- Email: [email protected]
Cholecystokinin-8 (CCK-8) has no effect on heart rate in rats lacking CCK-A receptors
Peptides 22 (2001) 1279 –1284
Cholecystokinin-8 (CCK-8) has no effect on heart rate in rats lacking CCK-A receptors Mieko Kurosawaa,*, Setsu Iijimaa, Akihiro Funakoshib, Takako Kawanamib, Kyoko Miyasakac, Violeta Bucinskaited, Thomas Lundebergd a
Basic Medical Research Center, International University Health and Welfare, Otawara, Tochigi 324-8501, Japan b Department of Gastroenterology, National Kyushu Cancer Center, Fukuoka 811-1395, Japan c Department of Clinical Physiology, Tokyo Metropolitan Institute of Gerontology, Itabashi, Tokyo 173-0015, Japan d Department of Physiology and Pharmacology, Karolinska Institutet, 171–77 Stockholm, Sweden Received 13 November 2000; accepted 4 February 2001
Abstract Heart rate responses to i.v. administration of cholecystokinin-8 (CCK-8) were investigated in Otsuka Long-Evans Tokushima Fatty (OLETF) rats lacking CCK-A receptors and control Long-Evans Tokushima Otsuka (LETO) rats. The heart rate decreased after i.v. administration of 3 nmol䡠kg⫺1 of CCK-8 in LETO rats, but not in OLETF rats. Bradycardia in the LETO rats disappeared after treatment with MK-329, but not after treatment with L-365,260. The expression of CCK-A receptor precursor mRNA was found exclusively in the atrium in LETO rats. These results suggest that CCK-8 decreases heart rate via CCK-A receptors located in the atrium of the rats. © 2001 Elsevier Science Inc. All rights reserved. Keywords: Heart rate; Cholecystokinin; Type A CCK receptors; Otsuka Long-Evans Tokushima Fatty (OLETF) rats; Long-Evans Tokushima Otsuka (LETO) rats; Atrium; Ventricle
1. Introduction Cholecystokinin (CCK) is a neuropeptide known to cause contraction of the gallbladder and to stimulate pancreatic enzyme secretion [9]. In addition, CCK has various regulatory roles in satiety [8,19], nociception [1], anxiety [4], gastric motility [14] and heart rate [7]. These regulatory roles are exerted via stimulation of either type A CCK (CCK-A) receptors or type B CCK (CCK-B) receptors [21]. Additional receptors of neither type A, nor type B CCK receptors have been recently identified [16,18]. A congenital defect in the expression of CCK-A receptor genes was recently demonstrated in Otsuka Long-Evans Tokushima Fatty (OLETF) rats [6,20], which have been established as an animal model of non-insulin-dependent diabetes mellitus and obesity. The expression of the CCK-B receptor is intact in the OLETF rats [6,12]. CCK-A receptor * Corresponding author. Tel.: ⫹81-287-24-3180; fax: ⫹81-287-243191. E-mail address: [email protected] (M. Kurosawa).
mediated responses such as pancreatic exocrine enzyme secretion and gastric emptying, reported in normal CCK-A receptor intact rats, were not observed in OLETF rats [5,17]. In contrast, excitation of vagal afferents to CCK, which is also elicited via stimulation of CCK-A receptors in normal rats [11,15], was not totally impaired in OLETF rats [10]. That is, CCK slightly increased vagal afferent activity in OLETF rats, and the increase was not influenced by treatment with either CCK-A or CCK-B receptor antagonists. These results suggest that there is functional compensation for the lack of CCK-A receptors by non-A, non-B CCK receptors in the response of the gastric vagal afferent nerve to CCK-8 in OLETF rats. Because heart rate has been shown to decrease through stimulation of CCK-A receptors in normal rats [7], the present study was performed to investigate whether the response of heart rate to i.v. administration of CCK was totally impaired in OLETF rats, or whether it was functionally compensated in a similar way to the response of the gastric vagal afferents [10]. The control strain of LongEvans Tokushima Otsuka (LETO) rats was used for comparison. The location of CCK-A receptors and CCK-B re-
0196-9781/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 0 1 ) 0 0 4 5 2 - 1
1280
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
ceptors in the heart of the control LETO rats was determined using a polymerase chain reaction (PCR).
2. Materials and methods
polygraph recorder. After 30 min of stable recording had been obtained, CCK-8 was i.v. administered. The heart rate was measured at -30, 0, 30, 60, 90, 120, 180, 240 and 300 s after CCK-8 (or G-Gly or saline) injection, and is expressed as an increment or a decrement from the pre-administration control value.
