Chronic cold stress in mice induces a regulatory phenotype in macrophages: Correlation with increased 11β-hydroxysteroid dehydrogenase expression

Brain, Behavior, and Immunity 26 (2012) 50–60

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Chronic cold stress in mice induces a regulatory phenotype in macrophages: Correlation with increased 11b-hydroxysteroid dehydrogenase expression R. Sesti-Costa ⇑, M.D.C. Ignacchiti, S. Chedraoui-Silva, L.F. Marchi, B. Mantovani Department of Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, 14049-900 Ribeirão Preto, SP, Brazil

a r t i c l e

i n f o

Article history: Received 4 April 2011 Received in revised form 13 July 2011 Accepted 14 July 2011 Available online 22 July 2011 Keywords: Neuroimmunomodulation Chronic stress Macrophage Phagocytosis 11b-HSD Glucocorticoid Catecholamine Growth hormone

a b s t r a c t Susceptibility to infections, autoimmune disorders and tumor progression is strongly influenced by the activity of the endocrine and nervous systems in response to a stressful stimulus. When the adaptive system is switched on and off efficiently, the body is able to recover from the stress imposed. However, when the system is activated repeatedly or the activity is sustained, as during chronic or excessive stress, an allostatic load is generated, which can lead to disease over long periods of time. We investigated the effects of chronic cold stress in BALB/c mice (4 °C/4 h daily for 7 days) on functions of macrophages. We found that chronic cold stress induced a regulatory phenotype in macrophages, characterized by diminished phagocytic ability, decreased TNF-a and IL-6 and increased IL-10 production. In addition, resting macrophages from mice exposed to cold stress stimulated spleen cells to produce regulatory cytokines, and an immunosuppressive state that impaired stressed mice to control Trypanosoma cruzi proliferation. These regulatory effects correlated with an increase in macrophage expression of 11b-hydroxysteroid dehydrogenase, an enzyme that converts inactive glucocorticoid into its active form. As stress is a common aspect of modern life and plays a role in the etiology of many diseases, the results of this study are important for improving knowledge regarding the neuro–immune–endocrine interactions that occur during stress and to highlight the role of macrophages in the immunosuppression induced by chronic stress. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Stress can be defined as a state of homeostatic disturbance induced by psychological, environmental, physiological or infectious stimuli. Neuroendocrine changes are triggered as an adaptive reaction to stress stimulation, and the changes induced greatly differ according to type, intensity and duration of stress. Physiological responses to stress were observed by Selye in 1949 and referred to as ‘‘General Adaptation Syndrome’’ (Selye and Fortier, 1949). Currently, this adaptation to a stressor is referred to as allostasis, which is an essential, active and adaptive process for maintaining a steady state via multiple effectors (McEwen, 1998). Stress responses are mediated by two main mechanisms: (a) activation of the hypothalamic–pituitary–adrenal (HPA) axis, which culminates in glucocorticoid secretion, and (b) stimulation of the sympathetic nervous system (SNS), which results in the release of norepinephrine and epinephrine (Laurentiis et al., 2005; Sternberg, 2006; Tausk et al., 2008; Webster et al., 2002). When this adaptive system is switched on and off efficiently, the body is able to recover from the stress imposed. However,

⇑ Corresponding author. Fax: +55 16 3633 6840. E-mail address: [email protected] (R. Sesti-Costa). 0889-1591/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbi.2011.07.234

when the system is activated repeatedly or the activity is sustained, an allostatic load is generated, which can lead to disease over long periods of time (McEwen, 1998). During a stress response, the neuroendocrine system helps the body to cope with the stressor by preparing the body for a ‘‘fight or flight’’ reaction, which can enhance or inhibit some aspects of the immune system (Dhabhar, 2002; Glaser et al., 2000). The final result depends on intensity of stressor stimulus, its continuity or intermittence as well as the immune cells evaluated. A large part of the immune response that is important for resolving infectious, tumoral and inflammatory injuries requires the involvement of macrophages, essential cells that efficiently remove cell debris generated by apoptosis during tissue remodeling or necrosis resulting from trauma. Macrophages are also responsible for the recognition and destruction of foreign agents in the body through phagocytosis and the production of reactive oxygen species. Finally, macrophages are fundamental for driving the T cell response through antigen presentation and cytokine secretion (Mantovani et al., 2007; Mosser and Edwards, 2008). Studies on the effects of stress on macrophages are contradictory. Some reports have indicated a decreased phagocytic ability upon stress induction (Garbulinski et al., 1991; Palermo-Neto et al., 2003), whereas others have shown an increase in phagocytosis in response to stress (Barriga et al., 2001; Ferrandez and De la Fuente,

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

1999; Shilov and Orlova, 2003). This divergence in results may be explained by differences in the type and duration of the stress applied in the study, the activation state of macrophages and particularly, the receptors involved in phagocytosis, as different studies use different types of particles for macrophage ingestion. Additionally, it is not known whether macrophages under stress are able to influence the T cell response. Our previous studies have shown that acute cold stress model acts differently on resting and lipopolysacharide (LPS)-activated macrophages. The acute stress model consisted of a single submission of mice to 4 °C for 4 h, which was able to increase plasma concentrations of corticosterone, epinephrine and norepinephrine. Resting macrophages from acutely stressed mice exhibited lower phagocytosis mediated by Fcc and mannose receptors, whereas activated macrophages had higher phagocytic capacity by the same receptors. Besides, the latter were less able to phagocytosis of apoptotic cells at the inflammatory site and to produce TGF-b (Baccan et al., 2010; Sesti-Costa et al., 2010). In the current study, we aim to investigate the effect of chronic stress, submitting mice to 4 °C for 4 h during seven consecutive days, on the function of resting and LPS-activated macrophages under various stimulation conditions and determine whether macrophages from stressed mice could influence the T cell response. 2. Methods 2.1. Animals and chronic cold stress Male 6- to 8-week-old BALB/c mice were obtained from Ribeirão Preto Medical School, University of São Paulo animal center and maintained under a 12:12 light:dark cycle with food and water available ad libitum. Chronic stress was induced by exposing mice to 4 °C for 4 h each day for 1, 6, 7 or 14 days, and the mice were sacrificed immediately after last session of stress. The protocol of stress used was approved by the ethics committee of the Faculty of Medicine of Ribeirão-USP (protocol No. 134/2006). 2.2. Quantification of plasma hormones After exposure to stress, mice were decapitated, and blood was collected into heparin-coated tubes. Blood was centrifuged, and the plasma was stored at -70 °C until use in assays. For catecholamine measure, plasma was stored in sodium metabisulfite to avoid oxidation. Catecholamines were purified by adsorption in alumin at pH 8.8 and dosed by HPLC using an octadecylsilane column (ODS-C18) and electrochemical detection as previously described (Garofalo et al., 1996). For corticosterone dosage, steroids were extracted from the plasma by adding 1 ml of ethanol. Corticosterone concentrations were determined by radioimmunoassay as previously reported (Vecsei, 1979) using an rabbit anti-corticosterone antibody and 3 H-corticosterone as the competitor. The radioimmunoassay performed for growth hormone (GH) was standardized according to Szepeshazi and co-workers (Szepeshazi et al., 2001) using a rabbit anti-rat GH antibody and a recombinant mouse GH (National Hormone & Peptide Program (NHPP), CA, USA). Mouse GH was labeled with 0.6 mCi I125 by Chloramine T, and the labeled hormone was purified on a Sephadex G75 column. Plasma samples (100 ll) from mice were incubated with the anti-rat GH antibody and 10,000 cpm of GH-I125 at 4 °C for 72 h. The secondary antibody was added, and samples were incubated at 4 °C for 24 h. Polyethylene glycol was then added, and samples were centrifuged to precipitate the immune complexes. The supernatant was discarded, and the reading was performed on the precipitate.

