Cholesteryl ester hydroperoxides increase macrophage CD36 gene expression via PPARα

BBRC Biochemical and Biophysical Research Communications 351 (2006) 733–738 www.elsevier.com/locate/ybbrc

Cholesteryl ester hydroperoxides increase macrophage CD36 gene expression via PPARa q Iness Jedidi a,b, Martine Couturier c,d, Patrice The´rond e, Monique Garde`s-Albert Alain Legrand e, Robert Barouki f,b, Dominique Bonnefont-Rousselot e, Martine Aggerbeck f,b,*

a,b

,

a

e

CNRS, UMR 8601, Laboratoire de Chimie-Physique, Paris F-75006, France b Universite´ Paris Descartes, Paris F-75006, France c INSERM, U551, Paris F-75013, France d AP-HP, Groupe Hospitalier Pitie´-Salpe´trie`re, Paris F-75013, France Universite´ Paris Descartes, Faculte´ de Pharmacie, Laboratoire de Biochimie Me´tabolique et Clinique (EA 3617), Paris F-75006, France f INSERM, U747, Laboratoire de Pharmacologie, Toxicologie et Signalisation Mole´culaire, Paris F-75006, France Received 6 October 2006 Available online 3 November 2006

Abstract The uptake of oxidized LDL by macrophages is a key event in the development of atherosclerosis. The scavenger receptor CD36 is one major receptor that internalizes oxidized LDL. In differentiated human macrophages, we compared the regulation of CD36 expression by copper-oxidized LDL or their products. Only oxidized derivatives of cholesteryl ester (CEOOH) increased the amount of CD36 mRNA (2.5-fold). Both oxidized LDL and CEOOH treatment increased two to fourfold the transcription of promoters containing peroxisome-proliferator-activated-receptor responsive elements (PPRE) in the presence of PPARa or c. Electrophoretic-mobility-shift-assays with nuclear extracts prepared from macrophages treated by either oxidized LDL or CEOOH showed increased binding of PPARa to the CD36 gene promoter PPRE. In conclusion, CEOOH present in oxidized LDL increase CD36 gene expression in a pathway involving PPARa.  2006 Elsevier Inc. All rights reserved. Keywords: Scavenger receptor; Atherosclerosis; Oxidized LDL; Linoleate cholesteryl ester hydroperoxides; PPARa

Oxidized low density lipoproteins (oxidized LDL) are involved in the early development of atherosclerotic lesions through the formation of macrophage-derived foam cells [1]. CD36 has been identified as the major q

Abbreviations: CEOOH, linoleate hydroperoxide from cholesteryl ester; DW-CD36, downstream promoter of the CD36 gene; HPRT, hypoxanthine guanine phosphoribosyltransferase; 7-KC, 7-ketocholesterol; LDL, low density lipoprotein; oxLDL, highly oxidized LDL; modLDL, moderately oxidized LDL; PCOOH, linoleate hydroperoxide from phosphatidylcholine; PPAR, peroxisome proliferator-activated receptor; PPRE, PPAR responsive element; qRT-PCR, quantitative reverse transcriptase PCR; RPL13A, ribosomal protein L13A; RXRa, retinoid X receptor a; UP-CD36, upstream promoter of the CD36 gene. * Corresponding author. Fax: +33 1 42 86 38 68. E-mail address: [email protected] (M. Aggerbeck). 0006-291X/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.10.122

scavenger receptor for the uptake of oxidized LDL into macrophages [2,3] and the lipid moiety of oxidized LDL appears to be the best candidate for binding to CD36 [4–6]. However, no study to date has demonstrated that these oxidized lipid products participate directly in the signaling pathway for the regulation of CD36 expression. The human gene encoding CD36 is regulated by two independent promoters: the proximal promoter, which contains a responsive element for nuclear peroxisome proliferator-activated receptors (PPAR), and the distal promoter, which is under the control of PPAR despite the absence of a PPAR responsive element (PPRE) [7,8]. Monocytes treated with synthetic ligands of PPARc