2.1. Animals and general preparation Experiments were performed on nine male OLETF rats (350 – 440 g) and eight male LETO rats (280 –310 g) obtained from Tokushima Research Institute, Tokushima, Japan. Animals were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (60 mg 䡠 kg⫺1, Abbot Lab., North Chicago, IL, USA). The trachea of each rat was catheterized to allow maintenance with a ventilator (Model SN-480 –7, Shinano, Tokyo, Japan). The femoral vein was cannulated for the i.v. administration of substances such as CCK-8. The jugular vein was cannulated for the constant infusion of pentobarbital and a muscle relaxant, gallamine triethiodide (Sigma Chemical Co., St. Louis, MO, USA). Blood pressure was monitored continuously from the femoral artery and was kept above 90 mmHg (systolic) by the administration of 4% Ficoll 70 (Pharmacia Fine Chemicals, Uppsala, Sweden). Rectal temperature was maintained at 37.5 ⫾ 0.1°C by a heating pad and an infrared lamp (ATB1100, Nihon-Kohden, Tokyo). All surgical procedures mentioned above were finished about 40 –50 min after the initial injection of the anesthetic. Additional pentobarbital sodium (5–10 mg 䡠 kg⫺1 䡠 h⫺1) and gallamine triethiodide (10 –20 mg 䡠 kg⫺1 䡠 h⫺1) were administered i.v. by an infusion pump (model 235, ATOM, Tokyo). During the experiment, the depth of anesthesia was routinely judged by observing the blood pressure fluctuation in the animal. 2.1.1. Drug treatment Sulfated cholecystokinin octapeptide (CCK-8) (Peptide Institute, Osaka, Japan) was first dissolved in saline containing 0.1% bovine serum albumin (BSA) at a concentration of 100 nmol 䡠 ml⫺1 and then diluted with saline to the administration dosages. CCK-8 was cumulatively administered at doses of 30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1 at a volume of 0.5 ml 䡠 kg⫺1. MK-329 (ML Lab, London, England), a CCK-A receptor antagonist, and L-365,260 (ML Lab), a CCK-B receptor antagonist, were first dissolved in dimethyl sufloxide at a concentration of 15 mol 䡠 ml⫺1, and then diluted with saline to 750 nmol 䡠 ml⫺1. Synthesized glycine-extended gastrin (G-Gly; Peptide Institute), one of the candidate substances for a specific ligand for non-A, non-B CCK receptors, was diluted similarly to CCK-8. These substances were injected at a speed of 0.01 ml 䡠 s⫺1. 2.1.2. Recording of heart rate The heart rate was calculated by the number of pulse waves of arterial blood pressure using a tachometer (AT601G, Nihon Kohden), and continuously recorded on a
2.2. Amplification of the coding regions of the CCK-A and -B receptor cDNAs in the heart of LETO rats Three additional LETO rats were sacrificed by decapitation and the hearts immediately removed and washed with 10 ml of cold isotonic saline. The right and left atria and ventricles were removed and frozen promptly in liquid nitrogen. Total RNA was extracted from the tissue by the acid-guanidium thiocyanate-phenol-chloroform method. The quantity and purity of RNA were determined from the absorbances at 260 and 280 nm. Ribosomal RNA bands were visualized by ethidium bromide staining and subsequent ultraviolet illumination. For cDNA synthesis, RNA (1 g) was incubated for 60 min at 37°C in a reaction mixture with Moloney Murine Leukemia Virus reverse transcriptase using First-Strand cDNA Synthesis kit (Pharmacia LKB Biotechnology, Uppsala, Sweden). For amplification of the coding region of the CCK-A receptor precursor cDNA, PCR was carried out for 40 cycles in a reaction mixture containing the above cDNA solution, 2.5 units of Taq DNA polymerase (Seikagaku Corp. Tokyo, Japan) and 50 pmol each of the sense and antisense primers, which correspond to the nucleotide sequence of rat CCK-A receptor precursor cDNA [22] (nucleotide 317–337: AGTCTGCACTGCAGATTCTCC, and 1129 –1109: GCTTCTTGGCTATCAGGTTGG) and rat 2 microglobulin cDNA (nucleotide 284 –303: ACCGAGAC CGATGTATATGC and 373–392: TGATTCAGAGCTC CATAGAG) as an internal standard. For amplification of the coding region of the CCK-B receptor precursor cDNA, PCR was carried out using sense and antisense primers, which corresponded to the nucleotide sequence of rat CCK-B receptor precursor cDNA (nucleotide 1276 –1297, CACTTGCTGAGCTACGTCTCTG and nucleotide 1848 –1870, GTCACTTCTGCACTAGGCTATGG) [23] and rat 2 microglobulin cDNA as an internal standard. Cycles were carried out at 96°C for 3 min, 54°C for 30 sec, 72°C for 60 sec (1 cycle) and 94°C for 30 sec, at 54°C for 3 min and at 72°C for 3 min (40 cycles). The reaction product was fractionated by electrophoresis on a NuSieve agarose (3%) gel. After electrophoresis, the gel was stained with ethidium bromide. 2.3. Southern blot analysis of PCR amplified cDNA (PCR-southern) The PCR reaction product was separated electrophoretically on a NuSieve agarose (3%) gel and blotted onto a nylon membrane. The blot was hybridized with a [32P]labeled cDNA probe of the rat CCK-A and CCK-B receptor
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
1281
the control level after about 3 min. The maximum decrement of the heart rate was 60 ⫾ 9 beats/min after administration of 3 nmol 䡠 kg⫺1 of CCK-8 (n ⫽ 5 rats) (Fig. 1G). The heart rate response to 3 nmol CCK injection was significant in comparison with the response to saline injection (treatment ⫻ time interaction F(1,7) ⫽ 31.5, P ⬍ 0.001). Arterial blood pressure did not show any consistent responses to injection of 3 nmol CCK-8 (mean changes were –2.0 ⫾ 3.7 mmHg at 30 s after the injection). Injection of the smaller 30 or 300 pmol 䡠 kg⫺1 CCK-8 doses produced no significant changes in the heart rate. In three rats, it was confirmed that pretreatment with neither propranolol, a -blocker, nor atropine, a muscarinic cholinergic blocker, influenced the bradycardiac response to 3 nmol䡠kg⫺1 CCK-8 (data not shown). 3.2. Response of heart rate in OLETF rats
Fig. 1. Responses of heart rate to i.v. administration of cholecystokinin octapeptide (CCK-8; 30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1) in LETO and OLETF rats. A-F: Sample recordings from one LETO rat (A-C) and one OLETF rat (D-F). G, H: Summarized responses for five LETO (G) and five OLETF rats (H) for each group. Ordinates: The magnitude of the response is expressed as changes from the pre-administration control value. Abscissa: 0 indicates the time of the injection of CCK-8 or saline. The data are means ⫾ S.E.M. **P ⬍ 0.01, between the CCK-8-injected group and the saline-injected group.
coding region, at 37°C overnight and washed with decreasing concentrations of SSC to a final concentration of 0.1 ⫻ SSC with 0.1% SDS at 65°C, and then autoradiographed as described [6,13]. 2.4. Statistical analysis Data are expressed as mean ⫾ S.E.M. Comparisons of group differences were made by analysis of variance (ANOVA) followed by Dunnett’s t test. Probability values of less than 5% were considered significant.
