Chronic Helicobacter pylori infections induce gastric mutations in mice1

GASTROENTEROLOGY 2003;124:1408 –1419

Chronic Helicobacter pylori Infections Induce Gastric Mutations in Mice ELIETTE TOUATI,* VALE´RIE MICHEL,* JEAN–MICHEL THIBERGE,‡ NICOLE WUSCHER,§ MICHEL HUERRE,§ and AGNE`S LABIGNE‡ *Unite´ de Programmation Mole´culaire et de Toxicologie Ge´ne´tique, ‡Unite´ de Pathoge´nie Bacte´rienne des Muqueuses, and §Unite ´ d’Histotechnologie et de Pathologie, Institut Pasteur, Paris, France

Background & Aims: Helicobacter pylori is an important etiologic factor in the development of gastric cancer. The aim of this study was to analyze the role of H. pylori infections in the induction of mutagenic events in gastric epithelial cells. The effect of a high-salt diet as a genotoxic risk factor was also investigated. Methods: Big Blue transgenic male mice (C57Bl/6) were inoculated with H. pylori (strain SS1) or Helicobacter felis (strain CS1) for 6 and 12 months. The frequency and spectrum of mutations at the stomach level were assessed. Inflammatory host response and inducible nitric oxide synthase (iNOS) expression by reverse-transcription polymerase chain reaction and immunohistochemistry analysis were also performed. Results: After 6 months, the gastric mutant frequency was 4-fold and 1.7-fold higher in mice infected with H. pylori and H. felis, respectively, than in uninfected mice. It was associated with a high frequency of transversions (AT 3 CG and GC 3 TA) known to result from oxidative damages. The Helicobacter-infected mice exhibited severe gastritis and a high level of iNOS messenger RNA expression. Hyperplasia developed 12 months after inoculation, and both the mutagenic effects and iNOS expression decreased in H. pylori– and H. felis–infected mice. No synergistic effects of a high-salt diet and Helicobacter infection were observed regarding the frequency of gastric mutation. Conclusions: A direct gastric mutagenic effect due to H. pylori infection in the Big Blue transgenic mouse model has been shown 6 months after inoculation. This genotoxicity can be attributable to oxidative DNA damage involving the inflammatory host response.

nfection with Helicobacter pylori is the most common bacterial infection; one half of the human population worldwide is infected. The bacterium colonizes the gastric mucosa, leading to gastric inflammation and, in some cases (10%), peptic ulcer diseases. H. pylori is also an important etiologic factor in the development of gastric carcinoma. The lesions associated with H. pylori infections are believed to progress over decades through chronic gastritis, atrophy, intestinal metaplasia, and dysplasia to cancer.1 The bacterium has been classified as a

I

group I carcinogen by the World Health Organization/ International Agency for Research on Cancer.2–5 A recent long-term prospective study of 1526 Japanese patients provides strong evidence for the association between H. pylori and gastric cancer observed in approximately 3% of the H. pylori–infected patients but in none of the uninfected patients.6 In addition to the general role that can be attributed to long-term H. pylori infections in gastric carcinogenesis, it is likely that host and environmental factors also contribute either directly or indirectly to the promotion of genotoxic events, leading to precancerous lesions.7 Several studies have reported that chronic inflammation associated with long-term persistence of H. pylori in the human stomach varies according to the bacterial strain involved and the host immune response.8 The inflammatory response is associated with the production of free radicals including reactive oxygen species, which can damage DNA and tissue.9,10 Generation of nitric oxide (NO䡠) by inducible nitric oxide synthase (iNOS) has been reported during inflammation and might play a role in carcinogenesis.11 Induction of iNOS expression has been shown in H. pylori–induced gastritis.12,13 Host genetic factors such as those affecting inflammatory responses have also been reported to play a major role in H. pylori–related diseases. Interleukin-1 gene cluster polymorphisms suspected of enhancing the production of interleukin-1␤, a proinflammatory cytokine, are associated with an increased risk of both hypochlorhydria induced by H. pylori and gastric cancer. Genetic factors that affect interleukin-1␤ production may determine why some individuals infected with H. pylori develop gastric cancer whereas others do not.14 Accordingly, carriers of interleukin 1␤-511T and interleukin-1RN*2 Abbreviations used in this paper: iNOS, inducuble nitric oxide synthase; RT-PCR, reverse-transcription polymerase chain reaction. © 2003 by the American Gastroenterological Association 0016-5085/03/$30.00 doi:10.1016/S0016-5085(03)00266-X

May 2003

homozygotes were found to have an increased risk for developing intestinal-type gastric carcinoma.15 Environmental factors such as a high salt-diet cause gastritis in humans as well as experimental animals and may favor the development of gastric tumors.16 –18 It has been reported that a high-salt diet in mice contributes to gastric atrophy and synergizes with Helicobacter infections through foveolar hyperplasia and expansion of H. pylori colonization.19 Various animal models have been developed to study the pathogenesis of H. pylori. In C57BL/6 mice, Helicobacter felis gastric colonization leads to a chronic active gastritis (with hyperplasia) that progresses to intestinal metaplasia and severe chronic lesions similar to those observed in human disease.20,21 Gastric lesions described as early invasive carcinomas have been reported 12–15 months after infection.22 The adapted clinical H. pylori isolate, strain SS1, is also able to colonize the mouse gastric mucosa. Chronic active gastritis develops 8 months after infection, progressing to severe atrophy in both C57BL/6 and BALB/c mice.23 The local and systemic immune responses on H. pylori SS1-infected mice are similar to those described in human infections.24 However, no severe lesions (ulcer, adenocarcinoma) developed in these mouse models. Such lesions have only been reported in the mongolian gerbil model in which H. pylori is able to cause atrophic gastritis, gastric ulcer, extensive metaplasia, and well-differentiated gastric adenocarcinoma.25–27 Mutagenesis is an essential component of tumorigenesis, particularly that involving genes that guarantee the stability of the genome. Transgenic rodent mutagenic assays were developed in the 1990s and are now widely used to assess in vivo the genetic toxicity of potential mutagenic agents. These systems allow the detection of spontaneous and mutagen-induced mutations in any organ of the animal.28 –30 The Big Blue transgenic mouse assay uses a recoverable transgenic ␭ phage shuttle vector harboring genes that allow easy detection of mutations. These reporter genes are the Escherichia coli lacI and lacZ genes or the cII gene from the ␭ phage.31 We used these Big Blue transgenic mice to investigate the role of H. pylori and H. felis infections in the induction of mutagenic events in gastric epithelial cells. Such events could initiate precancerous processes. We studied the frequency and spectrum of mutations in the stomach as well as the inflammatory host response in infected and noninfected control mice. We also assessed the contribution of a daily high-salt diet to the gastric mutant frequency in H. pylori– and H. felis–infected and noninfected mice.