51

2.3. Isolation of peritoneal macrophages Immediately after exposure to stress, animals were sacrificed by cervical dislocation, and macrophages were harvested by injecting 3 ml of Hanks’ Balanced Salt Solution (HBSS) into the peritoneal cavity. The cell suspension was incubated on culture plates for 60 min at 37 °C in RPMI-1640 (Sigma) containing 10% fetal bovine serum (Life Technologies, New York, NY, USA) for the macrophages to adhere as described by Mantovani (Mantovani, 1987) and washed with HBSS to remove the non-adherent cells. For experiments with activated macrophages, mice were intraperitoneally injected with 50 lg of LPS (lipopolysaccharide from Escherichia coli 026: B6 – Sigma, St. Louis, MO, USA) in 500 ll of PBS four days before the collection of macrophages. After this period, cells from the peritoneal cavity consisted of more than 95% macrophages, as seen by optical microscopy. 2.4. Phagocytosis assay Immune complexes were produced by staining goat red blood cells (GRBCs) with PKH26 (Sigma) according to the manufacturer’s instructions and incubating them for 30 min at 37 °C with mouse anti-GRBC antibody, which was produced and purified as previously described (Mantovani, 1987). Apoptotic thymocytes were obtained by incubation with 1 lM dexamethasone for 3 h at 37 °C, and they were then stained with cell tracker green CMFDA (Molecular Probes, Invitrogen, Eugene OR, USA) according to the manufacturer’s instructions. Zymosan was resuspended in carbonate buffer with 25 lg/ml FITC (Sigma) for 30 min at 37 °C and incubated with mouse serum to promote opsonization. Macrophages (106) were incubated at 37 °C for 45 min with 500 ll RPMI-1640 (Sigma) medium containing 10% fetal bovine serum and the different phagocytic stimuli, including an immune complex of IgG bound to red blood cell-PKH26 (4  106), zymosan-FITC (50 lg), zymosan-FITC opsonized with complement (50 lg) and apoptotic thymocyte-CMFDA (5  106). The macrophages incubated with apoptotic thymocytes were washed vigorously using a Pasteur pipette to remove the surface bound stimuli as described by Licht and co-workers (Licht et al., 1999), and red blood cells from the immune complex bound to macrophages were lysed by hypotonic shock as described by Mantovani (Mantovani, 1987). The fluorescence of internalized particles was captured by flow cytometry (FACSCanto, BD Biosciences) after fluorescence quenching of zymosan-FITC particles bound to the macrophage surface with trypan blue (2 lg/ml). Results were analyzed using FlowJoÒ (Tree Star) software and represented as the mean fluorescence intensity (MFI) per macrophage. 2.5. Superoxide anion determination Peritoneal cells were suspended in Hanks’ containing 1% gelatin (Difco, Detroit, MI, USA) to prevent the adhesion of macrophages to the tubes, and 106 cells were incubated with 0.15 mM lucigenina (Sigma) for 5 min at 37 °C. The immune complex of IgG bound to OVA was prepared by incubation of 1 mg/ml OVA for 1 h at 37 °C with antibody anti-OVA, which was prepared and purified as previously described (Lucisano and Mantovani, 1984). Zymosan or zymosan opsonized with complement was prepared as item 2.4. The stimuli were added to a final concentration of 200 lg/ml. The luminescence generated by the reaction was captured immediately for 90 min, and the results were expressed as the peak of superoxide release. 2.6. Actin polymerization Macrophages (5  105) were adhered onto coverslips, fixed and permeabilized with 2% paraformaldehyde containing 0.3% Triton

52

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

X-100 (Sigma) for 15 min at room temperature. After washing, cells were incubated with 15 lg/ml phaloidin-FITC (Sigma) for 45 min at room temperature. The coverslips were washed with PBS and mounted on a slide with mounting medium containing DAPI (diamidino-phenylindole-dihydrochloride) for labeling cell nuclei (Molecular Probes – Invitrogen). Cells were viewed by fluorescence microscopy in a blinded fashion, and fluorescence intensity was determined using ImageJ software. Results are expressed as the mean fluorescence intensity per macrophage. 2.7. Spleen cell isolation and co-culture Spleens of naive mice were macerated in PBS, and the cells were incubated for 5 min in lysis buffer (one part 0.17 M Tris–HCl [pH 7.5] and nine parts 0.16 M ammonium chloride) and suspended at 5  106/ml in RPMI-1640 containing 10% fetal bovine serum (Life Technologies, New York, NY, USA). Macrophages from stressed or control mice (5  105) were adhered to 96-well plates and stimulated for 45 min at 37 °C with the following different phagocytic stimuli: immune complex (100 lg/ml), zymosan (50 lg/ml), opsonized zymosan (50 lg/ml) or apoptotic thymocytes (2.5  106/ml). The stimuli were washed away, and the macrophages were co-incubated with splenocytes. After 72 h of incubation, the supernatant was collected and stored at 70 °C until cytokine determination. 2.8. Flow cytometry Peritoneal macrophages (5  105) were incubated with PBS containing 10% goat serum for 1 h at room temperature to block Fc receptors (Hendrzak et al., 1994). The cells were then incubated for 40 min at 4 °C with the following conjugated antibodies: rat anti-IA/IE (MHC class II)-FITC (553623) or rat IgG2a-FITC (553929) as an isotype control, and hamsteranti-CD80-FITC (553768) (all at 2 lg/ml, BD Biosciences, San Diego, CA, USA). Cells were fixed with 2% paraformaldehyde for 20 min at room temperature. The acquisition was performed with a FACSCanto, and data were analyzed using FlowJoÒ (Tree Star) software.