3. Results 3.1. Response of heart rate in LETO rats As shown in the sample recordings in Fig. 1A-C, i.v. administration of 3 nmol 䡠 kg⫺1 CCK-8 decreased the heart rate in LETO rats. The decrease reached a maximum about 30 – 60 s after the administration and gradually returned to
As shown in Figs. 1D-F and H, i.v. administration of CCK-8 (30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1) had no effect on the heart rate in OLETF rats. Injection of the highest dose, 30 nmol 䡠 kg⫺1 CCK-8, also had no effect on the heart rate in the OLETF rats (in 3 rats, data not shown). Furthermore, G-Gly (30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1, 3 nmol 䡠 kg⫺1 and 30 nmol 䡠 kg⫺1), one of the candidate substances for a specific ligand of non-A, non-B CCK receptors, had no effect on the heart rate (data not shown). 3.3. Involvement of CCK-A and CCK-B receptors in heart rate response The decreased response of the heart rate to i.v. administration of 3 nmol 䡠 kg⫺1 CCK-8 in LETO rats was not influenced by pretreatment with 750 nmol 䡠 kg⫺1 L-365,260, a CCK-B receptor antagonist (Fig. 2B and D). However, the response was totally absent after pretreatment with 750 nmol 䡠 kg⫺1 MK-329, a CCK-A receptor antagonist (treatment ⫻ time interaction F(1,7) ⫽ 34.3, P ⬍ 0.001) (Fig. 2C and D). The lack of response in heart rate to i.v. administration of CCK-8 in the OLETF rats was not modified by pretreatment with L-365,260 or MK-329. 3.4. Expression of the CCK-A and CCK-B receptor precursor genes in the heart of LEO rats From the RNA of the right and left atria of the heart in LETO rats, we obtained one amplified DNA band after 40 PCR cycles, which corresponded to the expected size of DNA amplified from the CCK-A receptor precursor mRNA (495 base pairs). This DNA was not obtained from the ventricles, although the 2 microglobulin precursor mRNA, used as an internal standard, was detected. PCR-Southernblotting detected a single hybridizing fragment of 0.5 kb in the atrial DNA (Fig. 3 upper column).
1282
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
Fig. 2. Effects of L-365,260, a type B CCK receptor antagonist and MK-329, a CCK-A receptor antagonist, on the responses of heart rate to an i.v. administration of CCK-8 (3 nmol 䡠 kg⫺1) in LETO rats. A-C: Sample recordings from one LETO rat. D: Summarized responses in five LETO rats. L-365,260 or MK-329 was injected i.v. 5 min before the administration of CCK-8. **P ⬍ 0.01, between the CCK-8-injected group and the saline-injected group. #P ⬍ 0.05, ##P ⬍ 0.01, between the group before treatment and the group after treatment with MK-329. See Fig. 1 for other details.
From the heart RNA (both atrial and ventricular), we obtained one amplified DNA band after 40 PCR cycles, which corresponded to the expected size of DNA amplified from the CCK-B receptor precursor mRNA (595 base pairs). The 2 microglobulin precursor mRNA, used as an internal standard, was detected. PCR-Southern-blotting detected a single hybridizing fragment of 0.6 kb (Fig. 3 lower column).
4. Discussion
Fig. 3. Upper: Autoradiograms of CCK-A receptor in PCR-amplified cDNA fragments from LETO rats by Southern blot hybridization using a radio-labelled full length CCK-A receptor cDNA probe. Autoradiograms of PCR-Southern blots displayed a single band of 0.5 kb. Marker (M): Hap II digested pUC19, 1: right atrium, 2: right ventricle, 3: left atrium, 4: left ventricle. Lower: Autoradiograms of CCK-B receptor in PCR-amplified cDNA fragments from LETO rats by Southern blot hybridization using a radio-labelled full length CCK-B receptor cDNA probe. Autoradiograms of PCR-Southern blots displayed a single band of 0.6 kb. Marker (M): Hap II digested pUC19, 1: right atrium, 2: right ventricle, 3: left atrium, 4: left ventricle.
The present results demonstrated that i.v. administration of CCK-8 produces bradycardia via stimulation of CCK-A receptors located at the atrium in control LETO rats. There was no response in heart rate to i.v. administered CCK-8 in CCK-A receptor deficient OLETF rats. Gaw et al. [7] showed that heart rate response to CCK-8 is independent of autonomic nerve activity, and suggested that CCK-8 directly stimulates CCK-A receptors in rat hearts. In accordance with this, we have also shown in the present study that neither pretreatment with propranolol nor atropine affected the bradycardiac response to CCK-8 in LETO rats. Also, no consistent responses to CCK-8 were seen in the blood pressure, indicating that the bradycardia is
not due to baro-receptor reflex. Furthermore, we found that the localization of CCK-A receptors was restricted to the atrium, and not the ventricle. Taken together, these results indicate that the bradycardiac response to CCK-8 was induced via stimulation of CCK-A receptors in the atrium. The restricted localization of CCK-A receptors in the atrium suggests that CCK-8 decreases heart rate by inhibiting the pacemaker cells and/or impulse conducting system in the atrium although the heart rate is influenced by a change in cardiac contractility. It is well known that anesthetics such as barbiturates inhibit vagal efferent tone. This allows a possibility that the
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
bradycardia induced by systemic administration of CCK-8 may be masked in animals with normal vagal efferent tone due to vagal action of CCK-8. That is, cardiac vagal efferent activity in these animals may reflexly decrease following increases of cardiac vagal afferent activity caused by the stimulation of CCK-A receptors located in its terminals, such as is the mechanism of reflex decrease observed in gastric vagal efferent activity [3]. However, we have shown that i.v. administration of CCK-8 has no influence on vagal afferent activity in the thoracic organs [3], suggesting that CCK-A receptors are not located (or functioning) in the terminals of the thoracic (e.g. lung and cardiac) vagal afferents. Thus, it is unlikely that vagal action of CCK-8 masks the bradycardia in animals with normal vagal tone. One question raised is how does activation of the CCK-A receptors result in bradycardia. In 1992, Wank and collaborators [22,23] purified and cloned a CCK-A receptor cDNA from rat pancreas that allowed the isolation of an identical cDNA from rat brain by PCR. They concluded that the respective cDNAs for both CCK-A and CCK-B are identical in both the brain and the gastrointestinal