734

I. Jedidi et al. / Biochemical and Biophysical Research Communications 351 (2006) 733–738

undergo changes in surface marker expression characteristic of monocytic differentiation into macrophages with an increased capacity to internalize oxidized LDL [8–10]. However, contrary to PPARc, the role of PPARa in lipid accumulation still remains unclear. Furthermore, recent studies have questioned the role of PPARc in the regulation of genes involved in the atherogenesis mechanism and consequently its role in lipid accumulation [11–15]. Indeed, there is no direct evidence to date that CD36 mRNA expression is increased through the PPRE present in the gene promoter [8] and PPARc may be required exclusively in lipid clearance [16]. These apparently contradictory results might be due in part to the use of various PPARc synthetic ligands and to the different cellular models and their degree of differentiation. Moreover, it is important to note that most of the studies did not distinguish the monocytic differentiation into quiescent macrophages and the activation of macrophages. Therefore, the exact role of PPAR in the mechanism of CD36 gene regulation by oxidized LDL and its oxidized derivatives in differentiated macrophages remains unclear. To provide additional insight into the mechanism of CD36 gene regulation, we attempted to identify the oxidized lipids present in oxidized LDL involved in the induction of the CD36 gene, and to clarify the role of PPAR. For this purpose we used fully differentiated human primary monocyte-derived macrophages treated with either oxidized LDL or oxidized derivatives purified from these LDL. We have identified oxidized derivatives of cholesteryl esters as the main product responsible for increased CD36 expression in differentiated human macrophages and we have shown that this regulation involves PPARa. Materials and methods Isolation and oxidation of LDL by copper. LDL were isolated from normolipidemic human plasma as described previously [17]. LDL (3 g/L), expressed as total LDL concentration, were oxidized by 5 lM CuSO4 for 6 h (moderate oxidation) or 24 h (high oxidation) at 37 C [18] and dialyzed against 10 lM sodium phosphate buffer (pH 7). Isolation of oxidized derivatives of cholesteryl esters and phosphatidylcholine hydroperoxides and oxysterols. Total lipids and purified linoleate hydroperoxides from phosphatidylcholine (PCOOH) or cholesteryl ester (CEOOH) were isolated from moderately oxidized LDL by high performance liquid chromatography (HPLC) and quantified as previously described [17]. Oxysterols were detected by gas chromatography as described by Zarev et al. [18]. Isolation of human monocyte-derived macrophages. Mononuclear cells were isolated from buffy coats of healthy normolipidemic donors as described [19]. After 10 days, monocyte-derived macrophages (denoted as macrophages) were washed three times with PBS and incubated for 16 h in the X-Vivo10 medium (Cambrex) containing the lipids tested. Cell viability was assessed by Trypan blue exclusion. Cos7 cell culture. Cos7 cells were cultured as previously described [20]. For transfection experiments, cells were incubated in the serum-free medium for 24 h with modLDL. RNA preparation and quantitative reverse transcriptase PCR. Total RNA was isolated as described [21] and purified using the DNase-I digestion Kit (Qiagen). cDNA was prepared from 5 lg RNA using the High Capacity cDNA Archive kit (Applied Biosystems). mRNA amounts of CD36 and of reference genes (RPL13A, HPRT, and ubiquitin) were

