Cholesterol-lowering effect of dietary Lupinus angustifolius proteins in adult rats through regulation of genes involved in cholesterol homeostasis

Food Chemistry 132 (2012) 1475–1479

Contents lists available at SciVerse ScienceDirect

Food Chemistry journal homepage: www.elsevier.com/locate/foodchem

Cholesterol-lowering effect of dietary Lupinus angustifolius proteins in adult rats through regulation of genes involved in cholesterol homeostasis Cinzia Parolini 1, Elena Rigamonti 1, Marta Marchesi, Marco Busnelli, Paola Cinquanta, Stefano Manzini, Cesare R. Sirtori, Giulia Chiesa ⇑ Department of Pharmacological Sciences, Università degli Studi di Milano, via Balzaretti 9, 20133 Milan, Italy

a r t i c l e

i n f o

Article history: Received 26 April 2011 Received in revised form 25 November 2011 Accepted 3 December 2011 Available online 11 December 2011 Keywords: Cholesterol L. angustifolius Lupin proteins Rats Hepatic gene expression

a b s t r a c t In the absence of a clear indication from previous studies, a rat study was designed to evaluate a possible hypolipidaemic effect of Lupinus angustifolius (blue lupin) proteins. Rats were fed for 28 days Nath’s hypercholesterolaemic diets containing 20% casein or blue lupin proteins. After 14 and 28 days of dietary treatment, blue-lupin-fed rats had markedly lower plasma total cholesterol levels than rats fed casein (53.0% and 55.3%, respectively, p < 0.0005). No significant differences were instead observed for triglyceride and HDL-cholesterol levels between the two groups. Lupin-protein-fed rats displayed higher hepatic mRNA levels of SREBP-2, a major transcriptional regulator of intracellular cholesterol levels, and CYP7A1, the rate-limiting enzyme in bile acid biosynthesis (p < 0.05). In conclusion, the present study demonstrates a marked cholesterol-lowering activity of proteins from L. angustifolius in rats. Moreover, blue lupin proteins appear to affect cellular lipid homeostasis by up-regulating SREBP-2 and CYP7A1 genes. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Interest in vegetable, particular leguminous, proteins has grown considerably in the past years. Lupin proteins provide a potentially important dietary protein source addressed to cardiovascular benefit, since the amino acid content of lupin seeds is very similar to that of the more extensively studied soy, with the advantage of a much lower concentration of isoflavones (Katagiri, Ibrahim, & Tahara, 2000). Four Mediterranean lupin species (Lupinus albus, Lupinus angustifolius, Lupinus luteus, and Lupinus mutabilis) are cultivated for nutrition and they are referred to as sweet lupin, since they all contain small amounts of toxic alkaloids vs. the bitter variety. Except for one study in rats fed low protein amounts of the legume (Bettzieche, Brandsch, Weisse et al., 2008), previous investigations have generally shown that protein extracts from L. albus seeds are able to reduce plasma total cholesterol (Marchesi et al., 2008; Sirtori et al., 2004) and triglyceride concentrations (Sirtori et al., 2004; Spielmann et al., 2007) in animal models. Moreover, it was also shown that a diet containing L. albus proteins reduces atherosclerosis progression in rabbits (Marchesi et al., 2008). A few studies have investigated the potential hypolipidaemic effect of blue lupin (L. angustifolius). In pigs fed a diet with whole ⇑ Corresponding author. Tel.: +39 02 50318328; fax: +39 02 50318284. 1

E-mail address: [email protected] (G. Chiesa). The authors equally contributed to this work.

0308-8146/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodchem.2011.12.004

