Chromatin structure at the flanking regions of the human beta-globin locus control region DNase I hypersensitive site-2: proposed nucleosome positioning by DNA-binding proteins including GATA-1

Biochimica et Biophysica Acta 1679 (2004) 201 – 213 www.bba-direct.com

Chromatin structure at the flanking regions of the human beta-globin locus control region DNase I hypersensitive site-2: proposed nucleosome positioning by DNA-binding proteins including GATA-1 Neil Davies, John Freebody, Vincent Murray * School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney NSW 2052, Australia Received 7 January 2004; received in revised form 6 April 2004; accepted 8 April 2004 Available online 10 May 2004

Abstract The human beta-globin locus control region DNase I hypersensitive site-2 (LCR HS-2) is erythroid-specific and is located 10.9 kb upstream of the epsilon-globin gene. Most studies have only examined the core region of HS-2. However, previous studies in this laboratory indicate that positioned nucleosomes are present at the 5V- and 3V-flanking regions of HS-2. In addition, footprints were observed that indicated the involvement of DNA-binding proteins in positioning the nucleosome cores. A consensus GATA-1 site exists in the region of the 3V-footprint. In this study, using an electrophoretic mobility shift assay (EMSA) and DNase I footprinting, we confirmed that GATA-1 binds in vitro at the 3V-end of HS-2. An additional GATA-1 site was found to bind GATA-1 in vitro at a site positioned 40 bp upstream. At the 5Vend of HS-2, DNase I footprinting revealed a series of footprints showing a marked correlation with the in vivo footprints. EMSA indicated the presence of several erythroid-specific complexes in this region including GATA-1 binding. Sequence alignment for 12 mammalian species in HS-2 confirmed that the highest conservation to be in the HS-2 core. However, a second level of conservation extends from the core to the sites of the proposed positioning proteins at the HS-2 flanking regions, before declining rapidly. This indicates the importance of the HS-2 flanking regions and supports the proposal of nucleosome positioning proteins in these regions. Crown Copyright D 2004 Published by Elsevier B.V. All rights reserved. Keywords: Gene expression; Nucleosome; Phylogenetic footprinting; GATA-1

1. Introduction The human beta-globin locus contains five genes that are expressed in a developmental stage-specific manner that reflects their order in the beta-globin array [1]. The regulation of expression is mainly at the transcriptional level and is mediated by both proximal and distal DNA-regulatory elements. The major distal regulatory element in the human beta-globin locus is the locus control region (LCR) [2– 4] which is located 6-22 kb upstream of the epsilon globin gene (Fig. 1), and consists of at least five erythroid-specific DNase I hypersensitive sites (HS-1 to HS-5). The LCR is required for conferring high-level globin gene expression at all stages of erythroid development [5]. The HS-2 and HS-3 core elements of 200 – 300 bp contain most of the LCR activity, and HS-2 appears to be * Corresponding author. Tel.: +61-2-9385-2028; fax: +61-2-93851483. E-mail address: [email protected] (V. Murray).

necessary and sufficient for full LCR activity in transgenic mice [6,7]. HS-2 contains multiple protein binding sites [8] and has enhancer activity in transient expression experiments [9,10]. The trans-acting factors binding in this region include GATA-1 [11 –13], NF-E2 [14] and CACC-binding proteins [13]. DNase I hypersensitive sites (DHS) are classically regarded as regions that are free from nucleosomes (although this is an area of debate). This permits transcription factors to bind in the region, leading to the induction of gene expression [15]. The results of Cairns and Murray [16] and Kim and Murray [17,18], using bleomycin and hedamycin in vivo footprinting agents, support the proposal that the HS-2 core region is nucleosome-free in erythroid cells. The results of Kim and Murray [17,18] show evidence for positioned nucleosomes at the 5V- and 3V-flanking regions of HS-2 in erythroid cells in vivo. Positioned nucleosomes are often found at the flanking regions of DHS [19 – 21]. The study presented here addresses the question of the identity of the

0167-4781/$ - see front matter. Crown Copyright D 2004 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2004.04.002

202

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

Fig. 1. Schematic of the human beta-globin gene cluster and LCR HS-2. The five expressed globin genes and their promoter regions are shown. The exploded view of the LCR HS-2 shows ‘‘positioned’’ nucleosomes at the 5V- and 3V-boundaries, as well as the position of the putative ‘‘positioning’’ proteins. GATA-1B (the 3V-positioning protein candidate) and GATA-1A are indicated at the 3V-boundary of HS-2. The locations of transcription factor binding elements within HS-2 are also indicated (figure adapted from Kim and Murray [18]).

bound proteins at the 5V- and 3V-ends of HS-2. It additionally provides information on the mechanism by which the nucleosomes are positioned. It should be noted that for this study, in vivo indicates that an experiment was performed in intact cells while in vitro indicates that cell extracts were used. In the presence of ATP, nucleosomes can slide along DNA [22]. Therefore, the maintenance of a nucleosome-free HS requires a mechanism to prevent the sliding of nucleosomes into the site. There are two known mechanisms by which nucleosomes can be positioned, thereby preventing sliding. The mechanism that has been most experimentally documented is positioning via certain DNA sequences. In many instances, a strong correlation was found for the dominant nucleosome positions in vivo and in vitro [23 – 26]. However, results from other studies suggest the use of caution in using in vitro nucleosome positions to predict in vivo nucleosome positions [27]. The second mechanism by which nucleosomes can be translationally positioned is via DNA binding proteins which actively position or prevent the sliding of a nucleosome. Examples of genes in which this has been observed include yeast STE6 and BAR1 [28], promoters in yeast GAL1/GAL10 [29], and the promoter in Drosophila hsp 26 [30]. This is our favoured proposal for nucleosome positioning at the flanking regions of HS-2, for two reasons. First, the results of Kim and Murray [18] show footprints in intact erythroid cells, adjacent to the footprint deduced to be caused by binding of a nucleosome. These footprints were

obtained using four different nitrogen mustards as damaging agents. We propose that these adjacent footprints are caused by transcription factors, which contribute to the establishment of positioned nucleosomes in these regions. At the 3Vend of HS-2, a consensus GATA-1 site exists at the site of the in vivo footprint, and is our candidate for nucleosome positioning in this region. The second reason why we favour DNA binding proteins as the major nucleosome positioning factors at the HS-2 flanking regions is that the deduced in vivo nucleosome footprints are found in erythroid K562 cells but not in non-erythroid HeLa cells, although the DNA sequence is the same in both cell lines [18]. Therefore, the DNA sequence alone cannot position the nucleosomes. The lack of nucleosome footprints in HS-2 in HeLa cells suggests that the nucleosomes are randomly assorted throughout HS-2 in these cells. GATA-1 was the first member of the GATA family of zinc finger transcription factors to be described. It is a haematopoietic cell-specific transcription factor that binds to the consensus sequence (A/T)GATA(A/G) [31]. The DNA binding domain consists of two zinc fingers of the Cys2– Cys2 type, but generally only the C-terminal finger and adjacent basic region are thought to be significantly involved in DNA binding at most sites [32,33]. GATA-1 contacts DNA in both the major and minor grooves [34]. GATA-1 is essential for erythroid cell development [35 – 37], and has been demonstrated to be involved in the generation of active chromatin over almost all of the globin and other erythroid-specific genes [38,39].