Table 1 Primers used in PCR reactions. Target

Forward primer

Reverse primer

11-HSD GR b2AR GHR b-Actin

GGCCAGCAAAGGGATTGGAAG TGGTGTGCTCCGATGA TGGTCATCCTGATGGTATGG GATTTTACCCCCAGTCCCAGTTC AGGGAAATCGTGCGTGACA

TTTTCCCAGCCAAGGAGGAGA AGGGTAGGGGTAAGC CCGGGAATAGACAAAGACCA GACCCTTCAGTCTTCTCATCCACA GAACCGCTCATTGCCGATA

50 °C for GR primers) for 1 min, and 72 °C for 1 min. Real time PCR reactions were performed in triplicate. Relative expression levels were calculated by DDCt (=DCt sample DCt of the calibrator) (Pfaffl 2001). The data were normalized to the housekeeping gene, b-actin, and values were compared to the control mice. 2.11. Experimental infection with Trypanosoma cruzi After the last session of stress, mice were intraperitoneally infected with 1000 bloodstream forms of T. cruzi (Y strain) and survival was observed. Parasitemia levels were evaluated by optical microscopy in 5 ll of blood drawn from the tail on 7, 9 and 11 days post-infection. Parasites were grown and purified from the monkey kidney fibroblast line LLC-MK2 (ATCC), suspended at 5  106/ml and labeled with 5 lM CFSE (Invitrogen) for 5 min at room temperature. Parasites were washed and 7  106 were intraperitoneally injected into mice. After 24 h, peritoneal cells were harvested and analyzed by FACS for the presence of intracellular T. cruzi-CFSE. 2.12. Statistical analysis All values were expressed as means ± SEMs. Data were compared between the test and control group by Student’s t-test using Sigma Stat software. Additionally, when more than two groups were compared, the ANOVA analysis was performed followed by Newman–Keuls Multiple Comparison test. Differences were considered significant at p 6 0.05. 3. Results

2.9. Enzyme-linked immunosorbent assay (ELISA) The presence of cytokines in culture supernatants was determined by a sandwich ELISA using DuoSet (R&D Systems, Minneapolis, MN, USA – IFN-c, DY485; TNF-a, DY410; IL-10, DY417; TGF-b, DY240; and IL-6, DY406), and the procedure was carried out according to the manufacturer’s instructions. The tetramethylbenzidine (TMB) reagent set (BD Biosciences) was used as the HRP (horseradish peroxidase) substrate, and absorbance was determined at 450 nm. 2.10. Quantitative real-time PCR RNA was extracted from macrophages (2–5  106/ml) using TrizolÒ according to the protocol recommended by the manufacturer (Invitrogen, Carlsbad, CA, USA). To ensure that samples were not contaminated with DNA, samples were treated with DNAse Amp Grade (1 U/ll – Invitrogen, Carlsbad CA – USA) according to the manufacturer’s protocol. One microgram of total RNA from the individual samples was reverse transcribed using the Superscript III Reverse Transcriptase kit (Invitrogen) into cDNA, and cDNA samples were amplified by real time PCR using the SYBR Green PCR Master Mix (Applied Biosystems, Warrington, WA, UK) according to the manufacturer’s instructions. The specific primer sequences are represented in Table 1. Cycling conditions were 94 °C for 5 min followed by 40 cycles of amplification consisting of 94 °C for 1 min, 60 °C (or

3.1. Chronic cold stress decreases phagocytosis and pro-inflammatory cytokine production by macrophages To study the effects of chronic stress on macrophage function, we first investigated the phagocytic capacity of resting and LPSactivated peritoneal macrophages from chronically stressed mice (4 °C/4 h daily for 7 days). We found that chronic cold stress reduced the phagocytic capacity of both resting and LPS-activated macrophages (Fig. 1A and B). However, whereas resting macrophages showed diminished phagocytosis upon stimulation with all the stimuli used, LPS-activated macrophages had reduced phagocytosis only when stimulated with either apoptotic thymocytes or zymosan. These data indicate an inhibitory effect of chronic cold stress on a fundamental function of macrophages. To determine the mechanism by which phagocytosis was inhibited by stress, we evaluated whether chronic cold stress altered actin polymerization in macrophages. Fig. 1E shows that chronic cold stress inhibited actin polymerization in resting macrophages, but no change was observed in LPS-activated macrophages. Together, these results indicate that macrophages in different stages of activation are differentially modulated by chronic cold stress. Despite the reduction in phagocytic capacity, chronic cold stress did not alter superoxide production by macrophage stimulated with different stimuli (Fig. 1C and D). Apoptotic thymocytes neither induced superoxide release nor inhibited the stimulation of superoxide mediated by PMA (phorbol myristate acetate) (data

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

53

Fig. 1. Chronic stress reduces phagocytosis and actin polymerization by macrophages without changing superoxide release. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days, and macrophages were isolated to test for phagocytic capacity (A and B), superoxide release (C and D) and actin polymerization (E). Resting macrophages (A) and macrophages activated by LPS in vivo (B) were incubated with apoptotic thymocytes – CMFDA (AT), zymosan-FITC (zy), zymosan-FITC opsonized with complement (zy ops) or immune complex of IgG bound to red blood cell-PKH26 (IC) for 45 min at 37 °C. The fluorescence present in the macrophages was assessed by flow cytometry, and data were plotted as the mean fluorescence intensity (n = 6–8 per group in duplicate). ⁄p < 0.05 vs. control (Student’s t-test). Resting macrophages (C) and macrophages activated by LPS in vivo (D) were incubated with medium alone (basal), zymosan (zy), zymosan opsonized with complement (zy ops) or immune complex of IgG bound to OVA (IC) together with lucigenina. The release of superoxide was monitored for 30–90 min. Data were plotted as the peak of centilation per minute (CPM) (n = 7–10 per group). (E) Macrophages were adhered to coverslips and incubated with phaloidin-FITC, which binds to polymerized actin. The data were plotted as the mean fluorescence intensity (MFI) of macrophages as quantified using ImageJ software (n = 3 per group with 10 fields quantified in each slide). The graphs represent the mean ± standard error. ⁄p < 0.05 vs. control (Student’s t-test).

not shown). However, cytokine production was affected by chronic cold stress. We found decreased TNF-a and IL-6 production and increased IL-10 production by both resting and activated macrophages (Fig. 2). These effects were most prominent in resting macrophages, where almost all stimuli induced the decrease in TNF-a and IL-6 secretion, including basal production. Thus, chronic cold stress skews macrophages toward a regulatory profile by inhibiting their production of pro-inflammatory cytokines and promoting their production of anti-inflammatory cytokines. 3.2. Macrophages from stressed mice have diminished expression of antigen-presenting molecules and induce lymphocytes to produce regulatory cytokines The ingestion of foreign particles by macrophages generates peptides that are linked to MHC class II and presented to specific

T cells. Additional signals required for the activation of T lymphocytes are provided by co-stimulatory molecules, which are expressed on the surface of macrophages upon initial recognition of foreign particles. To investigate the antigen-presenting ability of macrophages from stressed mice, we determined the expression of antigen-presenting molecules after chronic cold stress. As shown in Fig. 3, MHC class II expression on the surface of both resting and activated macrophages was reduced after stress. Furthermore, expression of the co-stimulatory molecule, B7–1 (CD80), on activated macrophages was also reduced, indicating impairment of the antigen presenting capacity of macrophages and therefore, potentially altered T cell activation by macrophages after stress. Indeed, resting macrophages from stressed mice significantly inhibited the secretion of IFN-c, a Th1-associated cytokine, in coculture with spleen cells and stimulated the secretion of IL-10 and TGF-b, cytokines associated with a regulatory profile. IL-4, a

54

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

Fig. 2. Chronic stress decreases pro-inflammatory and increases anti-inflammatory cytokine production by macrophages. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days. Resting macrophages (A) and macrophages activated by LPS in vivo (B) were incubated with apoptotic thymocytes (AT), zymosan (zy), zymosan opsonized with complement (zy ops) or immune complex of IgG bound to red blood cells (IC) for 24 h at 37 °C. After the culture, the supernatant was collected, and levels of TNF-a, IL-6 and IL-10 were determined by ELISA. The graphs represent the mean ± standard error (n = 6–8 per group in duplicate). ⁄p < 0.05 vs. control (Student’s t-test).