blue lupin seeds, Martins et al. (2005) reported lower total and low-density lipoprotein (LDL)-cholesterol levels vs. pigs fed a casein-based diet, but no variations in plasma triglyceride levels. In a more recent study in growing rats, comparing diets containing 5% of isolated proteins from different cultivars of blue lupin, no effect on total cholesterol levels was reported and a significant reduction of triglyceridaemia could be observed only for the Vitabor cultivar (Bettzieche, Brandsch, Schmidt et al., 2008). Moreover, apoE-deficient mice fed 10% L. angustifolius proteins for 16 weeks displayed higher cholesterol and triglyceride levels vs. casein fed mice (Weisse, Brandsch, Hirche, Eder & Stangl, 2010). On the contrary, a study, performed under peculiar metabolic conditions, i.e. in lactating rats, indicated that a diet containing 20% L. angustifolius proteins markedly reduced both cholesterol and triglyceride levels (Bettzieche, Brandsch, Eder, & Stangl, 2009). Altogether, there is no clear indication of a beneficial effect of proteins from L. angustifolius in modifying plasma lipid levels. A rat study was therefore designed to evaluate a possible hypolipidaemic effect of blue lupin proteins, following an experimental protocol that previously highlighted hypocholesterolaemic/hypotriglyceridaemic effects of other legume proteins (Rigamonti et al., 2010; Sirtori et al., 2004; Spielmann et al., 2007). It was decided to feed adult male rats with high concentrations (20%) of proteins from L. angustifolius. The study demonstrated a strong hypocholesterolaemic effect of blue lupin proteins. Further, the influence of the dietary treatment on major genes involved in cholesterol metabolism was assessed.

1476

C. Parolini et al. / Food Chemistry 132 (2012) 1475–1479 Table 2 Amino acid concentration in diets.

2. Materials and methods 2.1. Lupin protein preparation Total protein isolate from the Boregine cultivar of L. angustifolius seeds was manufactured by the Fraunhofer-Gesellschaft, Fraunhofer Institute (IVV) (Freising, Germany), by an extraction/precipitation process followed by spray drying (D’Agostina et al., 2006). The protein percentage was 91.15 based on dry matter. 2.2. Animals and experimental diets Procedures involving animals and their care were conducted in accordance with institutional guidelines that are in compliance with national (D.L. No. 116, G.U. Suppl. 40, February 18, 1992, Circolare No. 8, G.U. luglio 1994) and international laws and policies (EEC Council Directive 86/609, OJL 358, 1, December 12, 1987; Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health – NIH Publication No. 85-23, revised 1996). The experiments were supervised by the Laboratory Animal Welfare Service at our Department. Thirty male Sprague–Dawley rats (Charles River Italia, Calco, Italy; body weight 200–225 g) were housed in a room with controlled lighting (12 h/day), constant temperature and relative humidity. During the first week, they were fed a commercial non-purified diet (Mucedola, Settimo Milanese, Italy) and then divided into two groups of 15 rats on the basis of body weight, so that the distribution between the groups was similar. The rats were then fed for 28 days ad libitum a cholesterol/cholic acid diet containing casein as protein source or an identical diet except for the protein content, which was comprised of the total protein isolate from blue lupin. The composition of the semi-synthetic diets is shown in Table 1 and the amino acid concentration of the two diets is reported in Table 2. During the feeding period, body weight and food intake were recorded. 2.3. Sample collection Fasting blood samples were collected into tubes containing 0.1% (w/v) EDTA before and after 14 and 28 days of dietary treatments. Plasma was separated by centrifugation at 8000 rpm for 10 min at 4 °C and stored at 20 °C for lipid analysis. At the end of the dietary treatments (28 days) rats were sacrificed and liver was excised and immediately snap-frozen in liquid nitrogen for subsequent RNA isolation and analysis. 2.4. Plasma/lipid analyses Total cholesterol, HDL-cholesterol, and triglyceride plasma concentrations were measured with standard enzymatic techniques, using a Roche Diagnostics Cobas autoanalyser. High-density

Table 1 Composition of experimental diets. Ingredients (%)

CASEIN

LUPIN

Casein Lupin protein isolate DL-methionine Hegsted mineral mix Coconut oil Sucrose Cholesterol Cholic acid Vitamins Cellulose

20  0.4 4 25 44.1 1 0.5 + 5

 20 0.4 4 25 44.1 1 0.5 + 5

a

Amino acid (g/kg diet)

CASEIN

LUPIN

Arginine Cystine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Serine Tyrosine Threonine Valine

6.98 0.62 3.22 5.18 11.4 17.6 14.28 5.6 + 4.0a 9.62 10.92 9.8 7.82 13.4

23.16 2.90 7.2 4.92 8.12 14.12 7.06 0.48 + 4.0a 7.4 9.12 5.88 5.34 6.16

Dietary supplementation.