system. This would suggest that results obtained from studying neuronal activity following CCK-A receptor stimulation would give some insight into how CCK-8 decreases the heart rate. In the study by Branchereau and collaborators [2], ionic conductances controlled by CCK-A receptors were studied in neurons of the rat nucleus tractus solitarius and the dorsal motor nucleus of the vagus, using intracellular and whole-cell patch clamp recordings. It was demonstrated that CCK-A receptor-related inhibition was associated with membrane hyperpolarization and a decrease in input resistance that developed after the challenge. The CCK-A receptor-related inhibition was also seen to be partly generated by a potassium current. Although CCK-B receptors were localized in both the atrium and the ventricle, no contribution of the CCK-B receptors to the chronotropic action of CCK was observed. Further investigation of the functional involvement of the CCK-B receptors in the heart is required. In the present study, expression of CCK receptors was not examined in OLETF rats because they do not express CCK-A receptors due to a genetic abnormality [6] and the gene expression of CCK-B receptors was similar to that in LETO rats [12]. In addition, distribution of non-A, non-B CCK receptors could not be determined because they have not yet been successfully cloned. Recently, we demonstrated that excitation of vagal afferents to CCK-8, which is elicited via stimulation of CCK-A receptors in the control LETO rats, was not totally impaired in OLETF rats [10]. That is, CCK slightly increased the vagal afferent activity in OLETF rats, and the increase was not influenced by treatment with either a CCK-A or a CCK-B receptor antagonist. These results suggest that there is functional compensation for the lack of CCK-A receptors by non-A, non-B CCK receptors in the response of the gastric vagal afferent nerve to CCK-8 in OLETF rats. In contrast, the present study showed no re-
1283
sponse in heart rate to systemic injection of CCK-8 in OLETF rats, suggesting that there is no functional compensation in heart rate for the lack of CCK-A receptors. Acknowledgments The authors thank Ms. Yoneko Sasanuma and Mr. Hisao Muroi for their excellent assistance. This work was supported by a SRF Grant for Biomedical Research. We are grateful to ML Lab (London, England) for providing MK329 and L-365,260. References [1] Baber NS, Dourish CT, Hill DR. The role of CCK, caerulein, and CCK antagonists in nociception. Pain 1989;39:307–28. [2] Branchereau P, Champagnat J, Denavit-Saubie M. Cholecystokiningated currents in neurons of the rat solitary complex in vitro. J Neurophysiol 1993;70:2584 –95. [3] Bucinskaite V, Kurosawa M, Lundeberg T. Exogenous cholecystokinin-8 reduces vagal efferent nerve activity in rats through CCKA receptors. Br J Pharmacol 2000;129:1649 –54. [4] Dauge V, Lena I. CCK in anxiety, and cognitive processes. Neurosci Biobehav Rev 1998;22:815–25. [5] Funakoshi A, Miyasaka K, Shinozaki H, Arita Y, Nakano I, Nawara H. Regulation of pancreatic exocrine function in Otsuka Long-Evans Tokushima Fatty (OLETF) rats without gene expression of cholecystokinin-A receptor. Intern Med 1996;35:249 –56. [6] Funakoshi A, Miyasaka K, Shinozaki H, Masuda M, Kawanami T, Takata Y, Kono A. An animal model of congenital defect of gene expression of cholecystokinin (CCK)-A receptor. Biochem Biophys Res Commun 1995;210:787–96. [7] Gaw AJ, Hills DM, Spraggs CF. Characterization of the receptors and mechanisms involved in the cardiovascular actions of sCCK-8 in the pithed rat. Br J Pharmacol 1995;115:660 – 4. [8] Gibbs J, Young RC, Smith GP. Cholecystokinin decreases food intake in rats. J Comp Physiol Psychol 1973;84:488 –95. [9] Johnson LR. Pancreatic secretion. In: Johnson LR, editor. Gastrointestinal physiology. St. Louis: Mosby, 1985. p. 83–93. [10] Kurosawa M, Bucinskaite V, Taniguchi T, Miyasaka K, Funakoshi A, Lundeberg T. Response of the gastric vagal afferent activity to cholecystokinin in rats lacking type A cholecystokinin receptors. J Auton Nerv Syst 1999;75:51–9. [11] Kurosawa M, Uvna¨s-Moberg K, Miyasaka K, Lundeberg, T. Interleukin-1 (IL-1) increases activity of the gastric vagal afferent nerve partly via stimulation of type A CCK receptor in anesthetized rats. J Auton Nerv Syst 1997;62:72– 8. [12] Miyasaka K, Kanai S, Ohta M, Kawanami T, Kono A, Funakoshi A. Lack of satiety effect of cholecystokinin (CCK) in a new rat model not expressing the CCK-A receptor gene. Neurosci Lett 1994;180:143– 6. [13] Miyasaka K, Masuda M, Kawanami T, Funakoshi A. Neurohormonal regulation of pancreatic exocrine function in rats without gene expression of cholecystokinin-A receptor. Pancreas 1996;12:272–9. [14] Raybould HE, Roberts ME, Dockray GJ. Reflex decreases in intragastric pressure in response to cholecystokinin in rats. Am J Physiol 1987;253:G165–70. [15] Schwarz GJ, McHugh PR, Moran TH. Pharmacological dissociation of responses to CCK and gastric loads in rat mechanosensitive vagal afferents. Am J Physiol 1994;267:R303– 8. [16] Seva C, Dickinson CJ, Yamada T. Growth-promoting effects of glycine-extended progastrin. Science 1994;265:410 –2. [17] Shoji E, Okumura T, Onodera S, Takahashi N, Harada K, Kohgo Y. Gastric emptying in OLETF rats not expressing CCK-A receptor gene. Dig Dis Sci 1997;42:915–9.
1284
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
[18] Singh P, Owlia A, Espeijo R, Dai B. Novel gastrin receptors mediate mitogenic effects of gastrin and processing intermediates of gastrin on Swiss 3T3 fibroblasts. J Biol Chem 1995;270:8429 –38. [19] Smith GP, Jerome C, Cushin BJ, Eterno R, Simansky KJ. Abdominal vagotomy blocks the satiety effect of cholecystokinin in the rat. Science 1981;213:1036 –7. [20] Takiguchi S, Takata Y, Funakoshi A, Miyasaka K, Kataoka K, Fujimura Y, Goto T, Kono A. Disrupted cholecystokinin type-A receptor (CCK-AR) gene in OLETF rats. Gene 1997;197:169 –75.
[21] Wank SA. Cholecystokinin receptors. Am J Physiol 1995;269:G628 – G46. [22] Wank SA, Harkins R, Jensen RT, Shapira H, De Weerth A, Slattery, T. Purification, molecular cloning, and functional expression of the cholecystokinin receptor from rat pancreas. Proc Natl Acad Sci USA 1992a;89:3125–9. [23] Wank SA, Pisegna JR, De Weerth A. Brain and gastrointestinal cholecystokinin receptor family: Structure and functional expression. Proc Natl Acad Sci USA 1992b;89:8691–5.