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

In this study, we investigated the proposal that nucleosome-positioning factors are present at the flanking regions of HS-2. This was accomplished by in vitro methods and by examination of the level of nucleotide conservation for HS2 in 12 species of mammal.

2. Materials and methods 2.1. Nuclear extract preparation K562 and HeLa cells were harvested and washed twice with ice cold phosphate buffered saline (PBS). All subsequent steps were carried out on ice or at 4 jC. Cells were split into 1.5-ml eppendorf tubes to give approximately 3  107 cells per tube. Cells were centrifuged at 10,000 rpm for 30 s in a microfuge, the PBS was removed and the cells resuspended in 800-Al buffer A consisting of 10 mM HEPES, pH 7.8, 10 mM KCl, 15 mM MgCl2, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM PMSF, 10 Ag/ml aprotinin, 5 Ag/ml leupeptin and 1 mM dithiothreitol. The suspension was incubated for 15 min before the addition of 50 Al of 10% NP-40 and the suspension was vortexed for exactly 30 s. The homogenate was centrifuged at 14,000 rpm for 1 min in a microfuge, and the supernatant discarded. Buffer C (80 Al) was added to the pellet, consisting of 0.4 M NaCl, 20 mM HEPES, pH 7.8, 7.5 mM MgCl2, 2 mM EDTA and 1 mM EGTA, 0.1 mM dithiothreitol, 0.1 mM PMSF, 10 Ag/ml aprotinin and 5 Ag/ml leupeptin. The pellet (after checking that the pellet was white and not yellow) was resuspended in buffer C by flicking the eppendorf. The dithiothreitol, PMSF, aprotinin and leupeptin were added to buffers A and C immediately before use. The pellet was incubated in buffer C for 20 min on a rotary shaker. The tubes were centrifuged for 15 min, and the supernatant transferred to another 1.5-ml eppendorf tube; 3 Al was set aside for protein concentration determination, and the remainder frozen in 30-Al aliquots at 70 jC. The protein concentration was determined using the Bradford reagent with bovine serum albumin as a standard [40].

203

1B( )—caaatatttatgttgcaggt, Sp1—attcgatcggggcggggcgagc [42]; YY1—ctgcagtaacgccattttgcaaggcat [43]. 2.3. Antibodies Anti-GATA-1 antibodies were obtained from Santa Cruz Biotechnology (SC-265) and Sigma (G0290). The Sigma anti-GATA-1 antibody caused a supershift on EMSA gels, while the Santa Cruz antibody did not produce a supershift but inhibited formation of the GATA-1/DNA complex. 2.4. Gel mobility shift assay and DNase I footprinting For gel mobility shift assays, oligonucleotides were [32P]-labelled, hybridised and gel purified on a 15% (w/v) native polyacrylamide gel. Binding reactions were carried out at 0 jC in 20 Al of 10 mM HEPES, pH 7.8, 50 mM potassium glutamate, 5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 5% (v/v) glycerol, and 1 Ag of poly (dI – dC) [44]. Nuclear extract (5– 10 Ag) was added to the binding mix and incubated for 15 min. Where indicated, 1 Al of Sigma or Santa Cruz GATA-1 antibody was added prior to the nuclear extract. [32P]-labelled purified doublestranded oligonucleotide (100 fmol) was added and the reaction mixtures incubated for a further 15 min. Where

2.2. Oligonucleotides The primers used to amplify the flanking regions of HS-2 for DNase I footprinting were: at the 3V-end, ND191— ggatgcctgagacagaatgtgac, and ND193—catgccttcctcttccatatcc; and at the 5V-end, ND112—ggagctgagcttgtaaaaagtatag and ND228—ctgagatcgtgccactgcactccag. The following double-stranded oligonucleotide sequences were used as probes in the gel shift analyses: PCG (Positive Control GATA-1)—cctgggtcttatcaggga [41]; GATA-1B—caaatatttatcttgcaggt; GATA-1A—tatatatttgttgttatcaattgc; GATA-1C—atagaatgattagttattgt; 5VHS2—ggaataagatacatgttttatt. Competitor oligonucleotides were as follows: PCG, GATA-1B, PCG( )—cctgggtcttatgaggga [41], GATA-

Fig. 2. DNase I footprinting analysis at the 3V-end of HS-2. A [32P]-end labelled PCR product containing the 3V-end of HS-2 (bp 8831 to 9110) was used for the DNase I footprinting experiments with K562 or HeLa nuclear extracts. The sites of protection at GATA-1A, GATA-1C and GATA-1B by K562 nuclear extract are shown. Dideoxy sequencing lanes are indicated.

204

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

indicated, competitor oligonucleotides were added prior to the probe at molar excess of 150- to 200-fold. The resulting complexes were separated by electrophoresis through 4% (w/v) polyacrylamide gels at 4 jC in 0.5  Tris – borate – EDTA buffer. Gels were dried and subjected to autoradiography. For DNase I footprinting, primer ND193 was labelled with 32 P using polynucleotide kinase, and used with primer ND191 to amplify the region from bp 8831 to 9110 containing the 3V-end of HS-2. At the 5V end of HS-2, primer ND112 was labelled with 32P and used with primer 228 to amplify the region from bp 8247 to 8449. The resultant fragments were purified on a 6% (w/v) native polyacrylamide gel, then used in a DNase I footprinting reaction using the binding buffer and procedure described above, except that the reaction was scaled up to 30 Al. After the binding procedure described above, 2 Al of a solution containing 2 mM CaCl2 and 2 mM MgCl2 was added and mixed; then 0.003 to 0.12 Kunitz units of DNase 1 (Progen) was added and incubated for 1 min at 25 jC. The reaction was stopped by the addition of 9 Al of 10% SDS and 4.5 Al of 0.1 M EDTA. Proteinase K was added (2

Al of 10 mg/ml) and the reaction incubated for 30 min at 37 jC. H2O (50 Al) was added, and phenol/chloroform extraction was performed followed by ethanol precipitation. The pellet was resuspended in 7 Al of 10 mM Tris –HCl, pH 8.0, 0.1 mM EDTA, and 2 Al loaded onto a 6% denaturing polyacrylamide gel with 2 Al of denaturing formamide dye. Dideoxy sequencing reactions (obtained using the same oligonucleotide primers and unlabelled PCR product) were included on the gel. Gels were dried and subjected to autoradiography. 2.5. HS-2 nucleotide conservation analysis A phylogenetic footprinting analysis of the beta globin HS-2 was performed. Sequences from 12 species of mammal were compared using programs (Pretty Plot and Eplotsimilarity) accessed online from the Australian National Genome Information Service (ANGIS). The 12 species of mammal were human, chimpanzee, olive baboon, cat, dog, galago, rabbit, pig, mouse, cow, goat and rat.