lipoprotein (HDL)-cholesterol was measured after precipitation of apolipoprotein (apo)B-containing lipoproteins with polyethylene glycol (20%, weight/volume) in 0.2 M glycine (pH 10). This method has been extensively used for the measurement of HDL-cholesterol levels in mice (Chiesa et al., 1998; Parolini et al., 2003; Parolini et al., 2005; Schultz et al., 1992) and has been validated in our laboratory for HDL-cholesterol quantification in rats by comparison with results obtained by fast protein liquid chromatography separation of lipoprotein fractions (data not shown). 2.5. Real-time PCR analyses Total RNA was isolated from rat livers using the NucleoSpin RNA extraction kit (Macherey–Nagel, Düren, Germany) according to the manufacturer’s instructions. RNA concentration and purity were estimated from the optical density at 260 and 280 nm, respectively. Total RNA (1 lg) was reverse transcribed with random hexameric primers and MultiScribe reverse transcriptase (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions. cDNAs were quantified by real-time detection polymerase chain reaction (PCR) on an Applied Biosystems 7900 sequence detector using SYBRÒ Green I and specific primers, as indicated in Table 3. Real-time detection was performed in a volume of 25 lL containing 100 nmol/L of each primer and iTaq SYBR Green Supermix with ROX 2, as recommended by the manufacturer (Bio-Rad, Hercules, CA). Conditions were 95 °C for 10 min, followed by 40 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C. A final melting curve guaranteed the authenticity of the target product. The housekeeping gene cyclophilin was used for normalisation. The mRNA concentration of cyclophilin was not influenced by experimental conditions. 2.6. Statistical analysis Data are expressed as mean values and standard deviations. Group differences were tested for statistical significance by multivariate ANOVA (repeated measures), followed by the Tukey post hoc test; a value of p < 0.05 was considered as statistically significant. The statistical analysis was performed using the SYSTAT software (Version 12; Systat Software, Inc., Chicago, IL). 3. Results 3.1. Effect of a lupin protein isolate from L. angustifolius on plasma lipids The L. angustifolius protein isolate did not affect body weight of the rats on the high cholesterol regimen, when monitored during

1477

C. Parolini et al. / Food Chemistry 132 (2012) 1475–1479 Table 3 Sequences of the primers used for real-time PCR analysis. Gene

Forward primer (from 50 to 30 )

Reverse primer (from 50 to 30 )

ABCG5 Cyclophilin CYP7A1 HMG-CoA reductase LDL receptor SREBP-2

TGGACTGCATGACTGCAAAT AGCACTGGGGAGAAAGGATT CACCATTCCTGCAACCTTTT CCCAGCCTACAAACTGGAAA CAGCTCTGTGTGAACCTGGA AGACTTGGTCATGGGGACAG

GAACACCAACTCTCCGTAAG AGCCACTCAGTCTTGGCAGT GTACCGGCAGGTCATTCAGT CCATTGGCACCTGGTACTCT TTCTTCAGGTTCGGGATCAG GGGGAGACATCAGAAGGACA

ATP-binding cassette transporter (ABC)-G5; CYP7A1, cholesterol 7a-hydroxylase; HMG-CoA, hydroxymethyl-glutaryl-CoA; SREBP, sterol regulatory element-binding protein.

Total Cholesterol (mg/dL)

A 400 300

200

#

4. Discussion The present study attempted to elucidate whether a diet containing an isolate from L. angustifolius as protein source could significantly affect plasma lipid levels in adult rats on a high cholesterol/high fat diet. Although rats, when fed a chow diet, are characterised by a lipoprotein profile quite different from that of humans (low circulating LDL concentration and very high HDL plasma levels), when fed a high-fat, high-cholesterol diet, they respond with a strong elevation of VLDL-LDL cholesterol-carrying particles; therefore they have been widely used to study the

*

100

B 100

LUPIN 0 days 14 days 28 days

75

50

25

3.2. Dietary effects on liver mRNA concentrations of genes involved in cholesterol metabolism

CASEIN

C

100

Triglycerides (mg/dL)