Th2-associated cytokine, was not detected by ELISA. In LPS-activated macrophages from stressed mice, we observed no change induced by stress in the stimulation of these same cytokines (Fig. 4). These results suggest that regulatory macrophages induced by chronic cold stress can skew T cells into a regulatory profile of cytokine production. Finally, we evaluated whether the inhibitory effects of chronic stress were able to alter the course of an infection. We found that stressed mice were more susceptible to intracellular proliferation of the parasites within peritoneal cells. Additionally, parasitemia levels were higher in chronically stressed mice without altering the survival (Fig. 5). 3.3. Neuroendocrine changes after chronic cold stress To correlate the changes induced by chronic stress in macrophages with neuroendocrine changes, we first evaluated the plasma concentrations of the key hormones related to stress, corticosterone and catecholamines resulting from activation of the HPA axis and sympathetic nervous system, respectively. We also determined the plasma concentrations of growth hormone (GH), as

many studies have shown that GH counteracts the actions of glucocorticoids and catecholamines (Dorshkind and Horseman, 2001). The plasma concentration of corticosterone after acute stress (4 °C for 4 h) increased to approximately six times that of the control. The same result was observed in the mice injected with LPS. However, after 6, 7 and 14 days of chronic stress, corticosterone levels returned to baseline (Fig. 6A). Similarly, the concentrations of epinephrine and norepinephrine increased about twofold after acute stress and returned to baseline after 7 days of stress. The injection of LPS alone caused an increase in hormone levels similar to that of acute cold stress. Stress for 4 h after injection of LPS caused no further increase in the concentration of these hormones (Fig. 6C and D). Plasma concentrations of GH, by contrast, were reduced after 4 h of stress but returned almost to baseline levels after 7 days of chronic cold stress (Fig. 6B), revealing a mechanism of hormonal adaptation after a long period of stress. It is known that corticosterone is present at different concentrations in diverse tissues regardless of its concentration in plasma, as some tissues under different stimuli will produce altered quantities of 11-b hydroxysteroid dehydrogenase type 1 (11b-

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

55

Fig. 3. Macrophage activation is inhibited by chronic stress. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days. Resting macrophages (LPS ) and macrophages activated in vivo by LPS (LPS+) were evaluated for the presence of MHC class II or CD80-FITC. (A) Representative histograms. Control: dotted line; Stress: solid line. Isotype control: gray histogram. (B) Data are plotted as the percentage of stained cells; the graphs represent the mean ± standard error (n = 5–7 per group in duplicate). ⁄ p < 0.05 vs. control (ANOVA analysis followed by Newman–Keuls Multiple Comparison test).

HSD1). This enzyme is responsible for the local conversion of circulating inactive glucocorticoid (dehidroxicorticosterone) into active glucocorticoid (corticosterone), which is then capable of binding to intracellular receptors in target cells. Chronic stress caused an approximately fourfold increase in the mRNA expression of 11b-HSD1 by resting macrophages. Injection of mice with LPS caused a significant increase in the expression of this enzyme (40-fold), but the additional stress did not alter 11b-HSD1 expression in activated macrophages (Fig. 7A). This finding indicates that in spite of the similar plasma concentrations of corticosterone, macrophages may be exposed to higher concentrations of corticosterone. Finally, we evaluated whether the cold stress altered the responsiveness of macrophages to stress hormones. For these experiments, we measured the expression of the hormone receptors, GR (glucocorticoid receptor), b2AR (b2 adrenergic receptor) and GHR (GH receptor) in peritoneal macrophages. As shown in Fig. 7B–D, four days after LPS injection, we found a reduction in the expression of all receptors by macrophages (p < 0.001 with ANOVA followed by Newman–Keuls Multiple comparison test). Additionally, chronic cold stress decreased the expression of GR in both resting and activated macrophages. Stress did not alter the expression of b2AR in resting macrophages, but it increased the amount of b2AR mRNA in activated macrophages, thereby reversing the decrease caused by LPS. The expression of GHR was not modified by chronic cold stress. Thus, the effect of corticosterone mediated by GR on resting and activated macrophages is impaired after stress, whereas the effect of catecholamine mediated by b2AR is enhanced in LPS-activated macrophages after chronic cold stress.

4. Discussion Previous studies investigating the effects of chronic stress on macrophage function have so far been contradictory and incomplete. These studies differ on the type and duration of stress applied, the activation state of the cells assessed and the receptors

involved in phagocytosis, making it difficult to reach a consistent conclusion. Moreover, the influence of chronic stress on additional fundamental functions of macrophages up to now has not yet been determined. The current study showed that chronic cold stress skewed macrophages toward a regulatory phenotype characterized by lower phagocytic ability and higher anti-inflammatory cytokine production, which skewed T cells in the same fashion. Our results demonstrated that chronic cold stress decreased the phagocytosis of all particles by resting macrophages, indicating a widespread inhibition of the receptor-independent phagocytic function of resident peritoneal macrophages. LPS-activated macrophages also had reduced phagocytic ability after chronic stress, but the result was quite different. These macrophages had the ingestion of apoptotic thymocytes and zymosan inhibited, whereas phagocytosis mediated by complement and Fcc receptors remained unchanged, indicating that the inhibition of phagocytosis in activated macrophages is dependent on the phagocytic stimulus. The mechanisms by which stress acts to inhibit phagocytosis by resting macrophages might be a general process associated with phagocytosis. In fact, we found a reduction in actin polymerization in these macrophages after chronic stress. The production of superoxide anion was not altered by stress, suggesting that the effects of stress on phagocytosis did not affect the release of reactive oxygen species by NADPH oxidase. PalermoNeto et al. (2003) also showed a dissociation between the effects of stress on phagocytosis and its effects on the release of reactive oxygen species. They observed that although acute psychological stress or inescapable shock decreased phagocytic capability, these types of stress stimulated the release of hydrogen peroxide (H2O2) by peritoneal macrophages. The inhibition of phagocytosis induced by chronic stress, however, was accompanied by lower secretion of TNF-a and IL-6 and higher secretion of IL-10 by resting and activated macrophages. These data indicate that chronic cold stress induces a regulatory phenotype in macrophages, characterized by limited phagocytic capacity, increased anti-inflammatory cytokine production and reduced pro-inflammatory cytokine secretion.