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

1409

Materials and Methods Animals Six-week-old specific pathogen–free C57BL/6 male mice carrying the ␭ lacI transgene (Big Blue transgenic mice) were purchased from Stratagene (La Jolla, CA). Animals were housed in microisolators in polycarbonate cages. Food and water were supplied ad libitum. Standard diet and high-salt diet (NaCl 0.75% and NaCl 7.5%, respectively) were purchased from SAFE (Epinay/Orge, France). Animals were acclimatized for 1 week before inoculation. The experiments reported here were approved in advance by the Central Animal Facility Committee of the Institut Pasteur, in conformity with the French Ministry of Agriculture Guidelines for Animal Care.

Experimental Infections Mice were inoculated once by mouth with 100 ␮L of a suspension of 108 colony-forming units/mL of H. pylori strain SS1 (n ⫽ 28)23,32 or H. felis strain CS1 (n ⫽ 28).20 Control groups of mice (n ⫽ 24) were given peptone trypsin broth alone. One half of the uninfected mice (n ⫽ 12) and of the H. pylori– and H. felis–infected mice (n ⫽ 14 and n ⫽ 14, respectively) were fed daily with a high-salt diet. The mice were killed 6 and 12 months after infection (noninfected mice, n ⫽ 12; H. pylori–infected mice, n ⫽ 14; H. felis–infected mice, n ⫽ 14 at each time point). As a control for a positive mutagenic response in the stomach in the Big Blue assay,28,29 3 mice were given a daily dose (1.5 mg) of mutagenic nitrofuran derivative 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000) in 300 ␮L of 50% olive oil/10% dimethyl sulfoxide for 5 consecutive days.33 Three control mice received 300 ␮L of 50% olive oil/10% dimethyl sulfoxide by mouth. These animals were killed 3 weeks after the end of the mutagenic treatment, a period corresponding to an optimal expression time for mutations.34 Stomachs were isolated and divided into 3 homogenous segments, each containing antrum and body, and used for (1) histopathologic analyses, (2) determination of the mutant frequency, and (3) reverse-transcription polymerase chain reaction (RT-PCR) analyses of the expression of the inducible form of the nitric oxide synthase encoding gene (iNOS).

Assessment of Infection Infection status was confirmed by enzyme-linked immunosorbent assay technique. Serum samples were obtained from tail vein blood in Sarstedt microtubes (Sarstedt France, Orsay, France) from each mouse at 1, 3, and 9 months. Otherwise, the samples were recovered at the time the mice were killed at 6 and 12 months. The samples were tested for H. pylori or H. felis antigen-specific immunoglobulin G antibody as previously described.21,24 The presence of H. pylori or H. felis bacteria was also histologically confirmed for each mouse at 6 and 12 months after infection by Warthin–Starry staining.

1410

TOUATI ET AL.

GASTROENTEROLOGY Vol. 124, No. 5

Histology

DNA fragment. The RT-PCR reactions were performed as follows: 30 minutes at 50°C (complementary DNA synthesis) and 2 minutes at 94°C (denaturation) followed by the PCR amplification consisting of 40 cycles of 15 seconds at 94°C, 30 seconds at 60°C, and 1 minute at 70°C as well as 1 cycle of 8 minutes at 70°C for elongation. Reaction products were separated on a 2% agarose gel. The complementary DNA fragments obtained were gel purified, and 50 ng of each was used for sequencing.

Gastric tissue samples were taken from noninfected and infected mice. Tissue sections were fixed in formalin and embedded in low-melting-point paraffin wax. Serial 4-␮m sections were cut and stained with H&E, periodic acid–Schiff, and alcian blue using standard procedures.35 Tissue sections were examined blindly for histopathologic lesions to the treatment. The severity of gastritis in all groups of mice was evaluated semiquantitatively. Gastritis scores were determined according to the density of lymphocytes and plasma cells as previously described in the mouse model.36 Briefly, this grading involves an evaluation of the recruitment of inflammatory cells (polymorphonuclear and mononuclear cells) and the changes in the architecture of the mucosa; the morphologic changes in both antrum and corpus were classified into 4 grades: none, mild, moderate, or severe. Metaplasia was studied using the standard histologic criteria used in human pathology.37,38

Immunodetection of iNOS Production In Situ Cells that synthesized iNOS were visualized by immunohistochemistry with specific antibodies and peroxidase detection. Briefly, gastric tissue sections were treated for endogenous peroxidase activity by incubation in 0.3% (vol/vol) H2O2 for 20 minutes and then blocked in normal serum for 20 minutes. The first antibody used was a rabbit polyclonal antibody raised against a synthetic peptide corresponding to amino acid residues 1131–1144 of iNOS from mouse macrophages (diluted 1:100) (Calbiochem, La Jolla, CA).39 A biotinylated goat anti-mouse antibody (Dako, Carpinteria, CA) was then applied, followed by streptavidin-peroxidase assay for 15 minutes at room temperature. After washing, bound peroxidase activity was detected using the AEC substrate (SigmaAldrich, St Quentin Fallavier, France). Tissues were counterstained with hematoxylin, washed, and mounted in Aquamount improved (BDH Laboratories Ltd., Poole, Dorset, England). Ten microscopic fields were scored for iNOS-producing cells (magnification, 250⫻).

Isolation of RNA and RT-PCR Gastric tissues were quickly disaggregated and total RNA isolated using the RNeasy kit according to the manufacturer’s instructions (Qiagen, Courtaboeuf, France). One microgram of total RNA was used for RT-PCR according to the instructions of the Superscript One-Step RT-PCR kit (Life Technologies, Cergy-Pontoise, France). This procedure allows complementary DNA synthesis and PCR in a single tube using gene-specific primers. iNOS expression was analyzed using 5⬘CGCTACTACTCCATCAGCTC3⬘ as the 5⬘ primer and 5⬘CTGTGGTGGTGAAGCTGTAG3⬘ as the 3⬘ primer targeting a 270 – base pair DNA fragment. ␤-actin messenger RNA (mRNA) was used as a control with the primers 5⬘CCAGAGCAAGAGAGGTATCC3⬘ (for 5⬘) and 5⬘CTGTGGTGGTGAAGCTGTAG3⬘ (for 3⬘) targeting a 436 – base pair