In order to examine possible mechanisms for the lupin proteinmediated alterations of cholesterolaemia, liver mRNA concentrations of genes involved in cholesterol homeostasis and bile acid synthesis were measured by real-time PCR. Rats fed lupin proteins had higher liver mRNA concentration of sterol regulatory elementbinding protein-2 (SREBP-2) vs. rats fed casein (Fig. 2, p < 0.05). Relative mRNA levels of hydroxymethyl-glutaryl-CoA (HMG-CoA) reductase and LDL receptor did not appear to be influenced by the dietary treatment (Fig. 2). No differences were also noted between the two groups in liver mRNA levels of ATP-binding cassette transporter-G5 (ABCG5) (Fig. 2). Lupin fed rats had instead significantly higher mRNA levels of cholesterol 7a-hydroxylase (CYP7A1) vs. rats fed casein (p < 0.05, Fig. 2).

0 days 14 days 28 days

CASEIN

HDL-cholesterol (mg/dL)

the 28 days of dietary treatment. Growth changes between the two groups did not differ (mean weights at the end of treatment were 365 ± 25.4 g for casein and 359 ± 48.1 g for lupin-fed rats, p > 0.05), thus suggesting that, in this animal model, the lupin protein isolate appears to have satisfactory nutritional qualities. Plasma lipids were evaluated before (0 days), at 14 days and at 28 days (end) of the experimental diet. As expected, the caseincontaining Nath’s diet determined dramatic changes of the lipid profile, with a massive increase of total cholesterol, a reduction of HDL-cholesterol levels and a moderate rise of triglycerides, already observed after 14 days of treatment (Fig. 1). The presence in the Nath’s diet of the protein isolate from L. angustifolius in place of casein treatment caused only a moderate increase of total cholesterol levels, so that the cholesterolaemia measured in lupin fed rats at both 14 and 28 days of treatment was significantly lower compared to that measured in casein fed animals (53.0% and 55.3%, respectively, p < 0.0005) (Fig. 1). No significant differences were noted for HDL-cholesterol and triglycerides between the two groups (Fig. 1). As a consequence of the different impact of the two diets on cholesterolaemia, plasma levels of VLDL-LDL cholesterol in lupin fed rats were dramatically lower than those in casein fed animals, at both 14 (60.1%) and 28 (61.2%) days of treatment (p < 0.0005).

75

LUPIN 0 days 14 days 28 days

50

25

CASEIN

LUPIN

Fig. 1. Plasma lipid levels evaluated in rats before (0 days), at 14 and 28 days of Nath’s hypercholesterolaemic diet containing casein (CASEIN) or L. angustifolius (LUPIN) isolate as protein source. Each bar represents mean values ± SD (n = 15). # p < 0.0005 vs. CASEIN at 14 days of dietary treatment; ⁄p < 0.0005 vs. CASEIN at 28 days of dietary treatment.

hypolipidaemic effect of dietary interventions (Dabai et al., 1996; Wang McIntosh, 1996). In this report, the L. angustifolius protein based diet displayed marked hypocholesterolaemic properties vs. the casein diet, whereas no significant differences were observed for triglyceride levels. The lack of hypotriglyceridaemic effect was unexpected, since a diet containing proteins from L. albus, given at the same dose to

1478

C. Parolini et al. / Food Chemistry 132 (2012) 1475–1479

Relative mRNA concentration

4.0 CASEIN LUPIN

*

3.0

2.0

*

1.0

SREBP-2

HMG-CoA reductase

LDL Receptor

ABCG5

CYP7A1

Fig. 2. Relative mRNA concentrations of SREBP-2, HMG-CoA reductase, LDL receptor, ABCG5 and CYP7A1 in the liver of male rats fed diets containing casein (CASEIN) or lupin protein (LUPIN) for 28 days. Values were normalised to reference gene cyclophilin and are expressed relative to the levels in casein-fed animals set as 1. Each bar represents mean values ± SD (n = 15). Statistically significant differences between dietary treatments are indicated (LUPIN vs. CASEIN: ⁄p < 0.05).