Fig. 3. Gel shift analysis at the proposed positioning protein site GATA-1B. The [32P]-labelled double-stranded oligonucleotide probes used were: Lanes 2, 7 – 14—GATA-1B. Lanes 1, 3 – 6—PCG. Free DNA probes (no nuclear extract) are shown in lanes 1 and 2, HeLa nuclear extract was present in lane 6, K562 nuclear extract used in all other lanes. SigAb (lanes 4 and 8) indicates the addition of 1 Al of Sigma GATA-1 antibody. SCAb (lanes 5 and 9) indicates the addition of 1 Al of Santa Cruz GATA-1 antibody. Competitor oligonucleotides (150-fold molar excess) were added for PCG (lane 10), PCG( ) (lane 11), GATA-1B (lane 12), GATA-1B( ) (lane 13) and Sp1 (lane 14). The GATA-1 band and the GATA-1/Antibody supershift are shown.

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

3. Results 3.1. Analysis at the 3V-end of HS-2 Nuclear extracts were prepared from K562 and HeLa cells and utilised in DNase I footprinting experiments and electrophoretic gel mobility shift assays (EMSA). The [32P]-end labelled PCR products were produced by amplification of the region from bp 8831 to 9110 containing the 3V-end of HS-2 and used in the DNase I footprinting experiments. DNase I footprinting at the 3V-end of HS-2 (Fig. 2) revealed protection at both consensus GATA-1 sites, GATA1A (8940 – 8945) and GATA-1B (8980 –8985). These footprints were obtained using a nuclear extract from erythroid K562 cells which express the globin genes, but not with nuclear extract from HeLa cells. A faint footprint occurred at the GATA-1C site. These experiments demonstrate that an erythroid-specific protein binds to the proposed NPP site GATA-1B in vitro. Radiolabelled double-stranded oligonucleotides were produced containing the GATA-1B sequence and used in gel mobility shift assays (Fig. 3). A major protein/DNA complex (indicated as GATA-1 in Fig. 3) was observed with the K562 nuclear extract (lane 7) which was not observed with HeLa extract (lane 6). The addition of Sigma GATA-1

205

antibody (lane 8) yielded a large ‘‘supershifted’’ complex identifying the bound protein as GATA-1. The use of Santa Cruz GATA-1 antibody (lane 9) resulted in almost complete loss of complex formation. A 150-fold molar excess of competitor GATA-1 oligonucleotides PCG and GATA-1B (self) (lanes 10 and 12) resulted in loss of complex formation, while the use of competitor oligonucleotides with mutated GATA-1 sites (11 and 13) did not. The GATA-1 sites of these latter competitor oligonucleotides were abolished by replacing the G residue of the GATA motif with a C, as this mutation is known to disrupt GATA-1 binding [41]. The use of a competitor oligonucleotide containing an Sp1 site (lane 14) had no significant effect on complex formation. Lanes 3, 4 and 5 represent EMSA using PCG, a positive control oligonucleotide sequence which has been shown to bind GATA-1 and is found in the EKLF gene promoter [41]. A band can be seen (lane 3) that co-migrated with the major GATA-1B band (lane 6), and which is supershifted with Sigma GATA-1 antibody (lane 4). Gel mobility shift assays were conducted to investigate the GATA-1A and GATA-1C sites. Using the K562 nuclear extract (Fig. 4, lane 6), probe GATA-1A was gel shifted and gave a band that co-migrated with the GATA-1 band, but HeLa nuclear extract (lane 10) did not produce this band. This K562-specific complex was recognised by Sigma

Fig. 4. Gel shift analysis of GATA-1 sites at 3V-HS-2. Double-stranded oligonucleotides for the 3 GATA-1 sites at 3V-HS-2 were used. Lanes 1 – 5: GATA-1B. Lanes 6 – 10: GATA-1A. Lanes 11 – 15: GATA-1C. HeLa nuclear extract was present in lanes 5, 10 and 15 while K562 nuclear extract was used in all other lanes. SigAb (lanes 2, 7 and 12) indicates the addition of Sigma GATA-1 antibody. Competitor oligonucleotides (200-fold molar excess) were added for PCG (lanes 3, 8 and 13), PCG( ) (lanes 4, 9 and 14). The GATA-1 band and the GATA-1/Antibody supershift are shown.

206

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

GATA-1 antibody (lane 7) and gave a supershift. Loss of complex formation was observed with addition of a 200fold molar excess of competitor oligonucleotide containing a consensus GATA-1 site (PCG, lane 8) but not with a competitor oligonucleotide with a mutated GATA-1 site (PCG( ), lane 9). Probe GATA-1C was not gel shifted by an erythroidspecific nuclear protein (lanes 11 and 15), and the minor bands observed were not significantly affected by the addition of Sigma GATA-1 antibody (lane 12) or competitor oligonucleotides (lanes 13 and 14). This indicated that GATA-1 binds in vitro at site GATA-1A but not GATA-1C. A phylogenetic footprinting analysis of the human beta globin HS-2 was attempted. Sequences from 12 species of mammal were investigated for this region. Fig. 5 shows a depiction of nucleotide conservation at the 3V-end of HS2 (Pretty Plot). This indicated areas of sequence conservation, but these regions were not conserved in all species. Sequence conservation was also observed at the GATA-1 sites, but again the conservation was not found in all species.

3.2. Analysis at the 5V-end of HS-2 [32P]-end labelled PCR products were amplified from the 5V-end of HS-2 (bp 8247 to 8449) and used for the DNase I footprinting experiments (Fig. 6). Utilising K562 and HeLa nuclear extracts, a series of footprints and enhancements between bp 8330 and 8390 can be observed in Fig. 6. This large footprinted region is composed of several smaller footprints that are bordered by sites of enhancement at bps 8330, 8368, 8378 and 8390. The results are similar for K562 and HeLa nuclear extracts. However, there are several erythroid-specific footprints including: the AGATAC site (bp 8334 – 8339) that is a potential GATA-1 binding site; and at bp 8360. These in vitro DNase I footprinting results at 5V-HS-2 correlated with the in vivo results obtained by Kim and Murray [17]. The erythroid-specific protein binding at the AGATAC site (bp 8334 – 8339) was further investigated by gel mobility shift analysis (Fig. 7). The AGATAC doublestranded oligonucleotide probe is from the 8328– 8349-bp region. Two erythroid-specific bands were detected (labelled GATA-1 and YY1 + GATA-1) using this AGATAC

Fig. 5. Nucleotide conservation (Pretty Plot) for the 3V-end of HS-2 GATA-1 sites. Sequence alignment for 12 species of mammal is shown. The three potential GATA-1 sites are indicated. For GATA-1A and GATA-1B, the actual GATA site is found on the other (non-coding) DNA strand, and is shown above the sequence alignment. The consensus sequence is indicated below the alignment and a dash (in the consensus sequence) indicates that there is no consensus for that nucleotide. The species are arranged in decreasing order of similarity to human.