Determination of Mutant Frequency Genomic DNA was isolated from stomach tissue as recommended by the supplier (Stratagene). Briefly, gastric tissues were quickly disaggregated and digested with proteinase K. DNA was extracted using phenol/chloroform, precipitated with ethanol, and suspended in 200 – 400 ␮L of Tris/ ethylenediaminetetraacetic acid buffer (10 mmol/L Tris-HCl, pH 7.6, 1 mmol/L ethylenediaminetetraacetic acid). Genomic DNA was allowed to dissolve at room temperature for 24 hours and then stored at 4°C. The transgenic ␭ phage shuttle vector containing the cII reporter gene was recovered from individual genomic DNA samples using the Transpack packaging extract according to the manufacturer’s instructions (Stratagene). DNA extracts from individual mouse stomachs were analyzed independently. The packaging procedures, strain, and medium used to select for cII mutants and to determine the total number of plaque-forming units under nonselective conditions have been described previously in detail.31,40 Briefly, the ␭ phage particles were assayed for cII mutations by infecting an E. coli strain (G1250) that is an hfl mutant facilitating the lysogenic response by increasing the stability of the wild-type CII repressor. For the selection of mutants, plates were incubated at 24°C for 48 hours. At this selective temperature, only phage particles with a mutation in the cII gene can induce a lytic cycle resulting in plaque formation; wild-type particles undergo lysogeny. Mutant frequencies were calculated as the number of mutant plaques at 24°C divided by the average total number of plaques obtained at 37°C under nonselective conditions.

Plaque Purification, PCR, and cII Sequencing To identify the mutations by sequencing, DNA from mutant plaques was isolated and purified as previously reported.41 The cII gene of plaque-purified mutants was amplified by PCR using 10 ␮L of supernatant and the forward primer 5⬘CCGCTCTTACACATTCCAGC3⬘ and the reverse primer 5⬘CCTCTGCCG-AAGTTGAGTAT3⬘. The PCR mixture was as follows: 5 U Taq DNA polymerase (Roche Applied Science, Meylan, France), 1 ␮L 10 mmol/L deoxynucleoside triphosphate mix, 5 ␮L 10⫻ PCR buffer (Roche Applied Science), 5 ␮L 25 mmol/L MgCl2 , 3 ␮L of each primer (10 pmol/L per microliter), final volume 50 ␮L. The PCR program was as follows: step 1, 94°C for 2 minutes; step 2, 30 cycles of 94°C for 10 seconds, 58°C for 30 seconds, and 68°C for 2 minutes; and step 3, 58°C for 8 minutes. The amplification

May 2003

Figure 1. Anti–H. pylori and anti–H. felis antibodies in the sera of C57BL/6 Big Blue mice infected with H. pylori SS1 (gray circles) and H. felis CS1 (closed circles), respectively, or noninfected (open circles) detected by enzyme-linked immunosorbent assay. The results are presented as A405– 492 readings for diluted serum samples (1: 100). Each point corresponds to one mouse. Horizontal bars represent the mean value in each condition for mice 1, 3, 6, 9, and 12 months after infection.

products were sequenced using the cII224 primer 5⬘CCACACCTATGGTGTATG3⬘.

Statistical Analyses Statistical analyses were performed using a 2-tailed t test. A P value ⱕ0.05 was considered significant.

Results Assessment of Infections by Serologic Analyses None of the control mice, intragastrically inoculated with peptone trypsin broth without Helicobacter, were seropositive for Helicobacter at the time of death. In both H. pylori SS1- and H. felis CS1-inoculated mice, the H. pylori or H. felis antigen-specific antibody responses rapidly increased for the first 3 months after infection and remained stable thereafter (Figure 1). Agreement of 86% was found with the infection status analyzed by Warthin–Starry staining (Figure 2). Inflammatory Response Induced by H. pylori Infections Macroscopically (not shown), the stomachs from uninfected mice had a smooth and regular appearance. In

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

1411

accordance with previous reports,21 all H. felis–infected stomachs showed giant folds with a thickened and irregular mucosa, suggesting hyperplastic glandular lesions consistent with chronic gastritis. Smaller folds were visible in H. pylori–infected stomachs. Histologic analyses showed abnormal architecture of the gastric mucosa (Figure 2). The gastric pits and glands were approximately twice as long (600 – 800 ␮m) as those in uninfected age-matched controls (mean, 300 ␮m) with cystic dilation of the gastric mucosa and inflammatory lesions. Discrete erosions, edema, small foci of hemorrhagic necrosis, polymorphonuclear leukocytes in pits and glands, and glandular hyperplastic/cystic lesions were the main histologic features interpreted as severe and active gastritis in animals infected with H. pylori 6 months (Figure 2C–E2) and 12 months (Figure 2F–H2) after inoculation, respectively. These changes were associated with increased numbers of periodic acid–Schiff—positive cells 6 and 12 months after infection (Figure 2D and G). These lesions were scored as grade 1 moderate metaplasia. The grading of inflammation according to Eaton et al.36 is reported in Figure 3. In mice infected with H. pylori at 6 months (Figure 2C–E2), inflammatory infiltrates in the antrum were composed mainly of lymphocytes, macrophages, and predominantly polymorphonuclear cells, especially in the glandular lumen of the mucosa (Figure 2E2) and also within the submucosa. Polymorphonuclear cells were observed in the glands after 12 months of infection (Figure 2H2). Lymphocytes and plasmocytes combined with lymphoid follicle formation were seen in gastric samples from H. pylori– (Figure 2C and F ) and H. felis–infected mice (Figure 2I and J [arrow]) but never in those from uninfected mice (Figure 2A). Inflammation of the submucosa was more acute at 6 months after infection than at 12 months, especially in H. pylori–infected mice (Figure 3). Hyperplasia was observed from 6 months in H. felis–infected samples (2 of 7 mice) and in more than 50% of mice for both types of infection after 12 months. Lesions consistent with severe dysplasia and/or carcinoma were not seen (even after 12 months). iNOS Expression Related to the Inflammatory Response Generation of NO䡠 by iNOS is an important component of the inflammatory host response to infection.11 Induction of iNOS expression has been previously reported in H. pylori–induced gastritis in humans.12,13 Using immunohistochemistry, we detected an induction of iNOS production in macrophages and monocytes of the submucosa infiltrates and of the lamina propria; there was intense cytoplasmic labeling in both H. pylori– and

1412

TOUATI ET AL.