56

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

Fig. 4. IFN-c secretion is inhibited, whereas IL-10 and TGF-b production by spleen cells is induced by macrophages from chronically stressed mice. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days. Resting macrophages (A) and macrophages activated by LPS in vivo (B) were incubated with medium (med), apoptotic thymocytes (AT), zymosan (zy), zymosan opsonized with complement (zy ops) or immune complex of IgG bound to red blood cells (IC) for 45 min at 37 °C. After the culture, the stimuli were washed out, and the macrophages were incubated with splenocytes from control mice. After 3 days of culture, the supernatant was collected and tested by ELISA. The graphs represent the mean ± standard error (n = 3 per group). ⁄p < 0.05 vs. control (Student’s t-test).

In addition to the ability of IL-10 to suppress pro-inflammatory cytokines, many studies have shown that IL-10 is capable of inhibiting the expression of MHC class II and B7 co-stimulatory molecules on macrophages, thereby inhibiting the presentation of antigens (Connor et al., 2005; de Waal Malefyt et al., 1991; Ding et al., 1993). In the current study, we also observed that the reduction in phagocytic ability and stimulation of IL-10 correlated with reduced expression of B7–1 in activated macrophages and MHC class II in both resting and activated macrophages. These effects resulted in decreased production of IFN-c by spleen cells stimulated with resting, but not activated, macrophages. Our results are in accordance with previous observations that chronic stress is associated with the prevention of cellular immune responses and the reduction in the production of pro-inflammatory cytokines by monocytes and lymphocytes (Bauer et al., 2000; Kiecolt-Glaser

et al., 1996, 1995). It was also demonstrated that stress inhibits pro-inflammatory cytokines and induces anti-inflammatory cytokines, thereby suppressing cellular immunity (Calcagni and Elenkov, 2006). Furthermore, we demonstrated that spleen cells stimulated by resting macrophages develop a regulatory profile by producing IL-10 and TGF-b, indicating that macrophages might be the instigator of the immunosuppressive effects of chronic stress. The inhibitory effects of chronic stress resulted on higher susceptibility to T. cruzi infection, as shown by increased parasites proliferation within peritoneal cells and higher parasitemia. The results suggest that regulatory macrophages of stressed mice are not as able to kill the parasite as those originated from control mice. Exacerbated Th1 response, with high levels of IFN-c and TNF-a production, has been associated with the pathogenesis of

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

57

Fig. 5. Chronic cold stress increases susceptibility to Trypanosoma cruzi infection. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days. Trypomastigotes labeled with CFSE were inoculated (i.p) and after 24 h, peritoneal cells were harvested and analyzed by FACS for the presence of intracellular parasites (A). Mice were infected (i.p) with 1000 trypomastigotes and peak of parasitemia on 9 days post-infection (B) and survival (C) were observed. The graphs represent the mean ± standard error (n = 5– 10 per group) ⁄p < 0.005 vs control.

Fig. 6. Corticosterone, catecholamine and growth hormone concentrations return to baseline after 7 days of stress. Mice were subjected to chronic stress of 4 °C for 4 h daily for 1, 6, 7 or 14 days. The blood was collected to assess the concentration of corticosterone (A), GH (B), norepinephrine (C) and epinephrine (D). The graphs represent the mean ± standard error (n = 7–14 per group for corticosterone, n = 6 pools of 2 mice per group for catecholamines, and n = 6–18 per group for GH). ⁄p < 0.05 vs. control LPS (ANOVA analysis followed by Newman–Keuls Multiple Comparison test).

Chagas disease (da Matta Guedes et al., 2010; Bonney et al., 2011). Thus, despite presenting higher parasitemia, stressed mice resisted to the infection similarly to controls, suggesting that the regulatory macrophages promote a regulation of the Th1 response, avoiding an increase on mortality. To correlate the effects of chronic cold stress on macrophage function with the neuroendocrine events that occur under stress conditions, we initially determined plasma concentrations of key hormones related to stress. In agreement with other studies (Sternberg, 2006; Webster et al., 2002), the hormonal assay showed that the concentrations of corticosterone and catecholamines were elevated after acute stress (4 h). In contrast, GH was decreased after acute stress, which has also been demonstrated by Ruisseau and co-workers (Ruisseau et al., 1978) in rats stressed by 4 °C for 6 h. This result is interesting, as GH has been shown to have the opposite effect of corticosterone in situations of stress (Dimitrov et al., 2004; Mellado et al., 1998; Takagi et al., 1998). After 7 days of chronic stress, however, plasma concentrations of the three hormones returned to baseline levels. These data indicate

that there must be an adrenal (cortical and medullary) activation after acute stress, as the hormone levels acclimated after exposure to stress for longer periods of time. In fact, the habituation of the HPA axis after prolonged conditions of stress has been described in some works, and these studies illustrate the negative feedback exerted by the hippocampus in the release of corticosterone in situations where the stressor remains for long periods (Andersen and Teicher, 2004; Bhatnagar and Meaney, 1995; Mizoguchi et al., 2001; Silberman et al., 2003). In many cases, the actions of hormones on immune cells are mediated through a change in hormonal plasma concentrations, but many studies have shown that 11b-hydroxysteroid dehydrogenase type 1 (11b-HSD1) acts by amplifying corticosterone levels within the cells through the conversion of inactive into active corticosterone, which can bind to glucocorticoid receptors and mediate their effects (Rook et al., 2000; Seckl and Walker, 2001; Zhang et al., 2005). In addition, Thieringer and co-workers (Thieringer et al., 2001) have demonstrated that human monocytes have increased expression of 11b-HSD1 during differentiation into

58

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

Fig. 7. Expression of 11b-HSD 1 is elevated, whereas glucocorticoid receptor expression is reduced in macrophages after chronic stress. Mice were subjected to chronic stress of 4 °C for 4 h daily for 7 days. Expression of 11b-HSD 1 enzyme (A), GR (B), b2AR (C) and GHR (D) by RT-PCR in resting macrophages (LPS ) and macrophages activated in vivo by LPS (LPS+). The graphs represent the mean ± standard error (n = 6–12 in triplicate). ⁄p < 0.05 vs. control and #p < 0.001 between LPS vs. LPS+ (ANOVA analysis followed by Newman–Keuls Multiple Comparison test).