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

207

8366 and 8370– 8387. These areas were highly correlated with the DNase I footprints obtained in vitro (Fig. 6).

4. Discussion 4.1. GATA-1 and nucleosome positioning at the 3V-end of HS-2

Fig. 6. DNase I footprinting analysis at the 5V-end of HS-2. A [32P]-end labelled PCR product containing the 5V-end of HS-2 (bp 8247 to 8449) was used for the DNase I footprinting experiments with K562 or HeLa nuclear extracts. Two footprints between bp 8330 and 8390 are shown as well as enhancements at bps 8330, 8368, 8378 and 8390 (indicated by arrows). The erythroid-specific footprint at the AGATAC site is indicated. The in vivo footprint described by Kim and Murray [17] is indicated by the open rectangle. Dideoxy sequencing lanes are indicated.

oligonucleotide (lane 6). Loss of complex formation was observed at both band positions with the addition of a 200-fold molar excess of competitor PCG, containing a consensus GATA-1 site (lane 7), but not by PCG( ), containing a mutated GATA-1 site (lane 8). Use of Sigma GATA-1 antibody (lane 9) also causes loss of complex formation at both bands. The lower band co-migrates with a GATA-1/PCG complex (PCG, lane 3) which was supershifted by Sigma GATA-1 antibody (lane 4). This indicated that GATA-1 protein is complexed with the AGATAC oligonucleotide at this lower erythroid-specific band. The upper erythroid-specific band (YY1 + GATA-1) and a band (YY1) were competed out by an oligonucleotide containing a characterised YY1 site (lane 10), but not by an oligonucleotide which does not bind YY1 (lane 11). Band YY1 co-migrated with the characterised YY1/DNA complex (lane 12). This suggested that the upper erythroidspecific band is a complex of YY1 and GATA-1 with the AGATAC oligonucleotide. A phylogenetic footprinting analysis of 12 species of mammal was also performed at the 5V-end of HS-2. Fig. 8 shows a depiction of nucleotide conservation at the 5V-end of HS-2 (Pretty Plot). This indicated areas of sequence conservation especially between bps 8333 –8341, 8353 –

GATA-1 was found to be the dominant protein binding in vitro at the site of the proposed nucleosome positioning protein (GATA-1B) (Figs. 2 and 3). Therefore, the footprints obtained at this site in vivo in erythroid cells [12,18] are likely to be due to GATA-1 binding at this site in vivo. The location of this footprint adjacent to a positioned nucleosome [18] suggests a role for GATA-1 in the maintenance of the nucleosome position at this site. A role for GATA-1 has recently been proposed in nucleosome positioning in the human beta-globin intron 2 [45]. This study was initiated following the results of Kim and Murray [17,18]. However, evidence for the in vivo binding of GATA-1 at 3V-HS-2 is also found in an earlier study [12], in which erythroid-specific footprints were observed at sites GATA-1B and GATA-1A, using DMS as a footprinting agent. Surprisingly, in view of our in vitro results (Fig. 4, lanes 11 –15), an erythroid-specific footprint was also observed at GATA-1C, the non-consensus GATA-1 site. Furthermore, all three in vivo footprints changed character when the cells were treated with haemin, which is used to induce globin gene expression [46]. Chromatin immunoprecipitation (ChIP) analysis has been performed for GATA-1 over the entire beta-globin cluster, a region of 75 kb, using arrays [47]. Two major sites of in vivo GATA-1 binding were found: at the core of HS-2, and upstream of the gamma-globin gene. Some evidence of GATA-1 binding at the 3V-end of HS-2 was observed, but not regarded as significant under the parameters of the study. Although a powerful technique, ChIP is open to some criticism because it requires that a specific region of the protein of interest is accessible to the antibody being used. It has been said that ChIP ‘‘requires well behaved antibodies’’ [48]. GATA-1 is known to interact with itself [49], with Friend of GATA (FOG) [50], EKLF and SP1 [51], and may be involved in recruitment of histone acetylase [52,53] and RNA polymerase II [54]. In addition, our proposal suggests that GATA-1B would be in close proximity to a positioned nucleosome. Any of these factors could hinder the access of the antibody to the protein of interest, especially as formaldehyde, used in ChIP to crosslink the factor of interest to DNA, and cross-links protein to protein. Horak et al. [47] used three antibody types to attempt to circumvent this potential problem. However, possible weaknesses of the ChIP technique are highlighted by the fact that they did not observe additional in vivo GATA-1 binding sites previously detected using ChIP in the beta-globin region [55].

208

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

Fig. 7. Gel mobility shift analysis of the AGATAC site at the 5V-boundary of HS2. The labelled double-stranded oligonucleotide probes used were PCG (lanes 1, 3, 4), YY1 (lane 12) and 5VHS2 (lanes 2, 5 – 11). The 5VHS2 probe covers the region from bp 8328 – 8349 at the 5V-boundary of HS2 and contains the AGATAC motif. The YY1 oligonucleotide contains a known high-affinity YY1 binding site. Free DNA probes are shown in lanes 1 and 2. HeLa nuclear extract was in lane 5, while K562 nuclear extract was used in all other lanes. SigAb (lanes 4 and 9) indicates the addition of 1 Al of Sigma GATA-1 antibody. Competitor oligonucleotides (200-fold molar excess) were added for PCG (lane 7), PCG( ) (lane 8), YY1 (lane 10), and Sp1 (lane 11). The GATA-1 and YY1 bands are indicated by arrows. The band thought to represent simultaneous binding of GATA-1 and YY1 is indicated.