growing rats, was associated with triglyceride levels about 75% lower compared with casein-fed animals (Spielmann et al., 2007). Moreover, in a very recent study (Brandsch, Kappis, Weisse, Stangl, 2010), a plasma triglyceride reduction was also shown in adult rats fed a high fat diet containing L. angustifolius proteins. A possible reason for this discrepancy may reside in the different composition of the hyperlipidic diets used in the studies. The diet used in the present study contains sucrose as the only carbohydrate source. It is well known that diets rich in sucrose raise plasma triglycerides, compared with diets containing starch or glucose as carbohydrate source (Bird Williams, 1982; Kazumi et al., 1989). The triglyceride increase determined by the carbohydrate content may therefore mask a possible hypolipidaemic effect of a dietary treatment. Apparently, this is not the case for the present study, where the triglyceride increase by the Nath’s diet vs. baseline was very modest and not significant in either group (35.4 ± 5.78 mg/dL at baseline vs. 48.0 ± 5.74 mg/dL at 28 days in the casein group; 32.8 ± 7.04 mg/dL at baseline vs. 43.0 ± 11.9 mg/dL at 28 days in the lupin group). It should be noted that in a previous investigation by our research group, using the same dietary approach, proteins from L. albus caused a significant reduction of plasma triglyceride levels. Thus, it cannot be excluded that the lack of hypotriglyceridaemic effect observed in the present study may reflect a different biological activity between L. albus and L. angustifolius. Such a difference should not be surprising, since different cultivars within the same lupin variety appear to exert a different effect on plasma lipids (Bettzieche, Brandsch, Schmidt et al., 2008). The results of our study strongly support a beneficial effect of L. angustifolius proteins on plasma cholesterol levels. Previous studies have indicated that the amino acid composition of dietary proteins may influence plasma lipid levels. Particularly, a low methionine content has been implicated in the hypolipidaemic properties of vegetable proteins (Carroll Kurowska, 1995). Lupin proteins have a lower methionine concentration compared with casein and, since the two diets were equally supplemented for methionine (4 g/kg diet), the two dietary treatments were not balanced for the methionine content (9.60 g/kg in the casein diet vs. 4.48 g/kg in the lupin protein diet, see Table 2). This difference, however, should not have a major impact on plasma lipid levels, as indicated in a recent study (Hirche, Schroder, Knoth, Stangl, Eder, 2006), where it was demonstrated that above a concentration of 3.5 g/kg diet, the methionine concentration does not influence plasma cholesterol levels. By comparing the lipid profile of the casein and the lupin