macrophages, and this group, along with others, also showed that when macrophages were activated by LPS, 11b-HSD1 expression was significantly increased (Ishii et al., 2007). However, no study has investigated the effects of stress on the expression of this enzyme by macrophages or other immune cells until now. We observed that although the concentration of plasma corticosterone after chronic stress was similar to that in control mice, the level of intracellular corticosterone in macrophages is likely to be highly amplified because the expression of 11b-HSD1 was increased fourfold in resting macrophages after the stress. The injection of LPS alone induced a 40-fold increase in the expression of 11b-HSD1, confirming data from the literature (Ishii et al., 2007), but chronic cold stress caused no additional change in the expression of the enzyme by activated macrophages. These results suggest that although plasma levels of corticoisterone were not different between stressed and control mice, the macrophages of stressed mice likely have greater levels of intracellular corticosterone. The change in levels of neurotransmitters and hormones is only part of the physiological changes that occur after a neuroendocrine stimulus. It is also important to determine the reactivity of the target tissue to these hormones. A mechanism regulating the responsiveness of the cell to a particular hormone is the change in the number of hormone receptors. There is evidence that the expression of hormone receptors changes during cellular activation or differentiation. A striking example of this phenomenon is the absence of b2 adrenergic receptors on the cell surface of Th2 cells, whereas they are present on Th1 cells (Heijnen, 2007; Sanders et al., 1997). In the current study, we found that injection of mice with LPS decreased the expression of glucocorticoid receptor (GR), b2 adrenergic receptor (b2AR) and growth hormone receptor (GHR) on macrophages after 4 days of injection. Changes in hormone receptor expression under inflammatory conditions have been documented. Patients with chronic inflammatory diseases, such

as rheumatoid arthritis and asthma, develop resistance to glucocorticoids, and the immunosuppressive effects of treatment with glucocorticoids disappear. The synthetic glucocorticoid used in these treatments binds mainly to GR, and studies have shown that resistance to treatment is due to the inhibition of this receptor (Rhen and Cidlowski, 2005). Exposure to chronic cold stress, on the other hand, decreased the expression of GR on both resting and activated macrophages and increased the expression of b2AR on activated macrophages. These results suggest that the effects of chronic cold stress on activated macrophages may be mediated by b2AR, whereas the effects on resting macrophages may be mediated by corticosterone, which is increased in the intracellular environment despite lower expression of GR. These results are in agreement with previous data shown by our group addressing the effects of acute stress (Baccan et al., 2004), which was found to be mediated by corticosterone in resting macrophages, whereas the effects of acute stress on activated macrophages were found to be mediated by catecholamines. Some studies have shown that an increase in sympathetic nervous system activity and subsequent activation of b-adrenergic receptor promotes a regulatory phenotype in LPS-activated macrophages, characterized by increased IL-10 (Siegmund et al., 1998; Suberville et al., 1996; Woiciechowsky et al., 1998) and reduced TNF-a and IL-1b production (Elenkov et al., 1995; van der Poll et al., 1994; Van der Poll and Lowry, 1997). Furthermore, in vitro studies have demonstrated that the inhibitory effects of catecholamines on phagocytosis are mediated by bARs (Roy and Rai, 2004, 2008), whereas the stimulatory effects are mediated by aARs (Garcia et al., 2003; Ortega et al., 2005). In situations of stressrelated diseases and in chronic fatigue syndrome, the sensitivity of immune cells to glucocorticoid can also be changed (de Kloet et al., 2006; Kavelaars et al., 2000). Sheridan’s group has clearly shown that exposure of mice to chronic stress has consequences on the sensitivity of splenocytes to regulation by corticosterone, demonstrating that splenocytes become resistant to this hormone (Avitsur et al., 2005, 2002). We must keep in mind, however, that many other factors may also be involved in hormonal responses that can work in conjunction with corticosterone and catecholamines in the induction of regulatory macrophages upon exposure to chronic stress. The differences between the effects of chronic cold stress on resting and activated macrophages may be due to two different effects of LPS on macrophages: (1) LPS induces the classical activation of macrophages via TLR-4 and TNF-a, which leads to differences in macrophage responses to immune and neuroendocrine stimulation, and (2) injection of LPS causes stress, which stimulates pathways responsible for the modification of neuroendocrine responses to a second type of stress and changes the sensitivity of macrophages to hormones. Chronic stress may be immunosuppressive and therefore harmful to health. As stress is a common aspect of modern life and plays a role in the etiology of many diseases, the results of this study are important for improving knowledge regarding the neuro– immune–endocrine interactions that occur during chronic stress and for identifying the role of macrophages in the immunosuppression induced by chronic stress. The results of this study also suggest that chronic stress exposes the body to a greater risk of infection and proliferation of tumor cells, as the regulatory macrophages generated have a limited phagocytic capacity and enhanced anti-inflammatory cytokine secretion with the consequent inhibition of adaptive immune functions. Acknowledgments The authors thank Dr. José Antunes Rodrigues, Dr. Lucila Leico Kagohara Elias and Dra Isis do Carmo Kettelhut for providing their

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

laboratory facilities for the hormone dosage studies, Dr. João Santana da Silva for help with the experiments with T. cruzi, and José Antônio da Silva, Maria Antonieta Rissato Garófalo, Maria Valci Aparecida dos Santos Silva, Marina Holanda and Fabiana Rosseto de Morais for their technical support. This study was supported by CAPES, FAPESP and FAEPA.