It should be noted that GATA-2, which is also present in erythroid cells, may also bind at the GATA-1B site. The use of Santa Cruz GATA-1 antibody (Fig. 2, lane 9) results in loss of the GATA-1 complex, but a minor band slightly above this can be seen, which may be due to GATA-2 binding. This is very similar to results previously obtained for GATA-2 gel migration relative to GATA-1 [56]. Why Sigma GATA-1 antibody (Fig. 2, lane 8) does not produce this result is unclear, though the two antibodies clearly have a dissimilar effect on GATA-1 binding in EMSA. GATA-1 was also shown to be the dominant protein binding in vitro at the GATA-1A site (Fig. 4, lanes 6– 10). As stated previously, an in vivo haemin-inducible erythroidspecific footprint has been reported at this site [12]. In addition, the results of Kim and Murray [18] suggest a possible in vivo footprint at this site, though the location of the site at the extreme end of the gel makes interpretation difficult. We can only speculate on the role, if any, of the GATA-1A site at the 3V-end of HS-2. Although we propose that the GATA-1 protein at the GATA-1B site is involved in nucleosome positioning, it is possible that GATA-1B as well as GATA-1A perform a combination of roles at the 3V-end

of HS-2. GATA-1 has been shown to perform a number of functions, including perturbation of nucleosome binding [57], recruitment of histone acetylase [52] including at HS-2 [53], and recruitment of RNA polymerase II, including at HS-2 [54]. These functions could all be considered to be involved in activation of chromatin. The observation that GATA-1 can disrupt a nucleosome [57] could be linked to our proposal that GATA-1 is positioning a nucleosome. GATA-1 is one of the earliest markers of red cell differentiation [58] and could be involved in chromatin remodelling at a very early stage, both by recruitment of remodelling activities (e.g. histone acetylase), and directly (by nucleosome perturbation). If GATA-1 is directly involved in nucleosome disruption at the HS-2 region, this would indicate that the protein would then be ideally placed to adopt the role of preventing the nucleosomes from sliding into the newly created HS. The proposal that GATA-1B recruits histone acetylase is also attractive, due to the hypothesised proximity of GATA-1B to the positioned nucleosome. The results of the clustal alignment for the nucleotide sequences of 12 mammal species support our proposal for

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

209

Fig. 8. Nucleotide conservation (Pretty Plot) for 5V-HS-2. Sequence alignment for 12 species of mammal is shown. The site of the non-consensus AGATAC site at bp 8334 – 8339 is highlighted. The sites of in vitro enhancement at bp 8330, 8368, 8378 and 8390 are indicated. The consensus sequence is shown below the alignment and a dash (in the consensus sequence) indicates that there is no consensus for that nucleotide. The species are arranged in decreasing order of similarity to human.

nucleosome positioning at the 3V-end of HS-2 (Fig. 9). These alignments were generated after the predicted sites of the nucleosome and positioning proteins were formulated from in vivo and in vitro results, and the Eplotsimilarity graph shows a striking correlation to the schematic outline of our proposal (Fig. 9). It can be seen from this ‘‘similarity’’ plot that there are in general three tiers of conservation. The region of highest conservation is shown to lie within the 374-bp XbaI –HindIII fragment which is historically taken to represent the core of HS-2 and is the minimal region capable of conferring position independent expression of the beta-globin gene [8,13]. There is a secondary tier of conservation that extends from this core region to points that are very close to the sites of the proposed positioning proteins at the 5V and 3V ends of HS-2. After these points, there is then a rapid decline in sequence conservation to a ‘‘background’’ level of conservation. The sites of GATA-1A and GATA-1B are shown to lie within the region of secondary conservation, before it declines to background level. This is a compelling result, which did not form any part of our original positioning protein proposal. It can be seen that there is strong conservation of the GATA-1B site, except for the second ‘‘A’’ of the GATA site (Fig. 5). GATA-1 has been shown to bind to a variety of sites in addition to the consensus GATA-1 site [44], and GATA-1 may recognise these variations in vivo.

The site of GATA-1A (Fig. 5) is less conserved, but is conserved across the human, chimpanzee, olive baboon, galago and rabbit. This may reflect differences that have arisen between species over the course of evolution, and the GATA-1A site may play a significant role in those species in which it is found. This may also apply to the incomplete conservation at GATA-1B. Examples of these ‘‘differential footprints’’ and their significance can be found in the globin genes. One example is the SSP-binding site in the gammaglobin gene promoter [59], which is conserved in anthropoid primates only. This factor is implicated in the differential expression of gamma-globin and beta-globin genes [60]. 4.2. Nucleosome positioning at the 5V-end of HS-2 The footprints observed between bp 8330 and 8390 (Fig. 6) show a marked correlation to the in vivo footprinting results previously reported [17], in which the in vivo footprint is reported to be from 8332 to 8385. The DNase I footprinting results are similar for K562 and HeLa nuclear extract, however, there are some erythroid-specific footprints, for example at positions 8336 and 8360. Examination of the results of Kim [17] reveals partial footprinting in the region 8330 to 8390 in HeLa cells, though the adjacent positioned nucleosome is found in K562 cells only. This suggests that a series of ubiquitous factors bind in this

210

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

Fig. 9. Summary diagram of the human beta-globin HS-2 and areas of sequence conservation. The horizontal bar indicates the XbaI/HindIII fragment taken to represent the accepted HS-2 core. The positions of GATA-1A and GATA-1B are shown. The position of the 5V-HS-2 footprints obtained in vivo and in vitro is indicated. Numbering is from the human beta-globin sequence (GenBank accession NG 000007). The exploded diagram shows the relation of the Eplotsimilarity graph to known and proposed features of HS-2. The Eplotsimilarity graph was obtained using a 12-bp moving window. The diagram is approximately to scale.

region, but that a small number of erythroid-specific factors are responsible for key activities in this region, including the establishment of nucleosome positioning. Nucleosome rearrangement by erythroid proteins at the 5V-end of HS-2 has been reported in an in vitro chromatin-assembled LCR system [61]. An erythroid-specific DNase I footprint is observed at position 8334 – 8339 at the 5V-boundary of HS-2 (Fig. 6). In view of the 3V-HS-2 GATA-1 sites, it is provocative that a (non-consensus) GATA-1 site exists at this point—AGATAC. A probe containing this site suggested the binding of GATA-1 at the lower erythroid-specific band in gel shift analysis (Fig. 7). Evidence from both competitor oligonucleotides and GATA-1 antibody indicates that GATA-1 protein is bound at this sequence. We speculate that

GATA-1 could be involved in nucleosome positioning at the 5V-end of HS-2. There was a second erythroid-specific (upper) band. Surprisingly, addition of GATA-1 antibody or competitor oligonucleotide results in loss of this complex. Competitor oligonucleotide results tentatively suggest that this band is due to the simultaneous or co-operative binding of YY1 and GATA-1. The site in the AGATAC oligonucleotide thought to bind YY1 is the sequence TACATGTT, which is similar to a known high affinity YY1 binding consensus GACATNTT [62]. Further experiments are required to clarify this point. Simultaneous and co-operative binding of GATA-1 and YY1 has been previously reported, at the core of HS-3 [63] and at the epsilon globin silencer [64,65].