GASTROENTEROLOGY Vol. 124, No. 5

Figure 2. Lesions of the antral mucosa of (C–H2) H. pylori– and (I–K2) H. felis–infected mice compared with (A and B) uninfected mice. In contrast to the normal glandular architecture of uninfected tissues (A and B; original magnification 100⫻), the gastric glands infected by H. pylori for (C and D) 6 and (F and G) 12 months and H. felis for (I ) 6 and ( J) 12 months are hyperplastic. Inflammatory infiltrates are seen by H&E staining in both (C and F ) H. pylori– and (I and J) H. felis–infected samples, in the lamina propria and within the submucosa, as indicated by the arrows (bar ⫽ 150 ␮m). Polymorphonuclear cells are visible (E2) around and (H2 and I [inset]) inside the glands, as indicated by the arrowheads (bar ⫽ 37.5 ␮m). Note the large aggregates of lymphocytes (arrows in J and inset) and polymorphonuclear cells (arrowhead in J and inset) seen after 12 months of H. felis infection. These changes are accompanied by (D and G) an increase in the number of mucus-producing cells (periodic acid–Schiff stain indicated by the arrows) compared with (B) control (bar ⫽ 150 ␮m). The Warthin–Starry stains of (E1 and H1) H. pylori– and (K1 and K2) H. felis–infected samples show the presence of bacteria inside the glands at (E1 and K1) 6 and (H1 and K2) 12 months after infection as indicated by the arrows (bar ⫽15 ␮m).

May 2003

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

1413

Figure 3. Inflammation grading in long-term H. pylori– (gray symbols) and H. felis– (hatched symbols) infected and uninfected mice (open symbols) after (A) 6 months and (B) 12 months. The intensity of the lesions was evaluated semiquantitatively.36 Infiltrates of polymorphonuclear cells (PMN) and plasmocytes were graded as follows: 0, no infiltrates; 1, mild, multifocal infiltration; 2, mild, widespread infiltration; 3, mild, widespread, and moderate multifocal infiltration; 4, moderate, widespread infiltration; 5, moderate, widespread, and severe multifocal infiltration. Lymphoid aggregates were graded as 1 (mild, 1–10 glands), 2 (moderate, 10 –20 glands), or 3 (severe, more than 20 glands). Each symbol corresponds to one mouse. The horizontal bars represent the mean scores, of which the values are reported in parentheses. No significant differences for PMN infiltrates, plasmocyte infiltrates, and lymphocyte aggregates were observed between H. pylori and H. felis time-matched infected mice (P ⬎ 0.05). Circles, antrum; squares, corpus.

H. felis–infected gastric samples (Figure 4B and C). In H. felis–infected samples, a few epithelial cells also scored positive for iNOS (Figure 4C). RT-PCR analysis was used to detect iNOS mRNA. and sequence analyses of the PCR products were used for confirmation. Under low-salt diet conditions, after 6 months, H. pylori (P ⬍ 0.01) and H. felis (P ⬍ 0.02) infections were associated with a 5-fold greater abundance of iNOS mRNA than that found in the noninfected controls (Figure 5). After 12 months, the amount of iNOS mRNA was much lower than observed after 6 months and indeed was close to the background (Figure 5). High Gastric Mutant Frequency in H. pylori– Infected Mice The mean number of ␭ phage plaques screened for the detection of cII mutations in the transgenic vector was between 2 ⫻ 105 and 5 ⫻ 105 per mouse, with 2 ⫻ 105 the minimum required for this assay.28 Mutant frequencies in

the stomachs after 6 and 12 months of H. pylori SS1 and H. felis CS1 infection are reported in Figure 6. The mean frequency calculated for the stomach of noninfected mice at 6 months was 10.8 ⫻ 10⫺5, for H. pylori–infected mice was 49 ⫻ 10⫺5, and for H. felis–infected mice was 18.4 ⫻ 10⫺5, a 4.5-fold (P ⬍ 0.01) and 1.7-fold (P ⫽ 0.05) increase, respectively, compared with controls. After 12 months, the mean frequency of gastric mutation in the control group was one half that at 6 months (P ⬍ 0.001); those for H. pylori– and H. felis–infected samples were 1.6-fold (P ⬍ 0.01) and 1.8-fold (P ⬍ 0.01) higher than the control value, respectively. The frequency of mutation associated with H. pylori SS1 infection was higher than that associated with H. felis CS1 infection. We thus decided to further characterize the mutations in the H. pylori Big Blue mouse model. Mutation Spectra Induced in the cII Gene From H. pylori–Infected Stomachs DNA was isolated from stomachs of H. pylori– infected and control uninfected mice killed at 6 and 12

1414

TOUATI ET AL.

GASTROENTEROLOGY Vol. 124, No. 5

Figure 4. iNOS immunohistochemistry in gastric tissue sections of (A) noninfected, (B) H. felis CS1–, and (C) H. pylori SS1–infected samples at 6 months. Strong immunoreactivity for iNOS can be observed limited to the inflammatory cell infiltrate in the mucosa and deep mucosa in all infected samples. Note that there is weak iNOS immunoreactivity in epithelial cells in the case of H. felis infection (B). Uninfected samples were either negative or, when positive, only a very small number of iNOS-producing cells were detected in the lamina propria.

months. The mutations in the cII transgene were characterized and compared. Thirty-five cII mutants from 6-month control samples were sequenced; 72% were base substitutions, and 28% were single frameshifts. Consistent with previous reports,42 the most frequent event was a GC 3 AT transition (Figure 7A), occurring in 94% of the cases at 5⬘CpG3⬘ sites. The largest class of frame-

shifts was single residue deletion (16% of the total) or insertion (10% of the total) of (G:C) base pairs, all mapping in a 6G run (nucleotides 179 –185 of the cII gene), already identified as a hot-spot site for frameshift mutations.43 Forty-nine cII mutants (7 per mouse) were isolated from the stomachs of H. pylori–infected mice at 6 months

Figure 5. RT-PCR analysis of iNOS mRNA in stomach mucosa from Big Blue mice. (A) Representative gel of iNOS and ␤-actin expression in samples from uninfected, H. pylori SS1–, and H. felis CS1–infected mice after 6 and 12 months. (B) Histograms corresponding to the quantification of the relative expression of iNOS vs. ␤-actin after 6 and 12 months. P values are indicated for significant differences between infected and uninfected samples. Each column represents the mean ⫾ SD for one group of mice (n ⫽ 6 or 7) for each tested condition. Each experiment was performed 3 times.

May 2003

Figure 6. Gastric mutant frequencies measured using the Big Blue assay protocol29,31 in the stomach of age-matched uninfected and H. pylori– or H. felis–infected mice on the standard diet (open circles) and on the high-salt diet (closed circles) after 6 and 12 months. Each point corresponds to one mouse. Reported values are the mean gastric mutant frequency (⫻ 10⫺5) for each group of mice. The positive control for the mutagenesis assay was Big Blue mice treated with the reference mutagen, R7000 (see Materials and Methods); the gastric mutant frequency 3 weeks after treatment was 30 ⫾ 11 ⫻ 10⫺5, and that for the corresponding untreated mice was 6.7 ⫾ 2 ⫻ 10⫺5.