fed groups, both during and at the end of the dietary treatments, it clearly appears that blue lupin proteins display a hypocholesterolaemic effect through a strong reduction of VLDL-LDL cholesterol. A hypocholesterolaemic effect, particularly a reduction of LDL-cholesterol levels has been demonstrated for many legume seeds (Dabai et al., 1996; Kingman et al., 1993; Wang and McIntosh, 1996) and it appears to reside, mostly, in their protein component. A common mechanism for this effect appears to be an increase of the LDL receptor activity, as previously shown for soy (Lovati et al., 1996), L. albus (Sirtori et al., 2004) and, more recently, for pea proteins (Rigamonti et al., 2010). Although these results have all been obtained in rats, whose LDL metabolism is quite different from that of humans, an activation of LDL receptor has been demonstrated also in clinical studies, at least for soy (Baum et al., 1998; Lovati et al., 1987). An activation of the LDL receptor by L. angustifolius had been previously suggested for whole seeds (Martins et al., 2005). In more recent studies with purified proteins, both at low and high doses (Bettzieche, Brandsch, Schmidt et al., 2008; Bettzieche et al., 2009; Brandsch et al., 2010), blue lupin proteins did not increase mRNA levels of LDL-receptor or the transcription factor SREBP-2, a major activator of the LDL-receptor gene (Horton, Goldstein, Brown, 2002). In the present study, a significant increase of LDL-receptor expression was not observed, but a significant mRNA rise of SREBP-2 was found. Activation of SREBP2 leads to an increased expression of the LDL receptor, which in turns increases serum cholesterol clearance and therefore lowers circulating cholesterol levels. SREBP-2 activation, therefore, indirectly suggests that L. angustifolius proteins may also exert their hypocholesterolaemic effect, at least in part, by the same mechanism of action as most legume proteins. In the present study, no effect on HDL-cholesterol levels by blue lupin proteins was observed. It cannot be excluded that this dietary component could affect HDL levels in humans, since HDL metabolism between rats and humans is quite different. However, no effect of a blue lupin containing diet was also observed in other animal models (Martins et al., 2005). Finally, the expression of genes involved in bile acid synthesis and cholesterol transfer to bile gave clear evidence that CYP7A1 was significantly raised by the experimental diet. The mRNA rise of this rate-limiting enzyme converting cholesterol to 7a-hydroxy bile acids contrasts with previous results (Bettzieche, Brandsch, Schmidt et al., 2008) obtained in a comparative study, where different lupin protein cultivars were given at low doses (5% in diet). In that study, the most active cultivar Vitabor significant lowered the CYP7A1 mRNA expression, whereas blue lupin proteins from other cultivars, including Boregine (i.e. the cultivar used in our study), showed essentially no activity. The follow up study by these same authors on a higher concentration of lupin proteins in lactating rats showed instead a similar finding to the present report (Bettzieche et al., 2009), i.e. a significant rise of CYP7A1 mRNA levels. Based on our results, it appears that an increased transcriptional regulation of CYP7A1 may play a crucial role in the cholesterol lowering activity of blue lupin protein. Possible differences in the faecal sterol content between the two groups would have supported the observation of an increased CYP7A1 expression. Unfortunately, the faecal sterol content was not evaluated in the present investigation and this represents a limitation of the study. In conclusion, whereas a low intake of L. angustifolius proteins does not affect cholesterolaemia in rats (Bettzieche, Brandsch, Schmidt et al., 2008), high dietary concentrations of blue lupin proteins are effective in reducing plasma cholesterol levels. Dietary intake of vegetable proteins appears thus to be associated with cholesterol reduction in a dose-related fashion. In a recent clinical study (Weisse, Brandsch, Zernsdorf et al., 2010), a daily intake of 35 g of blue lupin proteins did not show any advantage over casein intake, since the two dietary treatments significantly reduced