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

For the sequence alignment (Fig. 9) at the 5V-end of HS-2, the results are similar to the 3V-end, with the secondary tier of conservation extending to the site of the in vitro and in vivo footprints reported [17], after which conservation declines rapidly to background level. The sequence alignment in this region (Fig. 8) reveals a series of blocks of high conservation which show a correlation to the series of sub-footprints in vitro (Fig. 6). The AGATAC site at 8334– 8339 is not highly conserved. However, it is possible that the site may play a significant role in the human HS-2.

211

[17,18]. In this alternative proposal, the bound factors at the flanking regions of HS-2 would then define the boundaries of, and perhaps play a part in the creation and maintenance of, this region of modified chromatin.

Acknowledgements This research was supported by the National Health and Medical Council of Australia. NPD was supported by an Australian Postgraduate Award.

4.3. General discussion of HS-2 nucleosome positioning References From previous studies [12,18], it appears that occupation of the GATA-1B site and the sites at the 5V-HS-2 is continuous rather than transient, since continuous occupation would be required to produce the reported footprints. This is in agreement with a nucleosome positioning protein proposal [22] that nucleosome positioning by a DNA binding factor requires that the factor be continuously bound to the DNA binding site, due to the phenomenon of ATPdependent nucleosome movement. The LCR HS core elements are responsible for most of the activity of the LCR in transgenic assays [66 –69]. The question then arises as to the role of the HS-2 flanking regions—the significance of which is supported by the existence of the second ‘‘tier’’ of conservation which extends out to the points of the proposed positioning proteins (Fig. 9). There is evidence that the LCR HS flanking regions may lead to synergistic enhancement of expression, whereas the cores alone yield only additive expression [70]. In addition, in beta-thalassemic mice, therapeutic levels of beta-globin gene expression are attained in the presence of the HS-2, -3 and -4 cores and flanking regions, but not with the HS cores alone [71]. In the LCR holocomplex model [66,72], the flanking sequences may help position the HS cores in a manner that aids their interaction [70]. The results of previous in vivo studies of HS-2 in this laboratory [16 – 18] conflict with the results of other researchers [73,74], who report that nucleosomes are found in vivo throughout the HS-2 region in both erythroid K562 cells and non-erythroid HeLa cells, and are positioned by sites of DNA bending found 5V and 3V of the HS-2 core. We believe the results of Kim and Murray [17,18] and Cairns and Murray [16] to more truly represent the in vivo situation, since they were obtained solely in intact cells. The results of Onishi et al [73] and Onishi and Kiyama _Hlt70162939[[74], while compelling, were in part deduced using plasmid DNA and intact, extracted nuclei. Despite this, it is possible that histone octamers are present along the entirety of HS-2, but that they are modified; for example by SWI/SNF complexes or histone acetylation. This could explain why they do not produce in vivo footprints in the studies of Cairns and Murray [16] and Kim and Murray

[1] G. Stamatoyannopoulos, A.W. Nienhuis, in: G. Stamatoyannopoulos, A.W. Nienhuis, P.J. Majerus, H. Varmus (Eds.), The Molecular Basis of Blood Diseases, 2nd ed., Saunders, Philadelphia, 1994, pp. 107 – 156. [2] W.C. Forrester, S. Takegawa, T. Papayannopoulou, G. Stamatoyannopoulos, M. Groudine, Evidence for a locus activation region: the formation of developmentally stable hypersensitive sites in globinexpressing hybrids, Nucleic Acids Res. 15 (1987) 10159 – 10177. [3] F. Grosveld, G.B. van Assendelft, D.R. Greaves, G. Kollias, Positionindependent, high-level expression of the human beta-globin gene in transgenic mice, Cell 51 (1987) 975 – 985. [4] D. Tuan, W. Solomon, Q. Li, I.M. London, The ‘‘beta-like-globin’’ gene domain in human erythroid cells, Proc. Natl. Acad. Sci. U. S. A. 82 (1985) 6384 – 6388. [5] D.R. Higgs, Do LCRs open chromatin domains? Cell 95 (1998) 299 – 302. [6] J.A. Lloyd, J.M. Krakowsky, S.C. Crable, J.B. Lingrel, Human gamma- to beta-globin gene switching using a mini construct in transgenic mice, Mol. Cell. Biol. 12 (1992) 1561 – 1567. [7] B.J. Morley, C.A. Abbott, J.A. Sharpe, J. Lida, P.S. Chan-Thomas, W.G. Wood, A single beta-globin locus control region element (5V hypersensitive site 2) is sufficient for developmental regulation of human globin genes in transgenic mice, Mol. Cell. Biol. 12 (1992) 2057 – 2066. [8] D. Talbot, S. Philipsen, P. Fraser, F. Grosveld, Detailed analysis of the site 3 region of the human beta-globin dominant control region, EMBO J. 9 (1990) 2169 – 2177. [9] P.A. Ney, B.P. Sorrentino, K.T. McDonagh, A.W. Nienhuis, Tandem AP-1-binding sites within the human beta-globin dominant control region function as an inducible enhancer in erythroid cells, Genes Dev. 4 (1990) 993 – 1006. [10] D.Y. Tuan, W.B. Solomon, I.M. London, D.P. Lee, An erythroidspecific, developmental-stage-independent enhancer far upstream of the human ‘‘beta-like globin’’ genes, Proc. Natl. Acad. Sci. U. S. A. 86 (1989) 2554 – 2558. [11] P.M. Reddy, C.K. Shen, Protein – DNA interactions in vivo of an erythroid-specific, human beta-globin locus enhancer, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 8676 – 8680. [12] T. Ikuta, Y.W. Kan, In vivo protein – DNA interactions at the betaglobin gene locus, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 10188 – 10192. [13] J.J. Caterina, D.J. Ciavatta, D. Donze, R.R. Behringer, T.M. Townes, Multiple elements in human beta-globin locus control region 5V HS 2 are involved in enhancer activity and position-independent, transgene expression, Nucleic Acids Res. 22 (1994) 1006 – 1011. [14] Q. Gong, A. Dean, Enhancer-dependent transcription of the epsilonglobin promoter requires promoter-bound GATA-1 and enhancerbound AP-1/NF-E2, Mol. Cell. Biol. 13 (1993) 911 – 917. [15] Q. Li, S. Harju, K.R. Peterson, Locus control regions: coming of age at a decade plus, Trends Genet. 15 (1999) 403 – 408.

