 91, 6795– 6801. Crandall, K.A., Templeton, A.R., 1993. Empirical tests of some predictions from coalescent theory with applications to intrasepcfic phylogeny reconstruction. Genetics 134, 959–969.
J. Li et al. / Forest Ecology and Management 243 (2007) 94–101 Csaikl, U.M., Glaz, I., Baliuckas, V., Petit, R.J., Jensen, J.S., 2002. Chloroplast DNA variation of white oak in the Baltic countries and Poland. Forest Ecol. Manage. 156, 211–222. Donnelly, P., Tavare´, 1986. The ages of alleles and a coalescent. Adv. Appl. Probab. 18, 1–19. Doyle, J.J., 1991. DNA protocols for plants—CTAB total DNA isolation. In: Hewitt, G.M., Johnston, A. (Eds.), Molecular Techniques in Taxonomy. Springer, Berlin, pp. 283–293. Dumolin, S., Demesure, B., Petit, R.J., 1995. Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Theor. Appl. Genet. 91, 1253–1256. Ennos, R.A., Sinclair, W.T., Hu, X.S., Langdon, A., 1999. Using organelle markers to elucidate the history, ecology and evolution of plant populations. In: Hollingsworth, P.M., Bateman, R.M., Gornall, R.J. (Eds.), Molecular Systematics and Plant Evolution of Plant Populations. Taylor & Francis Ltd., London, pp. 1–19. Excoffier, L., Smouse, P.E., 1994. Using allele frequencies and geographic subdivision to reconstruct gene trees within a species: molecular variance parsimony. Genetics 136, 343–359. Excoffer, L., Smouse, P.E., Quattro, L.M., 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes, applications to human mitochondrial DNA restriction data. Genetics 131, 479–491. Ferris, C., King, R.A., Hewitt, G.M., 1999. Isolation within species and history of glacial refugia. In: Hollingsworth, P.M., Bateman, R.M., Gornall, R.J. (Eds.), Molecular Systematics and Plant Evolution. Taylor & Francis, London, pp. 20–34. Fineschi, S., Salvini, D., Turchini, D., Pastorelli, R., Vendramin, G.G., 2005. Crataegus monogyna Jacq. and C. laevigata (Poir.) DC. (Rosaceae, Maloideae) display low level of genetic diversity assessed by chloroplast markers. Plant Syst. Evol. 250, 187–196. Hengeveld, R., 1989. Dynamics of Biological Invasions. Chapman & Hall, London. Hewitt, G.M., 1999. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc. 68, 87–112. Jarne, P., Lagoda, P.J.L., 1996. Microsatellites, from molecules to populations and back. Trends Ecol. Evol. 11, 424–429. Ko¨nig, A.O., Ziegenhagen, B., van Dam, B., Csaikl, U.M., Coart, E., Burg, K., Degen, B., de Vries, S.M.G., Petit, R.J., 2002. Chloroplast DNA variation of oaks in western central Europe and the genetic consequences of human influences. Forest Ecol. Manage. 156, 147–166. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Li, J.Q., 1996. The origin and distribution of the family Fageceae. Acta Phytotaxon. Sin. 34 (4), 376–396. Mantel, N., 1967. The detection of disease clustering and a generalized regression approach. Cancer Res. 27, 209–220. McCauley, D.E., 1994. Contrasting the distribution of chloroplast DNA and allozyme polymorphism among local populations of Silene alba: implications for studies of gene flow in plants. Proc. Natl. Acad. Sci. U.S.A. 91, 8127–8131. McDermott, J.M., McDonald, B.A., 1993. Gene flow in plant pathosystems. Annu. Rev. Phytopathol. 31, 353–373. Mogensen, H.L., 1996. The hows and whys of cytoplasmic inheritance in seed plants. Am. J. Bot. 83, 383–404. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Nei, M., 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. Olmstead, R.G., Palmer, J.D., 1994. Chloroplast DNA systematics: a review of methods and data analysis. Am. J. Bot. 81, 1205–1224.