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

1415

and sequenced. Most were base pair substitutions (71% of the total events) and 29% were single frameshifts, with a distribution similar to that observed with noninfected samples; deletions and additions of a single (G:C) base pair represented 20% and 9% of the total events, respectively. However, the distribution of substitutions was different than that of the spontaneous mutations (Figure 7B). AT 3 CG transversions predominated (28% of the substitutions); they were almost 10 times more frequent than in noninfected samples. AT 3 TA and GC 3 TA transversions were also induced by infection but to a lesser extent (22% and 19% of the substitutions compared with 7% and 11% in the spontaneous spectrum, respectively). Like the spontaneous mutants, all of the GC 3 AT transitions occurred at CpG sites and were 3 times less frequent. Seventy-six and 48 cII mutants from uninfected and H. pylori–infected stomachs at 12 months, respectively, were sequenced. Both spectra were similar to that observed for the spontaneous mutation spectrum at 6 months, except that they both showed a 2.5-fold higher GC 3 TA transversion rate (Figure 7C and D).

Figure 7. Distribution of the base pair substitution events in the cII gene as assessed using mutants isolated from the genomic gastric DNA from (A and C) uninfected and (B and D) H. pylori–infected mice after (A and B) 6 months and (C and D) 12 months. The number of each type of base pair substitution is expressed as a percentage of all substitution events observed.

1416

TOUATI ET AL.

Role of High-Salt Diet in the Induction of Gastric Mutations in Uninfected and H. pylori– and H. felis–Infected Mice In humans, a high-salt diet is a risk factor for gastric carcinogenesis. We tested the genotoxic role of such a diet and its possible synergistic genotoxic effect when administered to H. pylori– or H. felis–infected mice. Six months of a high-salt diet was without significant mutagenic effect on the gastric mucosa of uninfected mice. In contrast, the gastric mutant frequency was slightly (1.6-fold) but significantly (P ⬍ 0.01) higher after 12 months in the uninfected high-salt diet group than in the control group. In the infected groups, H. pylori infection was associated with genotoxicity at 6 months but not at 12 months and the high-salt diet had no observable effect (Figure 6).

Discussion DNA-adduct formation and the resulting genetic changes are key events in carcinogenesis. We investigated whether H. pylori infection, which stimulates host immune responses and causes inflammation, also has genotoxic effects, including DNA damage and mutation events. Any such direct mutagenic effect would explain the association between this bacterial infection and gastric carcinogenesis. Using Big Blue mice, we defined experimental conditions for measuring the mutagenic effect of Helicobacter infections. We showed a mutagenic effect, that it was more easily detected at 6 months of infection than at 12 months, and that it was more pronounced with H. pylori (strain SS1) than with H. felis (strain CS1) infection. This model thus seems to be useful for testing the potential of independent bacterial, environmental, and host factors to promote mutagenic events and thus the genesis of precancerous lesions during infection. The Big Blue mouse system has been widely used to measure the genotoxicity of chemicals. These C57BL/6 mice harbor a transgenic vector with genes of bacterial origin (lacI and lacZ) and genes from phage ␭ (cII), allowing the detection of mutations in any organ.25,26 We used the cII gene as a target gene for the detection of spontaneous or induced mutations. Spontaneous mutations occur in the genome of all tissues and cell types, and their rates depend on the organ, its turnover capacity, and the genetic background of the mouse.34 We found frequencies of spontaneous mutation in the stomach of 6.7 ⫾ 2.0 ⫻ 10⫺5 at 6 weeks, 10.8 ⫾ 2.6 ⫻ 10⫺5 at 6 months, and 5.4 ⫾ 1.0 ⫻ 10⫺5 at 12 months. These values are comparable to those determined previously in the stomach using the lacI gene as a reporter target

GASTROENTEROLOGY Vol. 124, No. 5

gene.33,44 The spontaneous mutation spectrum (Figure 7) was also very similar to that previously observed in the lacI reporter gene.33,41 GC 3 AT transitions, which result from the spontaneous deamination of methylated cytosine in 5⬘CpG3⬘ dinucleotides, leading to C 3 T predominate.42 The frequency of mutation in gastric tissues of mice infected with H. pylori SS1 for 6 months was 49 ⫻ 10⫺5, 4.5 times higher than that in the uninfected group (Figure 6). This mutagenic effect is similar to that measured in Big Blue mice following oral administration of the highly mutagenic compound R700033: a gastric mutant frequency of 30 ⫾ 11 ⫻ 10⫺5 compared with 6.7 ⫾ 2 ⫻ 10⫺5 for untreated mice. Surprisingly, H. felis exhibited a lower mutagenic effect than H. pylori (1.8fold higher than in uninfected mice). This shows the impact of the nature of the bacteria on the induction of mutations in gastric tissues. Even though H. pylori and H. felis are closely related species, they differ in their colonization and virulence properties. H. felis colonizes the gastric glands more deeply than H. pylori but does not adhere to epithelial cells.45 These findings suggest that the Big Blue mouse model will be useful to test derivatives of H. pylori strain SS1 to identify the factors inducing mutations. It could also be used for evaluating and comparing the genotoxicity of independent clinical isolates associated with different clinical outcomes of the infection. Several reports describe the development of gastric mucosal changes in rodents fed a high-salt diet. H. pylori–infected C57BL/6 mice fed a high-salt diet developed hypergastrinemia and preneoplastic gastric lesions 16 weeks after infection, but no significant exacerbation of inflammation was detected among the infected mice receiving salty food.19 In agreement with this report, no significant increases in inflammation scores were observed in uninfected mice receiving the high-salt diet compared with their counterparts fed a normal diet. However, 12 months after inoculation with H. pylori, we observed a significant increase in polymorphonuclear leukocyte infiltration in the antrum of mice fed a salty diet when compared with infected mice fed a normal diet (mean scores of 1.8 and 0.6, respectively; P ⬍ 0.001; data not shown). Both after 6 and 12 months, no synergistic effects of a high-salt diet and Helicobacter infection were observed regarding the gastric mutation frequency (Figure 6). A synergistic interaction between hypergastrinemia and Helicobacter infection, contributing to gastric preneoplastic lesions, has been previously reported in insulin-gastrin transgenic mice.46 If we assume that mutator activity is responsible for the induction of precan-