measured by qRT-PCR (ABI Prism 7900 HT, Applied Biosystems), using the SYBR Green PCR Master Mix (Applied Biosystems). The primers are: CD36 (GAGAACTGTTATGGGGCTAT/TTCAACTAACTGGAGAG GCAAAGG), RPL13A (CCTGGAGGAGAAGAGGAAAGAGA/TTG AGGACCTCTGTGTATTTGTCAA), HPRT (TGACACTGGCAAAA CAATGCA/GGTCCTTTTCACCAGCAAGCT), and ubiquitin (CACT TGGTCCTGCGCTTGA/TTTTTTGGGAATGCAACAACTTT). Western blots. Macrophages were washed and scraped on ice in PBS and lysed in 10 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100 in the presence of a protease inhibitor cocktail (Roche). Supernatants were prepared by centrifugation at 100,000g for 30 min at 4 C. Proteins (100 lg) were reduced with 2-mercaptoethanol and separated on a 10% SDS–polyacrylamide gel and transferred to a nitrocellulose membrane. A monoclonal antibody against the CD36 receptor (036SC-7309, Santa Cruz, CA, USA) (1:200) was visualized with horseradish peroxidase-conjugated secondary antibody (1:2000) using ECL Western blotting detection (Amersham Biosciences). The relative intensities of the bands were determined by the Quantity One software from Bio-Rad. Plasmids and transient transfections. Plasmids pSG5-mCD36, pSG5hPPARa, and pSG5-hPPARc were generous gifts from Dr. Staels (INSERM U325). pSG5-RXRa was a gift of Mrs. Diry (INSERM 775). Reporter plasmids with the firefly luciferase gene under the control of either the upstream (UP) or the downstream (DW) promoter of the CD36 gene were kind gifts from Dr. Motojima (Department of Biochemistry, Tokyo University, Japan) and the pGL3 (PPRE)3-TK-Luciferase reporter gene was a kind gift from Dr. Grimaldi (INSERM U470). Transient transfections were performed in Cos7 cells [20], except that the glycerol shock was omitted. After 48 h, modLDL were added to the serum-free culture medium and the cells were incubated for an additional 24 h. The cells were washed with PBS and homogenized in 200 lL of 1· RLB buffer (Promega). Firefly luciferase was assayed with a Promega kit. Nuclear extract preparation and electrophoretic mobility shift assay. Nuclear extracts were prepared from 10 day-differentiated human macrophages treated with modLDL, CEOOH, 7-KC or vehicle for 16 h [21]. The protein concentration of the extracts was measured with the BCA kit (Pierce) using bovine serum albumin as a standard. The top strand oligonucleotides used in this study were: CD36/PPRE 5 0 -GGGTTCTGGCCTCTGACTT-3 0 , consensus PPRE 5 0 -AGCTG GACCAGGACAAAGGTCACGTT-3 0 . The probe labeling and the electrophoretic mobility shift assays were performed as described except that the nuclear extract was 10 lg protein/assay [21]. The antisera (PPARa, SC1985X and PPARc, SC-1984X) were from Santa Cruz (CA, USA). Statistical analysis. The significance of the differences between the mean values of the various parameters was analyzed by Student’s t test. A value of P < 0.05 was accepted as statistically significant.

Results Linoleate cholesteryl ester hydroperoxides from modLDL increase CD36 expression in human macrophages The experiments were performed on human primary monocyte-derived macrophages that were fully differentiated in culture for 10 days. The differentiated cells were activated by treatment for 16 h with either native LDL or moderately (modLDL) or highly (oxLDL) copper-oxidized LDL. No changes in cell morphology and viability were observed during the treatments. As shown in Fig. 1 (left) and the supplementary Fig. 1, a twofold increase of the amount of CD36 (mRNA and protein) was observed after treatment with modLDL. In contrast, the amount of CD36 mRNA was modified neither by a treatment with

I. Jedidi et al. / Biochemical and Biophysical Research Communications 351 (2006) 733–738

CD36 mRNA (Fold over basal level)

3 modLDL (μg/mL) CEOOH (nmol/mL) 2.5

*

* *

2

*

1.5 1 0.5 0 0 100 200

0 0.5 1 1.5

Fig. 1. Effect of modLDL and CEOOH on CD36 mRNA content in human macrophages. Differentiated macrophages were treated for 16 h with either modLDL (in lg apoB/mL) on the left or CEOOH (nmol/mL) on the right. CD36 mRNA content was quantified by qRT-PCR. Results (expressed as the fold induction over basal level) are means ± SEM of three to six experiments performed in duplicate. *P < 0.05.