Cholecystokinin-8 (CCK-8) has no effect on heart rate in rats lacking CCK-A receptors Mieko Kurosawaa,*, Setsu Iijimaa, Akihiro Funakoshib, Takako Kawanamib, Kyoko Miyasakac, Violeta Bucinskaited, Thomas Lundebergd a
Basic Medical Research Center, International University Health and Welfare, Otawara, Tochigi 324-8501, Japan b Department of Gastroenterology, National Kyushu Cancer Center, Fukuoka 811-1395, Japan c Department of Clinical Physiology, Tokyo Metropolitan Institute of Gerontology, Itabashi, Tokyo 173-0015, Japan d Department of Physiology and Pharmacology, Karolinska Institutet, 171–77 Stockholm, Sweden Received 13 November 2000; accepted 4 February 2001
Abstract Heart rate responses to i.v. administration of cholecystokinin-8 (CCK-8) were investigated in Otsuka Long-Evans Tokushima Fatty (OLETF) rats lacking CCK-A receptors and control Long-Evans Tokushima Otsuka (LETO) rats. The heart rate decreased after i.v. administration of 3 nmol䡠kg⫺1 of CCK-8 in LETO rats, but not in OLETF rats. Bradycardia in the LETO rats disappeared after treatment with MK-329, but not after treatment with L-365,260. The expression of CCK-A receptor precursor mRNA was found exclusively in the atrium in LETO rats. These results suggest that CCK-8 decreases heart rate via CCK-A receptors located in the atrium of the rats. © 2001 Elsevier Science Inc. All rights reserved. Keywords: Heart rate; Cholecystokinin; Type A CCK receptors; Otsuka Long-Evans Tokushima Fatty (OLETF) rats; Long-Evans Tokushima Otsuka (LETO) rats; Atrium; Ventricle
1. Introduction Cholecystokinin (CCK) is a neuropeptide known to cause contraction of the gallbladder and to stimulate pancreatic enzyme secretion [9]. In addition, CCK has various regulatory roles in satiety [8,19], nociception [1], anxiety [4], gastric motility [14] and heart rate [7]. These regulatory roles are exerted via stimulation of either type A CCK (CCK-A) receptors or type B CCK (CCK-B) receptors [21]. Additional receptors of neither type A, nor type B CCK receptors have been recently identified [16,18]. A congenital defect in the expression of CCK-A receptor genes was recently demonstrated in Otsuka Long-Evans Tokushima Fatty (OLETF) rats [6,20], which have been established as an animal model of non-insulin-dependent diabetes mellitus and obesity. The expression of the CCK-B receptor is intact in the OLETF rats [6,12]. CCK-A receptor * Corresponding author. Tel.: ⫹81-287-24-3180; fax: ⫹81-287-243191. E-mail address: [email protected] (M. Kurosawa).
mediated responses such as pancreatic exocrine enzyme secretion and gastric emptying, reported in normal CCK-A receptor intact rats, were not observed in OLETF rats [5,17]. In contrast, excitation of vagal afferents to CCK, which is also elicited via stimulation of CCK-A receptors in normal rats [11,15], was not totally impaired in OLETF rats [10]. That is, CCK slightly increased vagal afferent activity in OLETF rats, and the increase was not influenced by treatment with either CCK-A or CCK-B receptor antagonists. These results suggest that there is functional compensation for the lack of CCK-A receptors by non-A, non-B CCK receptors in the response of the gastric vagal afferent nerve to CCK-8 in OLETF rats. Because heart rate has been shown to decrease through stimulation of CCK-A receptors in normal rats [7], the present study was performed to investigate whether the response of heart rate to i.v. administration of CCK was totally impaired in OLETF rats, or whether it was functionally compensated in a similar way to the response of the gastric vagal afferents [10]. The control strain of LongEvans Tokushima Otsuka (LETO) rats was used for comparison. The location of CCK-A receptors and CCK-B re-
0196-9781/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 0 1 ) 0 0 4 5 2 - 1
1280
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
ceptors in the heart of the control LETO rats was determined using a polymerase chain reaction (PCR).
2. Materials and methods
polygraph recorder. After 30 min of stable recording had been obtained, CCK-8 was i.v. administered. The heart rate was measured at -30, 0, 30, 60, 90, 120, 180, 240 and 300 s after CCK-8 (or G-Gly or saline) injection, and is expressed as an increment or a decrement from the pre-administration control value.
2.1. Animals and general preparation Experiments were performed on nine male OLETF rats (350 – 440 g) and eight male LETO rats (280 –310 g) obtained from Tokushima Research Institute, Tokushima, Japan. Animals were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (60 mg 䡠 kg⫺1, Abbot Lab., North Chicago, IL, USA). The trachea of each rat was catheterized to allow maintenance with a ventilator (Model SN-480 –7, Shinano, Tokyo, Japan). The femoral vein was cannulated for the i.v. administration of substances such as CCK-8. The jugular vein was cannulated for the constant infusion of pentobarbital and a muscle relaxant, gallamine triethiodide (Sigma Chemical Co., St. Louis, MO, USA). Blood pressure was monitored continuously from the femoral artery and was kept above 90 mmHg (systolic) by the administration of 4% Ficoll 70 (Pharmacia Fine Chemicals, Uppsala, Sweden). Rectal temperature was maintained at 37.5 ⫾ 0.1°C by a heating pad and an infrared lamp (ATB1100, Nihon-Kohden, Tokyo). All surgical procedures mentioned above were finished about 40 –50 min after the initial injection of the anesthetic. Additional pentobarbital sodium (5–10 mg 䡠 kg⫺1 䡠 h⫺1) and gallamine triethiodide (10 –20 mg 䡠 kg⫺1 䡠 h⫺1) were administered i.v. by an infusion pump (model 235, ATOM, Tokyo). During the experiment, the depth of anesthesia was routinely judged by observing the blood pressure fluctuation in the animal. 