May 2003

cerous lesions, the present results are in agreement with those observed in the hypergastrinemia model because a procarcinogenic effect of a high-salt diet occurring in the presence of H. pylori infection was less pronounced in this model.47 iNOS, an enzyme responsible for the production of NO䡠, was studied 6 months after inoculation. In both H. pylori– and H. felis–infected mice, iNOS was 5-fold more abundant than in uninfected mice (Figure 5A). By immunohistochemistry analysis, iNOS was primarily detected in the inflammatory cells infiltrating the infected gastric mucosa and submucosa (Figure 4). Both H. pylori and H. felis induced chronic gastritis in the Big Blue transgenic mice. This gastritis was similar to that previously reported in nontransgenic C57BL/6 mice,20,21,23 and it is characterized by infiltration of polymorphonuclear cells and plasmocytes in the mucosa and submucosa (Figures 2 and 3). Increased expression of iNOS has been reported previously in epithelial cells, macrophages, and endothelial cells of gastric biopsy specimens from individuals with H. pylori–associated gastritis.9,48,49 Gastric epithelial cells incubated in vitro with H. pylori extracts release large amounts of free radicals, mainly superoxides (O䡠) and NO䡠.10 These chemical species are mainly produced by activated inflammatory cells and induce oxidative DNA damage.50 NO䡠 causes direct DNA damage and mutations in a variety of experimental systems: NO-producing macrophages51 and spleen of mice bearing NO䡠-producing lymphoma cells.52 In addition, NO䡠 acts as a comutagen effector by inhibiting OH8G base excision DNA repair processes.53,54 H. pylori–induced mutations 6 months after infection included 3 frequent transversion events: GC 3 TA, AT 3 CG, and AT 3 TA (Figure 7B). This spectrum strongly suggests the induction of oxidative DNA damage associated with the host inflammatory response induced by the infection. Indeed, OH8G generated by superoxides and peroxynitrites cause GC 3 TA transversions,55,56 and AT 3 CG transversions have been described as a result of misincorporation of OH8deoxyguanosine triphosphate opposite adenine during replication.57 MTHI homozygous mutant mice deficient for the OH8deoxyguanosine triphosphatase activity that specifically degrades OH8deoxyguanosine triphosphate to OH8deoxyguanosine monophosphate develop more tumors in the lung, liver, and stomach than wild-type mice.58 Thus, the induction of iNOS in infected mice after 6 months might be responsible for a large production of NO䡠 and consequently an increased rate of mutation due to oxidative DNA damage. After 12 months of infection, the frequency of gastric mutations was lower compared with 6 months (Figure 6B) and no

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

1417

iNOS was detected; furthermore, the spectrum of mutations was indistinguishable from that of the uninfected samples (Figure 7C and D). It is tempting to conclude that NO䡠 plays a role in the mutagenic effect induced by H. pylori 6 months after infection. However, because iNOS expression was similar in H. pylori– and H. felis– infected samples, it strongly indicates that NO䡠 is not the only effector in H. pylori–mediated genotoxicity. The decrease of the mutant frequency after 12 months compared with 6 months for both H. pylori and H. felis infections and for both high-salt and standard diet was unexpected. The gastric mutant frequencies for H. pylori– and H. felis–infected mice were 1.6 and 1.8 times higher, respectively, than control values at 12 months (Figure 6). The differences are significant, because a previous extensive study of Big Blue mouse assays indicated that a 1.5-fold higher than control frequency of mutation is a significant positive result.30 Nevertheless, the findings at 12 months suggest compensatory mechanisms. The gastric epithelial tract is characterized by high epithelial cell turnover, with cell division exactly balancing cell death. Induction of apoptosis compensated by higher cell proliferation has been reported in H. pylori–infected gastric mucosa at the chronic gastritis stage.59 After long-term infection in mice (12 months), the inflammatory infiltrates were mainly composed of plasmocytes (Figure 3) and chronic gastritis lesions were observed associated with metaplastic changes. The findings at 12 months were possibly due to an increase in gastric epithelial cell proliferation or a change in the balance between apoptosis and cell proliferative activity of gastric tissues, which is believed to orchestrate the outcome of the Helicobacter– associated diseases.60 Concomitantly, iNOS expression was undetectable by RT-PCR analysis (Figure 5B). It has recently been reported that a mutant strain of H. pylori lacking urease failed to induce iNOS mRNA expression and NO䡠 production in vitro.61 Thus, iNOS might be induced via a response involving multiple pathways of activation. If bacterial factors such as urease are lower after long-term infection (12 months), this might account for a decrease in iNOS expression. In conclusion, we show that Helicobacter infection has a genotoxic effect on the gastric mucosa that can be detected 6 months after inoculation. This mutagenic effect is probably the consequence of oxidative DNA damage involving the host inflammatory response. Using the Big Blue system, we evidenced mutations in foreign reporter genes on the transgenic vector. H. pylori infection presumably causes mutations throughout the genome, including in genes that are required to maintain genetic stability. Thus, H. pylori infection might lead to geno-

1418

TOUATI ET AL.

toxic events promoting initiation of precancerous lesions. Many genes can, if mutated, induce a mutator phenotype associated with initiation of human cancer. The best known example is the tumor suppressor gene p53, which is mutated in numerous tumors, including gastric carcinoma.62 Thus, the Big Blue mouse model appears to be a powerful tool for quantifying the mutagenic effects associated with H. pylori infections.