native LDL nor by a treatment by highly oxLDL (data not shown). To further define the oxidized molecular species from modLDL implicated in the increase of CD36, we then measured the amount of the three major lipid derivatives found in modLDL and oxLDL. The formulas and concentrations of linoleate phosphatidylcholine hydroperoxides (PCOOH), linoleate cholesteryl ester hydroperoxides (CEOOH), and 7-ketocholesterol (7-KC) after oxidation of LDL (100 lg apoB/mL) are presented in Fig. 2. The concentration of the oxidized products differs markedly in modLDL and oxLDL. Indeed, the oxLDL contains essentially the final products of the oxidation of PCOOH and CEOOH such as hydroxynon-2-enal (HNE), malondialdehyde (MDA) [22,23], and oxidized products from the

735

cholesterol core of the LDL, such as 7-KC which is the most abundant oxysterol found in oxLDL [24]. Because we found CD36 gene regulation only with modLDL, the differentiated macrophages were thus treated for 16 h with various amounts of PCOOH and CEOOH and 7-KC as a control for oxLDL. The effect of these compounds on the amount of CD36 mRNA level was determined. Treatment of macrophages with CEOOH (Fig. 1, right) increased the amount of CD36 mRNA, similarly to modLDL (up to 2.5-fold). In contrast, PCOOH and 7-KC increased only weakly the amount of CD36 mRNA (1.5-fold increase, supplementary Fig. 1). Since CEOOH were the most active oxidized derivatives, their effect was further confirmed by Western blot analysis (supplementary Fig. 1). ModLDL increase the transcription of PPRE-containing genes Since several studies [9,16] have shown that synthetic PPAR ligands may promote lipid accumulation or clearance in macrophages, we studied the effect of modLDL on the transcription of PPRE-responsive plasmids. The effect was tested in Cos7 cells transfected with a pGL3 (PPRE)3-TK-Luciferase plasmid and various combinations of expression plasmids. The cells were treated for 24 h with native LDL, modLDL or the vehicle (PBS). Native LDL did not modify the reporter gene activity (data not shown). Co-transfection of either PPARa or PPARc led to a three to fourfold increase of the reporter gene activity whereas only a 1.5-fold increase was obtained with the empty vector pSG5 (Fig. 3, left). The reporter plasmid containing only the TK promoter was not responsive to modLDL (data not shown). We next determined whether modLDL could

Fig. 2. Chemical formulas and concentration of lipid derivatives found in modLDL and oxLDL. The formulas and concentrations after oxidation for either 6 h (modLDL) or 24 h (oxLDL) of a LDL solution (100 lg apoB/mL) of the major oxidized lipids are indicated (means ± SEM of three independent experiments).

736

I. Jedidi et al. / Biochemical and Biophysical Research Communications 351 (2006) 733–738

Luciferase activity (Fold over basal activity)

5

PPRE3-TK-Luc

4

**

DW-CD36-Luc

A Comp PPRE Comp CD36

+

Treatment

*

-

-

-

+

+ -

Antibody IgG PPARγ PPARα

+

+

*

3

modLDL

** **

2 1 0

CD36

pSG5 PPARα PPARγ

- +

- +

- +

pSG5 PPARα PPARγ

- +

- +

- +

Intensity 0.5

Fig. 3. Effect of modLDL on the transcription of PPRE-containing reporter plasmids in Cos 7 cells. The cells were transfected with either the pGL3 (PPRE)3-TK-Luc (left) or the DW-CD36-Luc (right) reporter plasmid, the RXRa expression plasmid, and the expression plasmids described in the figure, and treated with 100 lg apoB/mL modLDL for 24 h. The relative luciferase activities over basal level are means ± SEM of three independent experiments in triplicate. *P < 0.05.