212

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

[16] M.J. Cairns, V. Murray, Detection of protein – DNA interactions at beta-globin gene cluster in intact human cells utilizing hedamycin as DNA-damaging agent, DNA Cell Biol. 17 (1998) 325 – 333. [17] A. Kim, V. Murray, A large ‘‘footprint’’ at the boundary of the human beta-globin locus control region hypersensitive site-2, Int. J. Biochem. Cell Biol. 32 (2000) 695 – 702. [18] A.R. Kim, V. Murray, Chromatin structure at the 3V-boundary of the human beta-globin locus control region hypersensitive site-2, Int. J. Biochem. 33 (2001) 1183 – 1192. [19] A. Almer, W. Horz, Nuclease hypersensitive regions with adjacent positioned nucleosomes mark the gene boundaries of the PHO5/ PHO3 locus in yeast, EMBO J. 5 (1986) 2681 – 2687. [20] G.H. Thomas, S.C. Elgin, Protein/DNA architecture of the DNase I hypersensitive region of the Drosophila hsp26 promoter [erratum appears in EMBO J 1988 Oct;7(10):3300], EMBO J. 7 (1988) 2191 – 2201. [21] S.D. Willis, M.A. Seyfred, Pituitary-specific chromatin structure of the rat prolactin distal enhancer element, Nucleic Acids Res. 24 (1996) 1065 – 1072. [22] M.J. Pazin, P. Bhargava, E.P. Geiduschek, J.T. Kadonaga, Nucleosome mobility and the maintenance of nucleosome positioning, Science 276 (1997) 809 – 812. [23] T. Agalioti, S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, D. Thanos, Ordered recruitment of chromatin modifying and general transcription factors to the IFN-beta promoter, Cell 103 (2000) 667 – 678. [24] G. Fragoso, S. John, M.S. Roberts, G.L. Hager, Nucleosome positioning on the MMTV LTR results from the frequency-biased occupancy of multiple frames, Genes Dev. 9 (1995) 1933 – 1947. [25] M.S. Roberts, G. Fragoso, G.L. Hager, Nucleosomes reconstituted in vitro on mouse mammary tumor virus B region DNA occupy multiple translational and rotational frames, Biochemistry 34 (1995) 12470 – 12480. [26] E.Y. Shim, C. Woodcock, K.S. Zaret, Nucleosome positioning by the winged helix transcription factor HNF3, Genes Dev. 12 (1998) 5 – 10. [27] S. Belikov, B. Gelius, O. Wrange, Hormone-induced nucleosome positioning in the MMTV promoter is reversible, EMBO J. 20 (2001) 2802 – 2811. [28] M. Shimizu, S.Y. Roth, C. Szent-Gyorgyi, R.T. Simpson, Nucleosomes are positioned with base pair precision adjacent to the alpha 2 operator in Saccharomyces cerevisiae, EMBO J. 10 (1991) 3033 – 3041. [29] M.J. Fedor, N.F. Lue, R.D. Kornberg, Statistical positioning of nucleosomes by specific protein-binding to an upstream activating sequence in yeast, J. Mol. Biol. 204 (1988) 109 – 127. [30] Q. Lu, L.L. Wallrath, H. Granok, S.C. Elgin, (CT)n (GA)n repeats and heat shock elements have distinct roles in chromatin structure and transcriptional activation of the Drosophila hsp26 gene, Mol. Cell. Biol. 13 (1993) 2802 – 2814. [31] D.I. Martin, S.H. Orkin, Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1, Genes Dev. 4 (1990) 1886 – 1898. [32] J.G. Omichinski, C. Trainor, T. Evans, A.M. Gronenborn, G.M. Clore, G. Felsenfeld, A small single-‘‘finger’’ peptide from the erythroid transcription factor GATA-1 binds specifically to DNA as a zinc or iron complex, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 1676 – 1680. [33] C.D. Trainor, J.G. Omichinski, T.L. Vandergon, A.M. Gronenborn, G.M. Clore, G. Felsenfeld, A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction, Mol. Cell. Biol. 16 (1996) 2238 – 2247. [34] J.G. Omichinski, G.M. Clore, O. Schaad, G. Felsenfeld, C. Trainor, E. Appella, S.J. Stahl, A.M. Gronenborn, NMR structure of a specific DNA complex of Zn-containing DNA binding domain of GATA-1, Science 261 (1993) 438 – 446. [35] Y. Fujiwara, C.P. Browne, K. Cunniff, S.C. Goff, S.H. Orkin, Arrested development of embryonic red cell precursors in mouse embryos

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44] [45]

[46]

[47]

[48] [49]

[50]

[51]

[52]

[53]

[54]

[55]

lacking transcription factor GATA-1, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 12355 – 12358. M.J. Weiss, G. Keller, S.H. Orkin, Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells, Genes Dev. 8 (1994) 1184 – 1197. M.J. Weiss, S.H. Orkin, Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 9623 – 9627. J. Boyes, G. Felsenfeld, Tissue-specific factors additively increase the probability of the all-or-none formation of a hypersensitive site, EMBO J. 15 (1996) 2496 – 2507. J.A. Stamatoyannopoulos, A. Goodwin, T. Joyce, C.H. Lowrey, NFE2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region, EMBO J. 14 (1995) 106 – 116. H.S. Choi, Z. Lin, B.S. Li, A.Y. Liu, Age-dependent decrease in the heat-inducible DNA sequence-specific binding activity in human diploid fibroblasts, J. Biol. Chem. 265 (1990) 18005 – 18011. M. Crossley, A.P. Tsang, J.J. Bieker, S.H. Orkin, Regulation of the erythroid Kruppel-like factor (EKLF) gene promoter by the erythroid transcription factor GATA-1, J. Biol. Chem. 269 (1994) 15440 – 15444. T. Tamaki, K. Ohnishi, C. Hartl, E.C. LeRoy, M. Trojanowska, Characterization of a GC-rich region containing Sp1 binding site(s) as a constitutive responsive element of the alpha 2(I) collagen gene in human fibroblasts, J. Biol. Chem. 270 (1995) 4299 – 4304. J.R. Flanagan, K.G. Becker, D.L. Ennist, S.L. Gleason, P.H. Driggers, B.Z. Levi, E. Appella, K. Ozato, Cloning of a negative transcription factor that binds to the upstream conserved region of Moloney murine leukemia virus, Mol. Cell. Biol. 12 (1992) 38 – 44. M. Merika, S.H. Orkin, DNA-binding specificity of GATA family transcription factors, Mol. Cell. Biol. 13 (1993) 3999 – 4010. R.R. Bharadwaj, C.D. Trainor, P. Pasceri, J. Ellis, LCR-regulated transgene expression levels depend on the Oct-1 site in the AT-rich region of beta -globin intron-2, Blood 101 (2003) 1603 – 1610. T.R. Rutherford, D.J. Weatherall, Deficient heme synthesis as the cause of noninducibility of hemoglobin synthesis in a Friend erythroleukemia cell line, Cell 16 (1979) 415 – 423. C.E. Horak, M.C. Mahajan, N.M. Luscombe, M. Gerstein, S.M. Weissman, M. Snyder, GATA-1 binding sites mapped in the betaglobin locus by using mammalian chIp-chip analysis, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 2924 – 2929. R. Martienssen, Chipping away at chromatin [comment], Nat. Genet. 27 (2001) 240 – 241. M. Crossley, M. Merika, S.H. Orkin, Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains, Mol. Cell. Biol. 15 (1995) 2448 – 2456. A.P. Tsang, J.E. Visvader, C.A. Turner, Y. Fujiwara, C. Yu, M.J. Weiss, M. Crossley, S.H. Orkin, FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation, Cell 90 (1997) 109 – 119. M. Merika, S.H. Orkin, Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Kruppel family proteins Sp1 and EKLF, Mol. Cell. Biol. 15 (1995) 2437 – 2447. C.M. Kiekhaefer, J.A. Grass, K.D. Johnson, M.E. Boyer, E.H. Bresnick, Hematopoietic-specific activators establish an overlapping pattern of histone acetylation and methylation within a mammalian chromatin domain, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 14309 – 14314. D.L. Letting, C. Rakowski, M.J. Weiss, G.A. Blobel, Formation of a tissue-specific histone acetylation pattern by the hematopoietic transcription factor GATA-1, Mol. Cell. Biol. 23 (2003) 1334 – 1340. K.D. Johnson, J.A. Grass, M.E. Boyer, C.M. Kiekhaefer, G.A. Blobel, M.J. Weiss, E.H. Bresnick, Cooperative activities of hematopoietic regulators recruit RNA polymerase II to a tissue-specific chromatin domain, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 11760 – 11765. Z. Duan, G. Stamatoyannopoulos, Q. Li, Role of NF-Y in in vivo