References 1. Correa P. Is gastric carcinoma an infectious disease? N Engl J Med 1991;325:1170 –1171. 2. EUROGAST Study Group. An international association between Helicobacter pylori and risk of gastric cancer. Lancet 1993;341: 1359 –1362. 3. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans Infection with Helicobacter pylori. ARC monographs on the evaluation of carcinogenic risks to humans. Schistosomes, liver flukes and Helicobacter pylori. Volume 61. Lyon, France: International Agency for Research on Cancer, 1994:177–240. 4. Parsonnet J, Friedman G, Vandersteen D, Chang Y, Vogelman J, Orentreich N, Sibley R. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 1991;325:1127–1131. 5. Parsonnet J, Hansen S, Rodriguez L. Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994;330:1267–1271. 6. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper R. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 2001;345:784 –789. 7. Correa P. Human gastric carcinogenesis: a multistep and multifactorial process. First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res 1992;52: 6735– 6740. 8. Asaka M, Sepulveda A, Sugiyama T, Graham D. Gastric cancer, In: Mobley H, Mendz G, Hazell S, eds. Helicobacter pylori: physiology and genetics. Washington, DC: ASM, 2001:481– 498. 9. Farinati F, Cardin R, Degan P, Rugge M, Di Mario F, Bonvicini P, Naccarato R. Oxidative DNA damage accumulation in gastric carcinogenesis. Gut 1998;42:351–356. 10. Obst B, Wagner S, Sewing K, Beil W. Helicobacter pylori causes DNA damage in gastric epithelial cells. Carcinogenesis 2000;21: 1111–1115. 11. Jaiswal M, Larusso N, Gores G. Nitric oxide in gastrointestinal epithelial cell carcinogenesis: linking inflammation to oncogenesis. Am J Physiol 2001;281:G626 –G634. 12. Mannick E, Bravo L, Zarama G, Realpe J, Zhang X, Ruiz B, Fontham E, Mera R, Miller M, Correa P. Inducible nitric oxide synthase, nitrotyrosine, and apoptosis in Helicobacter pylori gastritis: effect of antibiotics and antioxidants. Cancer Res 1996; 567:3238 –3243. 13. Pignatelli B, Bancel B, Este`ve J, Malaveille C, Calmels S, Correa P, Patricot L, Laval M, Lyandrat N, Oshima H. Inducible nitric oxide synthase, antioxydant enzymes and Helicobacter pylori infection in gastritis and gastric precancerous lesions in humans. Eur J Cancer Prev 1998;7:439 – 447. 14. El-Omar EM, Carrington M, Chow W-H, McColl KEL, Bream JH, Young HA, Herrera J, Lssowska J, Yuan CC, Rothman N, Lanyon G, Martin M, Fraumeni JF Jr, Rabkin CS. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature 2000;404:398 – 402. 15. Machado JC, Pharoah P, Sousa S, Carvalho R, Oliveiras C, Figueiredo C, Amorim A, Seruca R, Caldas C, Carneiro F, Sobrinho-Simoes M. Interleukin 1␤ and interleukin 1RN polymor-

GASTROENTEROLOGY Vol. 124, No. 5

16. 17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

phisms are associated with increased risk of gastric carcinoma. Gastroenterology 2001;121:823– 829. Tuyns A. Salt and gastrointestinal cancer. Nutr Cancer 1988;11: 229 –232. Tsugane S, Kabuto M, Imai H, Gey F, Tei Y, Hanaoka T, Sugano K, Watanabe S. Helicobacter pylori, dietary factors, and atrophic gastritis in five Japanese populations with different gastric cancer mortality. Cancer Causes Control 1993;4:297–305. Joossens J, Hill M, Elliott P, Stamler R, Stamler J, Lesaffre E, Dyer A, Nichols R, Kesteloot H. Dietary salt, nitrate and stomach cancer mortality in 24 countries. Int J Epidemiol 1996;25:494 – 501. Fox J, Dangler C, Taylor N, King A, Koth T, Wang T. High-salt diet induces gastric epithelial hyperplasia and parietal cell loss, and enhances Helicobacter pylori colonization in C57BL/6 mice. Cancer Res 1999;59:4823– 4828. Fox J, Li X, Cahill R, Andrutis K, Rustgi A, Odze R, Wang T. Hypertrophic gastropathy in Helicobacter felis–infected wild-type C57BL/6 mice and p53 hemizygous transgenic mice. Gastroenterology 1996;110:155–166. Ferrero R, Ave´ P, Radcliff F, Labigne A, Huerre M. Outbred mice with long-term Helicobacter felis infection develop both gastric lymphoid tissue and glandular hyperplastic lesions. J Pathol 2000;191:333–340. Fox JG, Sheppard BJ, Dangler CA, Whary MT, Ihrig M, Wang TC. Germ-line p53-targeted disruption inhibits Helicobacter-induced premalignant lesions and invasive gastric carcinoma through down-regulation of Th1 proinflammatory responses. Cancer Res 2002;62:696 –702. Lee A, O’Rourke J, Ungria M, Robertson D, Daskalopoulos G, Dixon M. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 1997; 112:1386 –1397. Ferrero R, Thiberge JM, Huerre M, Labigne A. Immune responses to specific-pathogen-free mice to chronic Helicobacter pylori (strain SS1) infection. Infect Immun 1998;66:1349 –1355. Hirayama F, Takagi S, Kusuhara S, Iwao E, Yokoyama Y, Ikeda Y. Induction of gastric ulcer and intestinal metaplasia in Mongolian gerbils infected with Helicobacter pylori. J Gastroenterol 1996; 31:755–757. Watanabe T, Tada M, Nagai H, Sasaki S, Nakao M. Helicobacter pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology 1998;115:642– 648. Ogara K, Maeda S, Nakao M, Watanabe T, Tada M, Kyutoku T, Yoshida H, Shiratori Y, Omata M. Virulence factors of Helicobacter pylori responsible for gastric diseases in Mongolian gerbil. J Exp Med 2000;192:1601–1609. Kohler S, Provost G, Kretz P, Fieck A, Short J. An in vivo assay using transgenic mice to analyse spontaneous and induced mutations at the nucleic acid level. Strat Mol Biol 1990;3:19 –21. Kohler S, Provost G, Fieck A, Kretz P, Bullock W, Sorge J, Putman D. Spectra of spontaneous and mutagen-induced mutations in the lacI gene in transgenic mice. Proc Natl Acad Sci U S A 1991;88:7958 –7952. Schmezer P, Eckert C. Induction of mutations in transgenic animal models: Big Blue and Muta mouse. In: McGregor DB, Rice JM, Venitt S, eds. The use of short and medium term tests for carcinogenesis and data on genetic effects in carcinogenic hazard evaluation. Volume 146. IARC Scientific Publication. Lyon, France: World Health Organization, 1993:362–394. Jakubczak J, Merlino G, French J, Muller W, Paul W, Adhya S. Analysis of genetic instability during mammary tumor progression using a novel selection-based assay for in vivo mutation in a bacteriophage ␭ transgenic target. Proc Natl Acad Sci U S A 1996;93:9073–9078. Lee A, Fox J, Otto G, Murphy J. A small animal model of human

May 2003

33.

34.