CEOOH increase binding of PPARa to the CD36/PPRE A PPRE sequence (273/260 in the proximal promoter of the human CD36 gene) can bind the PPARc/RXRa complex [9]. We studied the binding of nuclear extracts prepared from macrophages treated or not with modLDL to the PPRE located in the proximal CD36 gene promoter. As shown in Fig. 4A, a specific complex was found with control nuclear extracts. This complex was increased when the extracts were prepared from macrophages treated for 16 h with modLDL and was competed for by the cold probe or a consensus PPRE oligonucleotide. The retarded band completely disappeared when an anti-PPARa antibody was added to the reaction, whereas an anti-PPARc antibody or a control IgG had no effect. To further investigate the component(s) in moderately oxidized LDL responsible for the increased binding of the nuclear extracts to the PPRE, we also prepared nuclear extracts from macrophages treated with CEOOH or 7-KC for 16 h. We observed the same increased binding with CEOOH (Fig. 4B) but only a marginal increase of the complex was observed after 7-KC treatment (Fig. 4C). The retarded bands obtained with the various treatments (CEOOH and 7-KC) disappeared also when the anti-PPARa antibody was used with no modification of the intensity in the presence of the anti-PPARc antibody or the control IgG.

3.2

0.8

0.5

1

3.2

0.7

0.5

1

1.4

0.4

0.4

1

1

0.2

1

0.3

CEOOH

Intensity 0.4

also stimulate the transcription of the natural CD36 gene promoters [8,25] in Cos7 cells. The reporter activity of UP-CD36-Luc was unmodified under all the conditions investigated (data not shown). Native LDL had no effect on the transcription of the DW-CD36-Luc plasmid under all the conditions tested (data not shown) while modLDL increased twofold its transcription in the presence of either PPARa or c (Fig. 3, right).

1

B

1

C

7-KC

Intensity 0.5

1

1

0.3

Fig. 4. Macrophage nuclear extract binding to the CD36/PPRE probe. The radiolabeled probe was incubated with nuclear extracts prepared from human macrophages incubated with either 100 lg apoB/mL modLDL (A), CEOOH (1.5 nmol/mL) (B), 7-KC (6 nmol/mL) (C) or ethanol (vehicle). Competitors (Comp) or antisera were added as described in the Materials and methods and the complexes were analyzed by electrophoretic mobility shift assay. The intensities of the specific bands (arbitrary units with a phosphorimager) are the mean of two or three experiments with different preparations.

Discussion Several studies have shown that the oxidized lipid moiety is responsible for the recognition of oxidized LDL by CD36 in macrophages [4,26]. However, no study has identified the product derived from oxidized LDL involved in the regulation of CD36 gene expression. The first aim of our study was to identify the oxidized lipids present in oxidized LDL involved in the regulation of the CD36 gene expression, in differentiated macrophages. We showed that a moderate oxidation of LDL increases the amount of CD36 mRNA, in agreement with the results of Kavanagh et al. [27], who showed that mildly and modLDL, but not oxLDL, increase the transcription of CD36, suggesting that early products from modLDL (such as lipid hydroperoxides) are involved in the transcriptional regulation of CD36 and that they are degraded in oxLDL. Consequently, we incubated macrophages with