2.1.1. Drug treatment Sulfated cholecystokinin octapeptide (CCK-8) (Peptide Institute, Osaka, Japan) was first dissolved in saline containing 0.1% bovine serum albumin (BSA) at a concentration of 100 nmol 䡠 ml⫺1 and then diluted with saline to the administration dosages. CCK-8 was cumulatively administered at doses of 30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1 at a volume of 0.5 ml 䡠 kg⫺1. MK-329 (ML Lab, London, England), a CCK-A receptor antagonist, and L-365,260 (ML Lab), a CCK-B receptor antagonist, were first dissolved in dimethyl sufloxide at a concentration of 15 mol 䡠 ml⫺1, and then diluted with saline to 750 nmol 䡠 ml⫺1. Synthesized glycine-extended gastrin (G-Gly; Peptide Institute), one of the candidate substances for a specific ligand for non-A, non-B CCK receptors, was diluted similarly to CCK-8. These substances were injected at a speed of 0.01 ml 䡠 s⫺1. 2.1.2. Recording of heart rate The heart rate was calculated by the number of pulse waves of arterial blood pressure using a tachometer (AT601G, Nihon Kohden), and continuously recorded on a
2.2. Amplification of the coding regions of the CCK-A and -B receptor cDNAs in the heart of LETO rats Three additional LETO rats were sacrificed by decapitation and the hearts immediately removed and washed with 10 ml of cold isotonic saline. The right and left atria and ventricles were removed and frozen promptly in liquid nitrogen. Total RNA was extracted from the tissue by the acid-guanidium thiocyanate-phenol-chloroform method. The quantity and purity of RNA were determined from the absorbances at 260 and 280 nm. Ribosomal RNA bands were visualized by ethidium bromide staining and subsequent ultraviolet illumination. For cDNA synthesis, RNA (1 g) was incubated for 60 min at 37°C in a reaction mixture with Moloney Murine Leukemia Virus reverse transcriptase using First-Strand cDNA Synthesis kit (Pharmacia LKB Biotechnology, Uppsala, Sweden). For amplification of the coding region of the CCK-A receptor precursor cDNA, PCR was carried out for 40 cycles in a reaction mixture containing the above cDNA solution, 2.5 units of Taq DNA polymerase (Seikagaku Corp. Tokyo, Japan) and 50 pmol each of the sense and antisense primers, which correspond to the nucleotide sequence of rat CCK-A receptor precursor cDNA [22] (nucleotide 317–337: AGTCTGCACTGCAGATTCTCC, and 1129 –1109: GCTTCTTGGCTATCAGGTTGG) and rat 2 microglobulin cDNA (nucleotide 284 –303: ACCGAGAC CGATGTATATGC and 373–392: TGATTCAGAGCTC CATAGAG) as an internal standard. For amplification of the coding region of the CCK-B receptor precursor cDNA, PCR was carried out using sense and antisense primers, which corresponded to the nucleotide sequence of rat CCK-B receptor precursor cDNA (nucleotide 1276 –1297, CACTTGCTGAGCTACGTCTCTG and nucleotide 1848 –1870, GTCACTTCTGCACTAGGCTATGG) [23] and rat 2 microglobulin cDNA as an internal standard. Cycles were carried out at 96°C for 3 min, 54°C for 30 sec, 72°C for 60 sec (1 cycle) and 94°C for 30 sec, at 54°C for 3 min and at 72°C for 3 min (40 cycles). The reaction product was fractionated by electrophoresis on a NuSieve agarose (3%) gel. After electrophoresis, the gel was stained with ethidium bromide. 2.3. Southern blot analysis of PCR amplified cDNA (PCR-southern) The PCR reaction product was separated electrophoretically on a NuSieve agarose (3%) gel and blotted onto a nylon membrane. The blot was hybridized with a [32P]labeled cDNA probe of the rat CCK-A and CCK-B receptor
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
1281
the control level after about 3 min. The maximum decrement of the heart rate was 60 ⫾ 9 beats/min after administration of 3 nmol 䡠 kg⫺1 of CCK-8 (n ⫽ 5 rats) (Fig. 1G). The heart rate response to 3 nmol CCK injection was significant in comparison with the response to saline injection (treatment ⫻ time interaction F(1,7) ⫽ 31.5, P ⬍ 0.001). Arterial blood pressure did not show any consistent responses to injection of 3 nmol CCK-8 (mean changes were –2.0 ⫾ 3.7 mmHg at 30 s after the injection). Injection of the smaller 30 or 300 pmol 䡠 kg⫺1 CCK-8 doses produced no significant changes in the heart rate. In three rats, it was confirmed that pretreatment with neither propranolol, a -blocker, nor atropine, a muscarinic cholinergic blocker, influenced the bradycardiac response to 3 nmol䡠kg⫺1 CCK-8 (data not shown). 3.2. Response of heart rate in OLETF rats
Fig. 1. Responses of heart rate to i.v. administration of cholecystokinin octapeptide (CCK-8; 30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1) in LETO and OLETF rats. A-F: Sample recordings from one LETO rat (A-C) and one OLETF rat (D-F). G, H: Summarized responses for five LETO (G) and five OLETF rats (H) for each group. Ordinates: The magnitude of the response is expressed as changes from the pre-administration control value. Abscissa: 0 indicates the time of the injection of CCK-8 or saline. The data are means ⫾ S.E.M. **P ⬍ 0.01, between the CCK-8-injected group and the saline-injected group.
coding region, at 37°C overnight and washed with decreasing concentrations of SSC to a final concentration of 0.1 ⫻ SSC with 0.1% SDS at 65°C, and then autoradiographed as described [6,13]. 2.4. Statistical analysis Data are expressed as mean ⫾ S.E.M. Comparisons of group differences were made by analysis of variance (ANOVA) followed by Dunnett’s t test. Probability values of less than 5% were considered significant.