35. 36. 37. 38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

Helicobacter pylori active chronic gastritis. Gastroenterology 1990;99:1315–1323. Quillardet P, Michel V, Arrault X, Hofnung M, Touati E. Mutagenic properties of a nitrofuran, 7-methoxy-2-nitronaphtho[2,1-b]furan (R7000), in lacI transgenic mice. Mutat Res 2000;470:177– 188. Heddle J, Shaver-Walker P, Tao K, Zhang X. Treatment protocols for transgenic mutation assays in vitro. Mutagenesis 1995;10: 467– 470. Prophet EB, Mills B, Arrington JB, Sobin LH, eds. Laboratory methods in histotechnology. Washington, DC: AFIP, 1992. Eaton KA, Radin MJ, Krakowa S. An animal model of gastric ulcer due to bacterial gastritis in mice. Vet Pathol 1995;32:489 – 497. Rosai J. Stomach. In: Rosai J, ed. Ackerman’s surgical pathology. 8th ed. St. Louis, MO: Mosby, 1996:616 – 666. Fenoglio-Preiser C. The non-neoplastic stomach, In: Noffsinger A, Stemmermann G, Lantz P, Listrom M, Rilke F, eds. Gastrointestinal pathology: an atlas and text. 2nd ed. Philadelphia: Lippincott-Raven, 1999:153–274. Lowenstein C, Glatt C, Bredt D, Snyder S. Cloned and expressed macrophage nitric oxide synthase contrasts with the brain enzyme. Proc Natl Acad Sci U S A 1992;89:6711– 6715. Zimmer D, Harbach P, Mattes W, Aaron C. Effects of plating medium and phage storage on mutant frequency and titer in the lambda cII transgenic mutation assay. Environ Mol Mutagen 1998;32:325–330. Arrault X, Michel V, Quillardet P, Hofnung M, Touati E. Comparison of kinetics of induction of DNA adducts and gene mutations by a nitrofuran compound, the 7-methoxy-2-nitronaphtho[2,1b]furan (R7000), in the caecum and the small intestine of the Big Blue mice. Mutagenesis 2002;17:353–359. De Boer J, Provost S, Gorelick N, Tindall K, Glickman B. Spontaneous mutation in lacI transgenic mice: a comparison of tissues. Mutagenesis 1998;13:109 –114. Harbach P, Zimmer D, Filipunas A, Mattes W, Aaron C. Spontaneous mutation spectrum at the lambda cII locus in liver, lung, and spleen tissue of Big Blue transgenic mice. Environ Mol Mutagen 1999;33:132–143. Touati E, Hofnung M, Thiberge JM, Michel V, Labigne A, Jenks P. Short-term infection with Helicobacter pylori and 1 week exposure to metronidazole does not enhance gastric mutation frequency in transgenic mice. J Antimicrob Chemother 2000;46:987–992. Lee A, Hazell S, O’Rourke J, Kouprach S. Isolation of a spiralshaped bacterium from the cat stomach. Infect Immun 1988;56: 2843–2850. Wang TC, Dangler CA, Chen D, Goldenring JR, Koh T, Raychowdhury R, Coffey RJ, Ito S, Varro A, Dockray GJ, Fox JG. Synergistic interaction between hypergastrinemia and Helicobacter infection in a mouse model of gastric cancer. Gastroenterology 2000;118:36 – 47. Fox JG, Rogers AB, Ihrig M, Taylor NS, Whary MT, Wang TC. Helicobacter pylori associated gastric cancer in INS-GAS mice is gender specific (abstr). Gut 2002;51:A47. Fu S, Ramanujam K, Wong A, Fantry G, Drachenberg C, Meltzer S, Wilson T. Increased expression and cellular localization of induc-

H. PYLORI INDUCES GASTRIC MUTATIONS IN MICE

49.

50. 51.

52.

53.

54.

55.

56.

57.

58. 59.

60.

61.

62.

1419

ible nitric oxide synthase and cyclooxygenease 2 in Helicobacter gastritis. Gastroenterology 1999;116:1319 –1329. Davies G, Banatvala N, Collins C, Sheaff M, Abdi Y, Clements L, Rampton D. Relationship between infective load of Helicobacter pylori and reactive oxygen metabolite production in antral mucosa. Scand J Gastroenterol 1994;29:419 – 424. Demple B, Harrison L. Repair of oxidative damage to DNA: enzymology and biology. Annu Rev Biochem 1994;63:915–948. Zhuang J, Lin C, Lin D, Wogan G. Mutagenesis associated with nitric oxide production in macrophages. Proc Natl Acad Sci U S A 1998;95:8286 – 8291. Gal A, Wogan G. Mutagenesis associated with nitric oxide production in transgenic SJL mice. Proc Natl Acad Sci U S A 1999; 93:15102–15107. Jaiswal M, Larusso N, Burgart L, Gores L. Inflammatory cytokines induce DNA damage and inhibit DNA repair in cholangiocarcinoma cells by a nitric oxide-dependent mechanism. Cancer Res 2000;60:184 –190. Jaiswal M, Larusso N, Shapiro R, Billiar T, Gores G. Nitric oxide mediated inhibition of DNA repair potentiates oxidative DNA damage in cholangiocytes. Gastroenterology 2001;120:190 –199. Costa de Oliveira R, Ribeiro D, Nigro R, Di Mascio P, Menck C. Singlet oxygen induced mutation spectrum in mammalian cells. Nucleic Acids Res 1992;20:4319 – 4323. Yermilov V, Rubio J, Oshima H. Formation of 8-nitroguanine in DNA treated with peroxynitrite in vitro and its rapid removal from DNA by depurination. FEBS Lett 1995;376:207–210. Cheng K, Cahill D, Kasai H, Nishimura S, Loeb L. 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G 3 T and A 3 C substitutions. J Biol Chem 1992;267:166 –172. Tsuzuki T, Egashira A, Kura S. Analysis of MTHI gene function in mice with targeted mutagenesis. Mutat Res 2001;477:71–78. Wagner S, Beil W. Helicobacter pylori induced apoptosis, In: Achtman M, Suerbaum S, eds. Helicobacter pylori: molecular and cellular biology. Norfolk, United Kingdom: Horizon Scientific, 2001:99 –111. Scotiniotis I, Rokkas T, Furth E, Rigas B, Shiff S. Altered gastric epithelial cell kinetics in Helicobacter pylori-associated intestinal metaplasia: implications for gastric carcinogenesis. Int J Cancer 2000;85:192–200. Gobert AP, Mersey BD, Cheng Y, Blumberg DR, Newton JC, Wilson KT. Cutting edge: urease release by Helicobacter pylori stimulates macrophage inducible nitric oxide synthase. J Immunol 2002;168:6002– 6006. Shiao Y, Rugge M, Correa P, Lehman H, Scheer W. P53 alteration in gastric precancerous lesions. Am J Pathol 1994;144:511– 517.

Received September 26, 2002. Accepted February 6, 2003. Address requests for reprints to: Eliette Touati, M.D., Unite ´ de Programmation Mole ´culaire et de Toxicologie Ge ´ne ´tique, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. e-mail: [email protected]; fax: (33) 1 45 68 88 34. Supported by the Institut Pasteur (Paris) as a Transversal Research Program (PTR). This report is dedicated to the memory of Prof. Maurice Hofnung.