101
Petit, R.J., Aguinagalde, I., de Beaulieu, J.L., Bittkau, C., Brewer, S., Cheddadi, R., Ennos, R., Fineschi, S., Grivet, D., Lascoux, M., Mohanty, A., Mu¨llerStarck, G., Demesure-Musch, B., Palme´, A., Martı´n, J.P., Rendell, S., Vendramin, G.G., 2003. Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300, 1563–1565. Pons, O., Petit, R.J., 1995. Estimation, variance and optimal sampling of gene diversity. I. Haploid locus. Theor. Appl. Genet. 90, 462–470. Pons, O., Petit, R.J., 1996. Measuring and testing genetic differentiation with ordered versus unordered alleles. Genetics 144, 1237–1245. Powell, W., Machray, G., Provan, J., 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1, 215–222. Rajora, O.P., Dancik, B.P., 1992. Chloroplast DNA inheritance in Populus. Theor. Appl. Genet. 84, 280–285. Rendell, S., Ennos, R.A., 2003. Chloroplast DNA diversity of the dioecious European tree Ilex aquifolium L. (English holly). Mol. Ecol. 12, 2681–2688. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schneider, S., Roessli, D., Excoffier, L., 2000. ARLEQUIN ver. 2.000: A Software for Population Genetic Data Analysis. Genetics and Biometry Laboratory. University of Geneva, Geneva, Switzerland. Soltis, D.E., Gitzendanner, M.A., Strenge, D.D., Soltis, P.S., 1997. Chloroplast DNA intraspecific phylogeography of plants from the Pacific Northwest of North America. Plant Syst. Evol. 206, 353–373. Soltis, D.E., Soltis, P.S., Milligan, B.G., 1992. Intraspecific cpDNA variation: systematic and phylogenetic implications. In: Soltis, P.S., Soltis, D.E., Doyle, J.J. (Eds.), Molecular Systematics of Plants. Chapman & Hall, New York, pp. 117–150. Sun, X.J., Li, X., 1999. A pollen record of the last 37 ka in deep sea core 17940 from the northern slope of the South China Sea. Mar. Geol. 156, 227–244. Sun, X.J., Li, X., Beug, H.J., 1999. Pollen distribution in hemipelagic surface sediments of the South China Sea and its relation to modern vegetation distribution. Mar. Geol. 156, 211–226. Sun, X.J., Li, X., Luo, Y.L., Chen, X.D., 2000. The vegetation and climate at the last glaciation on the emerged continental shelf of the south China sea. Palaeogeogr. Palaeoclimatol. Palaeoecol. 160, 301–316. Tzedakis, P.C., Lawson, I.T., Frogley, M.R., Hewitt, G.M., 2002. Buffered tree population changes in Quaternary refugium: evolutionary implication. Science 292, 267–269. Wade, M.J., McCauley, D.E., 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42, 995–1005. Walter, R., Epperson, B.K., 2001. Geographic pattern of genetic variation in Pinus resinosa: area of greatest diversity is not the origin of postglacial populations. Mol. Ecol. 10, 103–111. Weising, K., Gardner, R.C., 1999. A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42, 9–19. Xiao, Z.S., Wang, Y.S., Zhang, Z.B., 2001. Seed bank and the factors influencing on for three Fagaceae species in Dujiangyan Region, Sichuan. Biodivers. Sci. 9 (4), 373–381. Zheng, Z., 1991. Pollen flora and paleoclimate of the Chaoshan plain during the last 50000 years. Acta Micropaleontol. Sin. 8, 461–480. Zheng, Z., 2000. Late quaternary vegetational and climatic changes in the tropical and subtropical areas of China. Acta Micropalaeontol. Sin. 17 (2), 125–146. Zheng, Z., Deng, Y., Zhang, H., Yu, R.C., Chen, Z.X., 2004. Holocene environmental changes in the tropical and subtropical areas of the south China and the relation to human activities. Quat. Sci. 24 (4), 387–393. Zheng, Z., Lei, Z.Q., 1999. A 400,000 year record of vegetational and climatic changes from a volcanic basin, Leizhou Peninsula, southern China. Palaeogeogr. Palaeoclimatol. Palaeoecol. 145, 339–362.