3. Results 3.1. Response of heart rate in LETO rats As shown in the sample recordings in Fig. 1A-C, i.v. administration of 3 nmol 䡠 kg⫺1 CCK-8 decreased the heart rate in LETO rats. The decrease reached a maximum about 30 – 60 s after the administration and gradually returned to
As shown in Figs. 1D-F and H, i.v. administration of CCK-8 (30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1 and 3 nmol 䡠 kg⫺1) had no effect on the heart rate in OLETF rats. Injection of the highest dose, 30 nmol 䡠 kg⫺1 CCK-8, also had no effect on the heart rate in the OLETF rats (in 3 rats, data not shown). Furthermore, G-Gly (30 pmol 䡠 kg⫺1, 300 pmol 䡠 kg⫺1, 3 nmol 䡠 kg⫺1 and 30 nmol 䡠 kg⫺1), one of the candidate substances for a specific ligand of non-A, non-B CCK receptors, had no effect on the heart rate (data not shown). 3.3. Involvement of CCK-A and CCK-B receptors in heart rate response The decreased response of the heart rate to i.v. administration of 3 nmol 䡠 kg⫺1 CCK-8 in LETO rats was not influenced by pretreatment with 750 nmol 䡠 kg⫺1 L-365,260, a CCK-B receptor antagonist (Fig. 2B and D). However, the response was totally absent after pretreatment with 750 nmol 䡠 kg⫺1 MK-329, a CCK-A receptor antagonist (treatment ⫻ time interaction F(1,7) ⫽ 34.3, P ⬍ 0.001) (Fig. 2C and D). The lack of response in heart rate to i.v. administration of CCK-8 in the OLETF rats was not modified by pretreatment with L-365,260 or MK-329. 3.4. Expression of the CCK-A and CCK-B receptor precursor genes in the heart of LEO rats From the RNA of the right and left atria of the heart in LETO rats, we obtained one amplified DNA band after 40 PCR cycles, which corresponded to the expected size of DNA amplified from the CCK-A receptor precursor mRNA (495 base pairs). This DNA was not obtained from the ventricles, although the 2 microglobulin precursor mRNA, used as an internal standard, was detected. PCR-Southernblotting detected a single hybridizing fragment of 0.5 kb in the atrial DNA (Fig. 3 upper column).
1282
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
Fig. 2. Effects of L-365,260, a type B CCK receptor antagonist and MK-329, a CCK-A receptor antagonist, on the responses of heart rate to an i.v. administration of CCK-8 (3 nmol 䡠 kg⫺1) in LETO rats. A-C: Sample recordings from one LETO rat. D: Summarized responses in five LETO rats. L-365,260 or MK-329 was injected i.v. 5 min before the administration of CCK-8. **P ⬍ 0.01, between the CCK-8-injected group and the saline-injected group. #P ⬍ 0.05, ##P ⬍ 0.01, between the group before treatment and the group after treatment with MK-329. See Fig. 1 for other details.
From the heart RNA (both atrial and ventricular), we obtained one amplified DNA band after 40 PCR cycles, which corresponded to the expected size of DNA amplified from the CCK-B receptor precursor mRNA (595 base pairs). The 2 microglobulin precursor mRNA, used as an internal standard, was detected. PCR-Southern-blotting detected a single hybridizing fragment of 0.6 kb (Fig. 3 lower column).
4. Discussion
Fig. 3. Upper: Autoradiograms of CCK-A receptor in PCR-amplified cDNA fragments from LETO rats by Southern blot hybridization using a radio-labelled full length CCK-A receptor cDNA probe. Autoradiograms of PCR-Southern blots displayed a single band of 0.5 kb. Marker (M): Hap II digested pUC19, 1: right atrium, 2: right ventricle, 3: left atrium, 4: left ventricle. Lower: Autoradiograms of CCK-B receptor in PCR-amplified cDNA fragments from LETO rats by Southern blot hybridization using a radio-labelled full length CCK-B receptor cDNA probe. Autoradiograms of PCR-Southern blots displayed a single band of 0.6 kb. Marker (M): Hap II digested pUC19, 1: right atrium, 2: right ventricle, 3: left atrium, 4: left ventricle.
The present results demonstrated that i.v. administration of CCK-8 produces bradycardia via stimulation of CCK-A receptors located at the atrium in control LETO rats. There was no response in heart rate to i.v. administered CCK-8 in CCK-A receptor deficient OLETF rats. Gaw et al. [7] showed that heart rate response to CCK-8 is independent of autonomic nerve activity, and suggested that CCK-8 directly stimulates CCK-A receptors in rat hearts. In accordance with this, we have also shown in the present study that neither pretreatment with propranolol nor atropine affected the bradycardiac response to CCK-8 in LETO rats. Also, no consistent responses to CCK-8 were seen in the blood pressure, indicating that the bradycardia is
not due to baro-receptor reflex. Furthermore, we found that the localization of CCK-A receptors was restricted to the atrium, and not the ventricle. Taken together, these results indicate that the bradycardiac response to CCK-8 was induced via stimulation of CCK-A receptors in the atrium. The restricted localization of CCK-A receptors in the atrium suggests that CCK-8 decreases heart rate by inhibiting the pacemaker cells and/or impulse conducting system in the atrium although the heart rate is influenced by a change in cardiac contractility. It is well known that anesthetics such as barbiturates inhibit vagal efferent tone. This allows a possibility that the
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
bradycardia induced by systemic administration of CCK-8 may be masked in animals with normal vagal efferent tone due to vagal action of CCK-8. That is, cardiac vagal efferent activity in these animals may reflexly decrease following increases of cardiac vagal afferent activity caused by the stimulation of CCK-A receptors located in its terminals, such as is the mechanism of reflex decrease observed in gastric vagal efferent activity [3]. However, we have shown that i.v. administration of CCK-8 has no influence on vagal afferent activity in the thoracic organs [3], suggesting that CCK-A receptors are not located (or functioning) in the terminals of the thoracic (e.g. lung and cardiac) vagal afferents. Thus, it is unlikely that vagal action of CCK-8 masks the bradycardia in animals with normal vagal tone. One question raised is how does activation of the CCK-A receptors result in bradycardia. In 1992, Wank and collaborators [22,23] purified and cloned a CCK-A receptor cDNA from rat pancreas that allowed the isolation of an identical cDNA from rat brain by PCR. They concluded that the respective cDNAs for both CCK-A and CCK-B are identical in both the brain and the gastrointestinal