I. Jedidi et al. / Biochemical and Biophysical Research Communications 351 (2006) 733–738

lipid hydroperoxides isolated by HPLC. A 2.5-fold increase in the amount of CD36 mRNA (similar to the increased expression with modLDL) was observed only when macrophages were incubated with CEOOH, suggesting that this species may be primarily responsible for the increased transcription of the CD36 gene. The relatively weak effect of PCOOH may be due to its more efficient detoxification. In contrast to CEOOH, which is highly resistant to glutathione peroxidase [28] and to cholesteryl esterases [29,30], PCOOH is easily detoxified by glutathione peroxidase. Another possibility is the lower concentration of PCOOH in modLDL as compared to CEOOH (Fig. 2). Furthermore, since cholesteryl esters are composed of two parts, we investigated whether the oxidized cholesterol part could also contribute to the regulation of CD36 gene expression. CD36 gene expression was increased moderately (1.5-fold) by 7-KC, indicating that the cholesterol part is not primarily involved in this regulation. Our study is the first demonstration that a single oxidized lipid molecule isolated from oxidized LDL, CEOOH, is able to increase the amount of CD36 (mRNA and protein) to the same extent as native modLDL. The second goal of our study was to understand the molecular mechanism mediating the modLDL effect. In monocytes, the CD36 gene promoter is a direct target of PPAR [9], which binds to a PPRE in the proximal promoter [7]. Sato et al. have shown that synthetic ligands of both PPARa and c increase the transcription of CD36 gene in THP-1 cells [8]. However, the natural promoter of CD36 did not respond to PPAR ligands although they activated an artificial promoter containing 3 PPRE [8]. Our results clearly show, for the first time, that modLDL activates the transcription of the natural proximal promoter of CD36 in cos7 cells, in the presence of either PPARa or c. The activation of PPARc by oxidized LDL was predicted by Nagy et al. [10]. However, the activation of PPARa by oxidized LDL had not been described previously. We then investigated the effect of modLDL and CEOOH on the binding of macrophage nuclear extracts to the CD36/ PPRE sequence. Both modLDL and CEOOH but not 7KC increased specifically the binding of PPARa to the CD36/PPRE, with no increase of PPARc binding. These findings suggest that (i) the use of synthetic PPARa or PPARc ligands does not reflect the activity of natural PPAR ligands; (ii) an artificial promoter with only 3 PPRE cannot completely mimic the natural promoter of the CD36 gene and describe the physiological responses of the CD36 gene; (iii) in differentiated macrophages activated by modLDL or CEOOH, only PPARa is recruited on the CD36 gene promoter, suggesting that PPARa may be a critical player in lipid accumulation; and (iv) the PPAR-dependent regulation is located in the downstream promoter of the CD36 gene and can be due to a direct binding of PPAR. In conclusion, our study highlights the contribution of PPARa in the cellular effects of modLDL in addition to the previously shown contribution of PPARc. We also