C. Parolini et al. / Food Chemistry 132 (2012) 1475–1479

cholesterolaemia to the same extent. Interestingly, a recent overview on the clinical activity of soy proteins showed that, moving from 13 to 58 g/day of soy proteins, the LDL-cholesterol reduction almost doubled (Jenkins et al., 2010). Based on these results, it cannot be excluded that a higher daily intake of lupin proteins may also lead to a significant hypocholesterolaemic effect in patients. Finally, another important factor that may have affected the results of the clinical study by Weisse, Brandsch, Zernsdorf et al. (2010) is that the subjects were only slightly hypercholesterolaemic (about 220 mg/dL). It has been clearly shown in a meta-analysis by Anderson, Johnstone, and Cook-Newell (1995) that the LDL-cholesterol decrease caused by soy ingestion was determined by the degree of hypercholesterolaemia, with non-significant reductions in subjects with normal baseline cholesterol levels. Acknowledgements This investigation was supported by a grant of the European Commission, CRAFT Project Bioprofibre (COOP-CT-2006-032075). We are indebted to the Fraunhofer Gesellschaft, FraunhoferInstitute (IVV) (Freising, Germany) which provided the protein isolate from L. angustifolius and its aminoacid composition. References Anderson, J. W., Johnstone, B. M., & Cook-Newell, M. E. (1995). Meta-analysis of the effects of soy protein intake on serum lipids. New England Journal of Medicine, 333, 276–282. Baum, J. A., Teng, H., Erdman, J. W., Jr., Weigel, R. M., Klein, B. P., Persky, V. W., Freels, S., Surya, P., Bakhit, R. M., Ramos, E., Shay, N. F., & Potter, S. M. (1998). Long-term intake of soy protein improves blood lipid profiles and increases mononuclear cell low-density-lipoprotein receptor messenger RNA in hypercholesterolaemic, postmenopausal women. American Journal of Clinical Nutrition, 68, 545–551. Bettzieche, A., Brandsch, C., Eder, K., & Stangl, G. I. (2009). Lupin protein acts hypocholesterolaemic and increases milk fat content in lactating rats by influencing the expression of genes involved in cholesterol homeostasis and triglyceride synthesis. Molecular Nutrition Food Research, 53, 1134–1142. Bettzieche, A., Brandsch, C., Schmidt, M., Weisse, K., Eder, K., & Stangl, G. I. (2008). Differing effect of protein isolates from different cultivars of blue lupin on plasma lipoproteins of hypercholesterolaemic rats. Bioscience, Biotechnology, and Biochemistry, 72, 3114–3121. Bettzieche, A., Brandsch, C., Weisse, K., Hirche, F., Eder, K., & Stangl, G. I. (2008). Lupin protein influences the expression of hepatic genes involved in fatty acid synthesis and triacylglycerol hydrolysis of adult rats. British Journal of Nutrition, 99, 952–962. Bird, M. I., & Williams, M. A. (1982). Triacylglycerol secretion in rats: effects of essential fatty acids and influence of dietary sucrose, glucose or fructose. Journal of Nutrition, 112, 2267–2278. Brandsch, C., Kappis, D., Weisse, K., & Stangl, G. I. (2010). Effects of untreated and thermally treated lupin protein on plasma and liver lipids of rats fed a hypercholesterolaemic high fat or high carbohydrate diet. Plant Foods for Human Nutrition, 65, 410–416. Carroll, K. K., & Kurowska, E. M. (1995). Soy consumption and cholesterol reduction: review of animal and human studies. Journal of Nutrition, 125, 594S–597S. Chiesa, G., Parolini, C., Canavesi, M., Colombo, N., Sirtori, C. R., Fumagalli, R., Franceschini, G., & Bernini, F. (1998). Human apolipoproteins A-I and A-II in cell cholesterol efflux: studies with transgenic mice. Arteriosclerosis, Thrombosis, and Vascular Biology, 18, 1417–1423. D’Agostina, A., Antonioni, C., Resta, D., Arnoldi, A., Bez, J., Knauf, U., & Wasche, A. (2006). Optimization of a pilot-scale process for producing lupin protein isolates with valuable technological properties and minimum thermal damage. Journal of Agricultural and Food Chemistry, 54, 92–98. Dabai, F. D., Walker, A. F., Sambrook, I. E., Welch, V. A., Owen, R. W., & Abeyasekera, S. (1996). Comparative effects on blood lipids and faecal steroids of five legume