system. This would suggest that results obtained from studying neuronal activity following CCK-A receptor stimulation would give some insight into how CCK-8 decreases the heart rate. In the study by Branchereau and collaborators [2], ionic conductances controlled by CCK-A receptors were studied in neurons of the rat nucleus tractus solitarius and the dorsal motor nucleus of the vagus, using intracellular and whole-cell patch clamp recordings. It was demonstrated that CCK-A receptor-related inhibition was associated with membrane hyperpolarization and a decrease in input resistance that developed after the challenge. The CCK-A receptor-related inhibition was also seen to be partly generated by a potassium current. Although CCK-B receptors were localized in both the atrium and the ventricle, no contribution of the CCK-B receptors to the chronotropic action of CCK was observed. Further investigation of the functional involvement of the CCK-B receptors in the heart is required. In the present study, expression of CCK receptors was not examined in OLETF rats because they do not express CCK-A receptors due to a genetic abnormality [6] and the gene expression of CCK-B receptors was similar to that in LETO rats [12]. In addition, distribution of non-A, non-B CCK receptors could not be determined because they have not yet been successfully cloned. Recently, we demonstrated that excitation of vagal afferents to CCK-8, which is elicited via stimulation of CCK-A receptors in the control LETO rats, was not totally impaired in OLETF rats [10]. That is, CCK slightly increased the vagal afferent activity in OLETF rats, and the increase was not influenced by treatment with either a CCK-A or a CCK-B receptor antagonist. These results suggest that there is functional compensation for the lack of CCK-A receptors by non-A, non-B CCK receptors in the response of the gastric vagal afferent nerve to CCK-8 in OLETF rats. In contrast, the present study showed no re-
1283
sponse in heart rate to systemic injection of CCK-8 in OLETF rats, suggesting that there is no functional compensation in heart rate for the lack of CCK-A receptors. Acknowledgments The authors thank Ms. Yoneko Sasanuma and Mr. Hisao Muroi for their excellent assistance. This work was supported by a SRF Grant for Biomedical Research. We are grateful to ML Lab (London, England) for providing MK329 and L-365,260. References [1] Baber NS, Dourish CT, Hill DR. The role of CCK, caerulein, and CCK antagonists in nociception. Pain 1989;39:307–28. [2] Branchereau P, Champagnat J, Denavit-Saubie M. Cholecystokiningated currents in neurons of the rat solitary complex in vitro. J Neurophysiol 1993;70:2584 –95. [3] Bucinskaite V, Kurosawa M, Lundeberg T. Exogenous cholecystokinin-8 reduces vagal efferent nerve activity in rats through CCKA receptors. Br J Pharmacol 2000;129:1649 –54. [4] Dauge V, Lena I. CCK in anxiety, and cognitive processes. Neurosci Biobehav Rev 1998;22:815–25. [5] Funakoshi A, Miyasaka K, Shinozaki H, Arita Y, Nakano I, Nawara H. Regulation of pancreatic exocrine function in Otsuka Long-Evans Tokushima Fatty (OLETF) rats without gene expression of cholecystokinin-A receptor. Intern Med 1996;35:249 –56. [6] Funakoshi A, Miyasaka K, Shinozaki H, Masuda M, Kawanami T, Takata Y, Kono A. An animal model of congenital defect of gene expression of cholecystokinin (CCK)-A receptor. Biochem Biophys Res Commun 1995;210:787–96. [7] Gaw AJ, Hills DM, Spraggs CF. Characterization of the receptors and mechanisms involved in the cardiovascular actions of sCCK-8 in the pithed rat. Br J Pharmacol 1995;115:660 – 4. [8] Gibbs J, Young RC, Smith GP. Cholecystokinin decreases food intake in rats. J Comp Physiol Psychol 1973;84:488 –95. [9] Johnson LR. Pancreatic secretion. In: Johnson LR, editor. Gastrointestinal physiology. St. Louis: Mosby, 1985. p. 83–93. [10] Kurosawa M, Bucinskaite V, Taniguchi T, Miyasaka K, Funakoshi A, Lundeberg T. Response of the gastric vagal afferent activity to cholecystokinin in rats lacking type A cholecystokinin receptors. J Auton Nerv Syst 1999;75:51–9. [11] Kurosawa M, Uvna¨s-Moberg K, Miyasaka K, Lundeberg, T. Interleukin-1 (IL-1) increases activity of the gastric vagal afferent nerve partly via stimulation of type A CCK receptor in anesthetized rats. J Auton Nerv Syst 1997;62:72– 8. [12] Miyasaka K, Kanai S, Ohta M, Kawanami T, Kono A, Funakoshi A. Lack of satiety effect of cholecystokinin (CCK) in a new rat model not expressing the CCK-A receptor gene. Neurosci Lett 1994;180:143– 6. [13] Miyasaka K, Masuda M, Kawanami T, Funakoshi A. Neurohormonal regulation of pancreatic exocrine function in rats without gene expression of cholecystokinin-A receptor. Pancreas 1996;12:272–9. [14] Raybould HE, Roberts ME, Dockray GJ. Reflex decreases in intragastric pressure in response to cholecystokinin in rats. Am J Physiol 1987;253:G165–70. [15] Schwarz GJ, McHugh PR, Moran TH. Pharmacological dissociation of responses to CCK and gastric loads in rat mechanosensitive vagal afferents. Am J Physiol 1994;267:R303– 8. [16] Seva C, Dickinson CJ, Yamada T. Growth-promoting effects of glycine-extended progastrin. Science 1994;265:410 –2. [17] Shoji E, Okumura T, Onodera S, Takahashi N, Harada K, Kohgo Y. Gastric emptying in OLETF rats not expressing CCK-A receptor gene. Dig Dis Sci 1997;42:915–9.
1284
M. Kurosawa et al. / Peptides 22 (2001) 1279 –1284
[18] Singh P, Owlia A, Espeijo R, Dai B. Novel gastrin receptors mediate mitogenic effects of gastrin and processing intermediates of gastrin on Swiss 3T3 fibroblasts. J Biol Chem 1995;270:8429 –38. [19] Smith GP, Jerome C, Cushin BJ, Eterno R, Simansky KJ. Abdominal vagotomy blocks the satiety effect of cholecystokinin in the rat. Science 1981;213:1036 –7. [20] Takiguchi S, Takata Y, Funakoshi A, Miyasaka K, Kataoka K, Fujimura Y, Goto T, Kono A. Disrupted cholecystokinin type-A receptor (CCK-AR) gene in OLETF rats. Gene 1997;197:169 –75.
[21] Wank SA. Cholecystokinin receptors. Am J Physiol 1995;269:G628 – G46. [22] Wank SA, Harkins R, Jensen RT, Shapira H, De Weerth A, Slattery, T. Purification, molecular cloning, and functional expression of the cholecystokinin receptor from rat pancreas. Proc Natl Acad Sci USA 1992a;89:3125–9. [23] Wank SA, Pisegna JR, De Weerth A. Brain and gastrointestinal cholecystokinin receptor family: Structure and functional expression. Proc Natl Acad Sci USA 1992b;89:8691–5.