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213

[56]

[57]

[58]

[59] [60]

[61]

[62]

[63]

[64]

[65]

regulation of the gamma-globin gene, Mol. Cell. Biol. 21 (2001) 3083 – 3095. Y.L. Yu, Y.J. Chiang, J.J. Yen, GATA factors are essential for transcription of the survival gene E4bp4 and the viability response of interleukin-3 in Ba/F3 hematopoietic cells, J. Biol. Chem. 277 (2002) 27144 – 27153. J. Boyes, J. Omichinski, D. Clark, M. Pikaart, G. Felsenfeld, Perturbation of nucleosome structure by the erythroid transcription factor GATA-1, J. Mol. Biol. 279 (1998) 529 – 544. M. Hu, D. Krause, M. Greaves, S. Sharkis, M. Dexter, C. Heyworth, T. Enver, Multilineage gene expression precedes commitment in the hemopoietic system, Genes Dev. 11 (1997) 774 – 785. R. Hardison, Hemoglobins from bacteria to man: evolution of different patterns of gene expression, J. Exp. Biol. 201 (1998) 1099 – 1117. S.M. Jane, P.A. Ney, E.F. Vanin, D.L. Gumucio, A.W. Nienhuis, Identification of a stage selector element in the human gamma-globin gene promoter that fosters preferential interaction with the 5V HS2 enhancer when in competition with the beta-promoter, EMBO J. 11 (1992) 2961 – 2969. K.M. Leach, K. Nightingale, K. Igarashi, P.P. Levings, J.D. Engel, P.B. Becker, J. Bungert, Reconstitution of human beta-globin locus control region hypersensitive sites in the absence of chromatin assembly, Mol. Cell. Biol. 21 (2001) 2629 – 2640. S.R. Yant, W. Zhu, D. Millinoff, J.L. Slightom, M. Goodman, D.L. Gumucio, High affinity YY1 binding motifs: identification of two core types (ACAT and CCAT) and distribution of potential binding sites within the human beta globin cluster, Nucleic Acids Res. 23 (1995) 4353 – 4362. D.A. Shelton, L. Stegman, R. Hardison, W. Miller, J.H. Bock, J.L. Slightom, M. Goodman, D.L. Gumucio, Phylogenetic footprinting of hypersensitive site 3 of the beta-globin locus control region, Blood 89 (1997) 3457 – 3469. B. Peters, N. Merezhinskaya, J.F. Diffley, C.T. Noguchi, Protein – DNA interactions in the epsilon-globin gene silencer, J. Biol. Chem. 268 (1993) 3430 – 3437. N. Raich, C.H. Clegg, J. Grofti, P.H. Romeo, G. Stamatoyannopoulos,

[66]

[67]

[68]

[69]

[70]

[71]

[72] [73]

[74]

213

GATA1 and YY1 are developmental repressors of the human epsilonglobin gene, EMBO J. 14 (1995) 801 – 809. J. Bungert, U. Dave, K.C. Lim, K.H. Lieuw, J.A. Shavit, Q. Liu, J.D. Engel, Synergistic regulation of human beta-globin gene switching by locus control region elements HS3 and HS4, Genes Dev. 9 (1995) 3083 – 3096. E. Milot, J. Strouboulis, T. Trimborn, M. Wijgerde, E. de Boer, A. Langeveld, K. Tan-Un, W. Vergeer, N. Yannoutsos, F. Grosveld, P. Fraser, Heterochromatin effects on the frequency and duration of LCR-mediated gene transcription, Cell 87 (1996) 105 – 114. P.A. Navas, K.R. Peterson, Q. Li, E. Skarpidi, A. Rohde, S.E. Shaw, C.H. Clegg, H. Asano, G. Stamatoyannopoulos, Developmental specificity of the interaction between the locus control region and embryonic or fetal globin genes in transgenic mice with an HS3 core deletion, Mol. Cell. Biol. 18 (1998) 4188 – 4196. J. Bungert, K. Tanimoto, S. Patel, Q. Liu, M. Fear, J.D. Engel, Hypersensitive site 2 specifies a unique function within the human betaglobin locus control region to stimulate globin gene transcription, Mol. Cell. Biol. 19 (1999) 3062 – 3072. J.M. Molete, H. Petrykowska, E.E. Bouhassira, Y.Q. Feng, W. Miller, R.C. Hardison, Sequences flanking hypersensitive sites of the betaglobin locus control region are required for synergistic enhancement, Mol. Cell. Biol. 21 (2001) 2969 – 2980. C. May, S. Rivella, J. Callegari, G. Heller, K.M. Gaensler, L. Luzzatto, M. Sadelain, Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin, Nature 406 (2000) 82 – 86. M. Wijgerde, F. Grosveld, P. Fraser, Transcription complex stability and chromatin dynamics in vivo, Nature 377 (1995) 209 – 213. Y. Onishi, Y. Wada-Kiyama, R. Kiyama, Expression-dependent perturbation of nucleosomal phases at HS2 of the human beta-LCR: possible correlation with periodic bent DNA, J. Mol. Biol. 284 (1998) 989 – 1004. Y. Onishi, R. Kiyama, Enhancer activity of HS2 of the human betaLCR is modulated by distance from the key nucleosome, Nucleic Acids Res. 29 (2001) 3448 – 3457.