1479

species incorporated into a semi-purified, hypercholesterolaemic rat diet. British Journal of Nutrition, 75, 557–571. Hirche, F., Schroder, A., Knoth, B., Stangl, G. I., & Eder, K. (2006). Effect of dietary methionine on plasma and liver cholesterol concentrations in rats and expression of hepatic genes involved in cholesterol metabolism. British Journal of Nutrition, 95, 879–888. Horton, J. D., Goldstein, J. L., & Brown, M. S. (2002). SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. Journal of Clinical Investigation, 109, 1125–1131. Jenkins, D. J., Mirrahimi, A., Srichaikul, K., Berryman, C. E., Wang, L., Carleton, A., Abdulnour, S., Sievenpiper, J. L., Kendall, C. W., & Kris-Etherton, P. M. (2010). Soy protein reduces serum cholesterol by both intrinsic and food displacement mechanisms. Journal of Nutrition, 140, 2302S–2311S. Katagiri, Y., Ibrahim, R. K., & Tahara, S. (2000). HPLC analysis of white lupin isoflavonoids. Bioscience, Biotechnology, and Biochemistry, 64, 1118–1125. Kazumi, T., Yoshino, G., Kasama, T., Iwatani, I., Iwai, M., & Baba, S. (1989). Effects of dietary sucrose on age-related changes in VLDL-triglyceride kinetics in the rat. Diabetes Research and Clinical Practice, 6, 185–190. Kingman, S. M., Walker, A. F., Low, A. G., Sambrook, I. E., Owen, R. W., & Cole, T. J. (1993). Comparative effects of four legume species on plasma lipids and faecal steroid excretion in hypercholesterolaemic pigs. British Journal of Nutrition, 69, 409–421. Lovati, M. R., Manzoni, C., Canavesi, A., Sirtori, M., Vaccarino, V., Marchi, M., Gaddi, G., & Sirtori, C. R. (1987). Soybean protein diet increases low density lipoprotein receptor activity in mononuclear cells from hypercholesterolaemic patients. Journal of Clinical Investigation, 80(5), 1498–1502. Lovati, M. R., Manzoni, C., Corsini, A., Granata, A., Fumagalli, R., & Sirtori, C. R. (1996). 7S globulin from soybean is metabolized in human cell cultures by a specific uptake and degradation system. Journal of Nutrition, 126, 2831–2842. Marchesi, M., Parolini, C., Diani, E., Rigamonti, E., Cornelli, L., Arnoldi, A., Sirtori, C. R., & Chiesa, G. (2008). Hypolipidaemic and anti-atherosclerotic effects of lupin proteins in a rabbit model. British Journal of Nutrition, 100, 707–710. Martins, J. M., Riottot, M., de Abreu, M. C., Viegas-Crespo, A. M., Lanca, M. J., Almeida, J. A., Freire, J. B., & Bento, O. P. (2005). Cholesterol-lowering effects of dietary blue lupin (Lupinus angustifolius L.) in intact and ileorectal anastomosed pigs. Journal of Lipid Research, 46, 1539–1547. Parolini, C., Chiesa, G., Gong, E., Caligari, S., Cortese, M. M., Koga, T., Forte, T. M., & Rubin, E. M. (2005). Apolipoprotein A-I and the molecular variant apoAI(Milano): evaluation of the antiatherogenic effects in knock-in mouse model. Atherosclerosis, 183, 222–229. Parolini, C., Chiesa, G., Zhu, Y., Forte, T., Caligari, S., Gianazza, E., Sacco, M. G., Sirtori, C. R., & Rubin, E. M. (2003). Targeted replacement of mouse apolipoprotein A-I with human ApoA-I or the mutant ApoA-IMilano. Evidence of APOA-IM impaired hepatic secretion. J Biol Chem, 278, 4740–4746. Rigamonti, E., Parolini, C., Marchesi, M., Diani, E., Brambilla, S., Sirtori, C. R., & Chiesa, G. (2010). Hypolipidaemic effect of dietary pea proteins: Impact on genes regulating hepatic lipid metabolism. Molecular Nutrition Food Research, 54, S24–30. Schultz, J. R., Gong, E. L., McCall, M. R., Nichols, A. V., Clift, S. M., & Rubin, E. M. (1992). Expression of human apolipoprotein A-II and its effect on high density lipoproteins in transgenic mice. Journal of Biological Chemistry, 267, 21630–21636. Sirtori, C. R., Lovati, M. R., Manzoni, C., Castiglioni, S., Duranti, M., Magni, C., Morandi, S., D’Agostina, A., & Arnoldi, A. (2004). Proteins of white lupin seed, a naturally isoflavone-poor legume, reduce cholesterolaemia in rats and increase LDL receptor activity in HepG2 cells. Journal of Nutrition, 134, 18–23. Spielmann, J., Shukla, A., Brandsch, C., Hirche, F., Stangl, G. I., & Eder, K. (2007). Dietary lupin protein lowers triglyceride concentrations in liver and plasma in rats by reducing hepatic gene expression of sterol regulatory element-binding protein-1c. Annals of Nutrition and Metabolism, 51, 387–392. Wang, Y. H., & McIntosh, G. H. (1996). Extrusion and boiling improve rat body weight gain and plasma cholesterol lowering ability of peas and chickpeas. Journal of Nutrition, 126, 3054–3062. Weisse, K., Brandsch, C., Hirche, F., Eder, K., & Stangl, G. I. (2010). Lupin protein isolate and cysteine-supplemented casein reduce calcification of atherosclerotic lesions in apoE-deficient mice. British Journal of Nutrition, 103, 180–188. Weisse, K., Brandsch, C., Zernsdorf, B., Nkengfack Nembongwe, G. S., Hofmann, K., Eder, K., & Stangl, G. I. (2010). Lupin protein compared to casein lowers the LDL cholesterol:HDL cholesterol-ratio of hypercholesterolaemic adults. European Journal of Nutrition, 49, 65–71.