References Andersen, S.L., Teicher, M.H., 2004. Delayed effects of early stress on hippocampal development. Neuropsychopharmacology 29, 1988–1993. Avitsur, R., Stark, J.L., Dhabhar, F.S., Padgett, D.A., Sheridan, J.F., 2002. Social disruption-induced glucocorticoid resistance: kinetics and site specificity. J. Neuroimmunol. 124, 54–61. Avitsur, R., Kavelaars, A., Heijnen, C., Sheridan, J.F., 2005. Social stress and the regulation of tumor necrosis factor-alpha secretion. Brain Behav. Immun. 19, 311–317. Baccan, G.C., Oliveira, R.D., Mantovani, B., 2004. Stress and immunological phagocytosis: possible nongenomic action of corticosterone. Life Sci. 75, 1357–1368. Baccan, G.C., Sesti-Costa, R., Chedraoui-Silva, S., Mantovani, B., 2010. Effects of cold stress, corticosterone and catecholamines on phagocytosis in mice: differences between resting and activated macrophages. Neuroimmunomodulation 17, 379–385. Barriga, C., Martin, M.I., Tabla, R., Ortega, E., Rodriguez, A.B., 2001. Circadian rhythm of melatonin, corticosterone and phagocytosis: effect of stress. J. Pineal Res. 30, 180–187. Bauer, M.E., Vedhara, K., Perks, P., Wilcock, G.K., Lightman, S.L., Shanks, N., 2000. Chronic stress in caregivers of dementia patients is associated with reduced lymphocyte sensitivity to glucocorticoids. J. Neuroimmunol. 103, 84–92. Bhatnagar, S., Meaney, M.J., 1995. Hypothalamic-pituitary-adrenal function in chronic intermittently cold-stressed neonatally handled and non handled rats. J. Neuroendocrinol. 7, 97–108. Bonney, K.M., Taylor, J.M., Daniels, M.D., Epting, C.L., Engman, D.M., 2011. Heatkilled Trypanosoma cruzi induces acute cardiac damage and polyantigenic autoimmunity. PLoS ONE 21, e14571. Calcagni, E., Elenkov, I., 2006. Stress system activity, innate and T helper cytokines, and susceptibility to immune-related diseases. Ann. N. Y. Acad. Sci. 1069, 62– 76. Connor, T.J., Brewer, C., Kelly, J.P., Harkin, A., 2005. Acute stress suppresses proinflammatory cytokines TNF-alpha and IL-1 beta independent of a catecholamine-driven increase in IL-10 production. J. Neuroimmunol. 159, 119–128. da Matta Guedes, P.M., Gutierrez, F.R., Maia, F.L., Milanezi, C.M., Silva, G.K., Pavanelli, W.R., Silva, J.S., 2010. IL-17 produced during Trypanosoma cruzi infection plays a central role in regulating parasite-induced myocaditis. PloS Negl. Trop. Dis. 16, e604. de Kloet, C.S., Vermetten, E., Geuze, E., Kavelaars, A., Heijnen, C.J., Westenberg, H.G., 2006. Assessment of HPA-axis function in posttraumatic stress disorder: pharmacological and non-pharmacological challenge tests, a review. J. Psychiatr. Res. 40, 550–567. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M.G., te Velde, A., Figdor, C., Johnson, K., Kastelein, R., Yssel, H., de Vries, J.E., 1991. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J. Exp. Med. 174, 915– 924. Dhabhar, F.S., 2002. Stress-induced augmentation of immune function–the role of stress hormones, leukocyte trafficking, and cytokines. Brain Behav. Immun. 16, 785–798. Dimitrov, S., Lange, T., Fehm, H.L., Born, J., 2004. A regulatory role of prolactin, growth hormone, and corticosteroids for human T-cell production of cytokines. Brain Behav. Immun. 18, 368–374. Ding, L., Linsley, P.S., Huang, L.Y., Germain, R.N., Shevach, E.M., 1993. IL-10 inhibits macrophage costimulatory activity by selectively inhibiting the up-regulation of B7 expression. J. Immunol. 151, 1224–1234. Dorshkind, K., Horseman, N.D., 2001. Anterior pituitary hormones, stress, and immune system homeostasis. BioEssays 23, 288–294. Elenkov, I.J., Hasko, G., Kovacs, K.J., Vizi, E.S., 1995. Modulation of lipopolysaccharide-induced tumor necrosis factor-alpha production by selective alpha- and beta-adrenergic drugs in mice. J. Neuroimmunol. 61, 123–131. Ferrandez, M.D., De la Fuente, M., 1999. Effects of age, sex and physical exercise on the phagocytic process of murine peritoneal macrophages. Acta Physiol. Scand. 166, 47–53. Garbulinski, T., Obminska-Domoradzka, B., Switala, M., Debowy, J., 1991. Responses of neutrophils and lymphocytes in the cold stress: effects of non-steroid antiinflammatory drugs. Pol. J. Pharmacol. Pharm. 43, 352–359. Garcia, J.J., del Carmen Saez, M., De la Fuente, M., Ortega, E., 2003. Regulation of phagocytic process of macrophages by noradrenaline and its end metabolite 4hydroxy-3-metoxyphenyl-glycol. Role of alpha- and beta-adrenoreceptors. Mol. Cell. Biochem. 254, 299–304.