737

point to the important role of CEOOH, which is the most potent oxidized lipid isolated from modLDL to regulate CD36 gene expression in fully differentiated human macrophages. In addition to identifying a novel species of importance for the regulation of CD36 gene expression by oxidized LDL, our findings indicate that this process is far more complex than previously believed, requiring additional studies to unravel the details of its mechanism. Acknowledgments We thank Dr. K. Motojima (Department of Biochemistry, Tokyo University, Japan) for providing us with the luciferase constructs under the control of the upstream and downstream CD36 promoters. I. Jedidi was the recipient of fellowships from the Ministe`re de la Recherche et de la Technologie, the Fondation pour la Recherche Me´dicale, and from the Group of Study on Hemostasis and Thrombosis. This work was supported by the INSERM, the CNRS, and the University Paris Descartes. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2006. 10.122. References [1] D. Steinberg, S. Parthasarathy, T.E. Carew, J.C. Khoo, J.L. Witztum, Beyond cholesterol. Modifications of low-density lipoprotein that increase its atherogenicity, N. Engl. J. Med. 320 (1989) 915–924. [2] U.P. Steinbrecher, Receptors for oxidized low density lipoprotein, Biochim. Biophys. Acta 1436 (1999) 279–298. [3] M. Febbraio, E.A. Podrez, J.D. Smith, D.P. Hajjar, S.L. Hazen, H.F. Hoff, K. Sharma, R.L. Silverstein, Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice, J. Clin. Invest. 105 (2000) 1049–1056. [4] V. Terpstra, D.A. Bird, D. Steinberg, Evidence that the lipid moiety of oxidized low density lipoprotein plays a role in its interaction with macrophage receptors, Proc. Natl. Acad. Sci. USA 95 (1998) 1806–1811. [5] A. Boullier, K.L. Gillotte, S. Horkko, S.R. Green, P. Friedman, E.A. Dennis, J.L. Witztum, D. Steinberg, O. Quehenberger, The binding of oxidized low density lipoprotein to mouse CD36 is mediated in part by oxidized phospholipids that are associated with both the lipid and protein moieties of the lipoprotein, J. Biol. Chem. 275 (2000) 9163–9169. [6] E.A. Podrez, G. Hoppe, J. O’Neil, H.F. Hoff, Phospholipids in oxidized LDL not adducted to apoB are recognized by the CD36 scavenger receptor, Free Radic. Biol. Med. 34 (2003) 356–364. [7] A.L. Armesilla, M.A. Vega, Structural organization of the gene for human CD36 glycoprotein, J. Biol. Chem. 269 (1994) 18985–18991. [8] O. Sato, C. Kuriki, Y. Fukui, K. Motojima, Dual promoter structure of mouse and human fatty acid translocase/CD36 genes and unique transcriptional activation by peroxisome proliferator-activated receptor alpha and gamma ligands, J. Biol. Chem. 277 (2002) 15703–15711. [9] P. Tontonoz, L. Nagy, J.G. Alvarez, V.A. Thomazy, R.M. Evans, PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL, Cell 93 (1998) 241–252. [10] L. Nagy, P. Tontonoz, J.G. Alvarez, H. Chen, R.M. Evans, Oxidized LDL regulates macrophage gene expression through ligand activation of PPARgamma, Cell 93 (1998) 229–240.

738

I. Jedidi et al. / Biochemical and Biophysical Research Communications 351 (2006) 733–738

[11] A. Chawla, Y. Barak, L. Nagy, D. Liao, P. Tontonoz, R.M. Evans, PPAR-gamma dependent and independent effects on macrophagegene expression in lipid metabolism and inflammation, Nat. Med. 7 (2001) 48–52. [12] K.J. Moore, E.D. Rosen, M.L. Fitzgerald, F. Randow, L.P. Andersson, D. Altshuler, D.S. Milstone, R.M. Mortensen, B.M. Spiegelman, M.W. Freeman, The role of PPAR-gamma in macrophage differentiation and cholesterol uptake, Nat. Med. 7 (2001) 41–47. [13] L. Patel, S.J. Charlton, I.C. Marshall, G.B. Moore, P. Coxon, K. Moores, J.C. Clapham, S.J. Newman, S.A. Smith, C.H. Macphee, PPARgamma is not a critical mediator of primary monocyte differentiation or foam cell formation, Biochem. Biophys. Res. Commun. 290 (2002) 707–712. [14] A. Cabrero, M. Cubero, G. Llaverias, M. Jove, A. Planavila, M. Alegret, R. Sanchez, J.C. Laguna, M.V. Carrera, Differential effects of peroxisome proliferator-activated receptor activators on the mRNA levels of genes involved in lipid metabolism in primary human monocyte-derived macrophages, Metabolism 52 (2003) 652–657. [15] C.P. Hodgkinson, S. Ye, Microarray analysis of peroxisome proliferator-activated receptor-gamma induced changes in gene expression in macrophages, Biochem. Biophys. Res. Commun. 308 (2003) 505–510. [16] H. Vosper, L. Patel, T.L. Graham, G.A. Khoudoli, A. Hill, C.H. Macphee, I. Pinto, S.A. Smith, K.E. Suckling, C.R. Wolf, C.N. Palmer, The peroxisome proliferator-activated receptor delta promotes lipid accumulation in human macrophages, J. Biol. Chem. 276 (2001) 44258–44265. [17] I. Jedidi, P. Therond, S. Zarev, C. Cosson, M. Couturier, C. Massot, D. Jore, M. Gardes-Albert, A. Legrand, D. Bonnefont-Rousselot, Paradoxical protective effect of aminoguanidine toward low-density lipoprotein oxidation: inhibition of apolipoprotein B fragmentation without preventing its carbonylation. Mechanism of action of aminoguanidine, Biochemistry 42 (2003) 11356–11365. [18] S. Zarev, D. Bonnefont-Rousselot, I. Jedidi, C. Cosson, M. Couturier, A. Legrand, J.L. Beaudeux, P. Therond, Extent of copper LDL oxidation depends on oxidation time and copper/LDL ratio: chemical characterization, Arch. Biochem. Biophys. 420 (2003) 68–78. [19] D. Hourton, D. Stengel, M.J. Chapman, E. Ninio, Oxidized low density lipoproteins downregulate LPS-induced platelet-activating factor receptor expression in human monocyte-derived macrophages:

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28] [29] [30]

implications for LPS-induced nuclear factor-kappaB binding activity, Eur. J. Biochem. 268 (2001) 4489–4496. C. Massaad, M. Garlatti, E.M. Wilson, F. Cadepond, R. Barouki, A natural sequence consisting of overlapping glucocorticoid-responsive elements mediates glucocorticoid, but not androgen, regulation of gene expression, Biochem. J. 350 (2000) 123–129. C. Gouedard, R. Barouki, Y. Morel, Dietary polyphenols increase paraoxonase 1 gene expression by an aryl hydrocarbon receptordependent mechanism, Mol. Cell. Biol. 24 (2004) 5209–5222. H. Esterbauer, M. Dieber-Rotheneder, G. Waeg, G. striegl, C. Jurgen, Biochemical, structural and functional properties of oxidized low-density lipoprotein, Chem. Res. Toxicol. 3 (1990) 77–92. H. Esterbauer, C. Jurgens, O. Quehenberger, E. Koller, Autooxidation of human low density lipoprotein: loss of polyunsaturated fatty acids and vitamin E and generation of aldehydes, J. Lipid Res. 28 (1987) 495–509. S. Zarev, P. Therond, D. Bonnefont-Rousselot, J.L. Beaudeux, M. Gardes-Albert, A. Legrand, Major differences in oxysterol formation in human low density lipoproteins (LDLs) oxidized by *OH/O2*-free radicals or by copper, FEBS Lett. 451 (1999) 103–108. C. Kuriki, T. Tanaka, Y. Fukui, O. Sato, K. Motojima, Structural and functional analysis of a new upstream promoter of the human FAT/CD36 gene, Biol. Pharm. Bull. 25 (2002) 1476–1478. A.C. Nicholson, S. Frieda, A. Pierce, R.L. Silverstein, Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines. Evidence implicating the lipid moiety of the lipoprotein as the binding site, Arterioscler. Thromb. Vasc. Biol. 15 (1995) 269–275. I.C. Kavanagh, C.E. Symes, P. Renaudin, E. Nova, M.D. Mesa, G. Boukouvalas, D.S. Leake, P. Yaqoob, Degree of oxidation of low density lipoprotein affects expression of CD36 and PPARgamma, but not cytokine production, by human monocyte-macrophages, Atherosclerosis 168 (2003) 271–282. A.W. Girotti, Lipid hydroperoxide generation, turnover, and effector action in biological systems, J. Lipid Res. 39 (1998) 1529–1542. F. Maehira, Inhibitory effect of lipid hydroperoxide on cholesteryl esterases, Biochem. Mol. Biol. Int. 32 (1994) 221–231. G. Hoppe, A. Ravandi, D. Herrera, A. Kuksis, H.F. Hoff, Oxidation products of cholesteryl linoleate are resistant to hydrolysis in macrophages, form complexes with proteins, and are present in human atherosclerotic lesions, J. Lipid Res. 38 (1997) 1347–1360.