59

Garofalo, M.A., Kettelhut, I.C., Roselino, J.E., Migliorini, R.H., 1996. Effect of acute cold exposure on norepinephrine turnover rates in rat white adipose tissue. J. Auton. Nerv. Syst. 60, 206–208. Glaser, R., Sheridan, J., Malarkey, W.B., MacCallum, R.C., Kiecolt-Glaser, J.K., 2000. Chronic stress modulates the immune response to a pneumococcal pneumonia vaccine. Psychosom. Med. 62, 804–807. Heijnen, C.J., 2007. Receptor regulation in neuroendocrine-immune communication: current knowledge and future perspectives. Brain Behav. Immun. 21, 1–8. Hendrzak, J.A., Wallace, P.K., Morahan, P.S., 1994. Optimizing the detection of cell surface antigens on elicited or activated mouse peritoneal macrophages. Cytometry 17, 349–356. Ishii, T., Masuzaki, H., Tanaka, T., Arai, N., Yasue, S., Kobayashi, N., Tomita, T., Noguchi, M., Fujikura, J., Ebihara, K., Hosoda, K., Nakao, K., 2007. Augmentation of 11beta-hydroxysteroid dehydrogenase type 1 in LPS-activated J774.1 macrophages – role of 11beta-HSD1 in pro-inflammatory properties in macrophages. FEBS Lett. 581, 349–354. Kavelaars, A., Kuis, W., Knook, L., Sinnema, G., Heijnen, C.J., 2000. Disturbed neuroendocrine–immune interactions in chronic fatigue syndrome. J. Clin. Endocrinol. Metab. 85, 692–696. Kiecolt-Glaser, J.K., Marucha, P.T., Malarkey, W.B., Mercado, A.M., Glaser, R., 1995. Slowing of wound healing by psychological stress. Lancet 346, 1194–1196. Kiecolt-Glaser, J.K., Glaser, R., Gravenstein, S., Malarkey, W.B., Sheridan, J., 1996. Chronic stress alters the immune response to influenza virus vaccine in older adults. Proc. Natl. Acad. Sci. USA 93, 3043–3047. Laurentiis, A., Scorticati, C., McCann, S.M., Rettori, V., 2005. Neuroendocrinologia básica. In: Antunes-Rodrigues, J., Moreira, A.C., Elias, L.L., Castro, M. (Eds.), Neuroendocrinologia básica e aplicada. Guanabara Koogan, Rio de Janeiro-RJ. Licht, R., Jacobs, C.W., Tax, W.J., Berden, J.H., 1999. An assay for the quantitative measurement of in vitro phagocytosis of early apoptotic thymocytes by murine resident peritoneal macrophages. J. Immunol. Methods 223, 237–248. Lucisano, Y.M., Mantovani, B., 1984. Lysosomal enzyme release from polymorphonuclear leukocytes induced by immune complexes of IgM and of IgG. J. Immunol. 132, 2015–2020. Mantovani, B., 1987. Phagocytosis of in vitro-aged erythrocytes – a sharp distinction between activated and normal macrophages. Exp. Cell Res. 173, 282–286. Mantovani, A., Sica, A., Locati, M., 2007. New vistas on macrophage differentiation and activation. Eur. J. Immunol. 37, 14–16. McEwen, B.S., 1998. Stress, adaptation, and disease. Allostasis and allostatic load. Ann. N. Y. Acad. Sci. 840, 33–44. Mellado, M., Llorente, M., Rodriguez-Frade, J.M., Lucas, P., Martinez, C., del Real, G., 1998. HIV-1 envelope protein gp120 triggers a Th2 response in mice that shifts to Th1 in the presence of human growth hormone. Vaccine 16, 1111–1115. Mizoguchi, K., Yuzurihara, M., Ishige, A., Sasaki, H., Chui, D.H., Tabira, T., 2001. Chronic stress differentially regulates glucocorticoid negative feedback response in rats. Psychoneuroendocrinology 26, 443–459. Mosser, D.M., Edwards, J.P., 2008. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8, 958–969. Ortega, E., Marchena, J.M., Garcia, J.J., Barriga, C., Rodriguez, A.B., 2005. Norepinephrine as mediator in the stimulation of phagocytosis induced by moderate exercise. Eur. J. Appl. Physiol. 93, 714–718. Palermo-Neto, J., de Oliveira Massoco, C., Robespierre de Souza, W., 2003. Effects of physical and psychological stressors on behavior, macrophage activity, and Ehrlich tumor growth. Brain Behav. Immun. 17, 43–54. Rhen, T., Cidlowski, J.A., 2005. Antiinflammatory action of glucocorticoids–new mechanisms for old drugs. N. Engl. J. Med. 353, 1711–1723. Rook, G., Baker, R., Walker, B., Honour, J., Jessop, D., Hernandez-Pando, R., Arriaga, K., Shaw, R., Zumla, A., Lightman, S., 2000. Local regulation of glucocorticoid activity in sites of inflammation. Insights from the study of tuberculosis. Ann. N. Y. Acad. Sci. 917, 913–922. Roy, B., Rai, U., 2004. Dual mode of catecholamine action on splenic macrophage phagocytosis in wall lizard, Hemidactylus flaviviridis. Gen. Comp. Endocrinol. 136, 180–191. Roy, B., Rai, U., 2008. Role of adrenoceptor-coupled second messenger system in sympatho-adrenomedullary modulation of splenic macrophage functions in live fish Channa punctatus. Gen. Comp. Endocrinol. 155, 298–306. Ruisseau, P.D., Tache, Y., Brazeau, P., Collu, R., 1978. Pattern of adenohypophyseal hormone changes induced by various stressors in female and male rats. Neuroendocrinology 27, 257–271. Sanders, V.M., Baker, R.A., Ramer-Quinn, D.S., Kasprowicz, D.J., Fuchs, B.A., Street, N.E., 1997. Differential expression of the beta2-adrenergic receptor by Th1 and Th2 clones: implications for cytokine production and B cell help. J. Immunol. 158, 4200–4210. Seckl, J.R., Walker, B.R., 2001. Minireview: 11beta-hydroxysteroid dehydrogenase type 1 – a tissue-specific amplifier of glucocorticoid action. Endocrinology 142, 1371–1376. Selye, H., Fortier, C., 1949. Adaptive reactions to stress. Res. Publ. Assoc. Res. Nerv. Ment. Dis. 29, 3–18. Sesti-Costa, R., Baccan, G.C., Chedraoui-Silva, S., Mantovani, B., 2010. Effects of acute cold stress on phagocytosis of apoptotic cells: the role of corticosterone. Neuroimmunomodulation 17, 79–87. Shilov, J.I., Orlova, E.G., 2003. Role of adrenergic mechanisms in regulation of phagocytic cell functions in acute stress response. Immunol. Lett. 86, 229–233. Siegmund, B., Eigler, A., Hartmann, G., Hacker, U., Endres, S., 1998. Adrenaline enhances LPS-induced IL-10 synthesis: evidence for protein kinase A-mediated pathway. Int. J. Immunopharmacol. 20, 57–69.

60

R. Sesti-Costa et al. / Brain, Behavior, and Immunity 26 (2012) 50–60

Silberman, D.M., Wald, M.R., Genaro, A.M., 2003. Acute and chronic stress exert opposing effects on antibody responses associated with changes in stress hormone regulation of T-lymphocyte reactivity. J. Neuroimmunol. 144, 53– 60. Sternberg, E.M., 2006. Neural regulation of innate immunity: a coordinated nonspecific host response to pathogens. Nat. Rev. Immunol. 6, 318–328. Suberville, S., Bellocq, A., Fouqueray, B., Philippe, C., Lantz, O., Perez, J., Baud, L., 1996. Regulation of interleukin-10 production by beta-adrenergic agonists. Eur. J. Immunol. 26, 2601–2605. Szepeshazi, K., Schally, A.V., Armatis, P., Groot, K., Hebert, F., Feil, A., Varga, J.L., Halmos, G., 2001. Antagonists of GHRH decrease production of GH and IGF-I in MXT mouse mammary cancers and inhibit tumor growth. Endocrinology 142, 4371–4378. Takagi, K., Suzuki, F., Barrow, R.E., Wolf, S.E., Herndon, D.N., 1998. Recombinant human growth hormone modulates Th1 and Th2 cytokine response in burned mice. Ann. Surg. 228, 106–111. Tausk, F., Elenkov, I., Moynihan, J., 2008. Psychoneuroimmunology. Dermatol. Ther. 21, 22–31. Thieringer, R., Le Grand, C.B., Carbin, L., Cai, T.Q., Wong, B., Wright, S.D., Hermanowski-Vosatka, A., 2001. 11 Beta-hydroxysteroid dehydrogenase type

1 is induced in human monocytes upon differentiation to macrophages. J. Immunol. 167, 30–35. Van der Poll, T., Lowry, S.F., 1997. Epinephrine inhibits endotoxin-induced IL-1 beta production: roles of tumor necrosis factor-alpha and IL-10. Am. J. Physiol. 273, R1885–R1890. van der Poll, T., Jansen, J., Endert, E., Sauerwein, H.P., van Deventer, S.J., 1994. Noradrenaline inhibits lipopolysaccharide-induced tumor necrosis factor and interleukin 6 production in human whole blood. Infect. Immun. 62, 2046–2050. Vecsei, P., 1979. Glucocorticoids: cortisol, corticosterona, and compound. In: Jsffe, B.M., Berhrman, H.R. (Eds.), Methods of hormone radioimmunoassay. Academic press, Vallejo, CA, USA, pp. 393–415. Webster, J.I., Tonelli, L., Sternberg, E.M., 2002. Neuroendocrine regulation of immunity. Annu. Rev. Immunol. 20, 125–163. Woiciechowsky, C., Asadullah, K., Nestler, D., Eberhardt, B., Platzer, C., Schoning, B., Glockner, F., Lanksch, W.R., Volk, H.D., Docke, W.D., 1998. Sympathetic activation triggers systemic interleukin-10 release in immunodepression induced by brain injury. Nat. Med. 4, 808–813. Zhang, T.Y., Ding, X., Daynes, R.A., 2005. The expression of 11 beta-hydroxysteroid dehydrogenase type I by lymphocytes provides a novel means for intracrine regulation of glucocorticoid activities. J. Immunol. 174, 879–889.