Chrysotobibenzyl inhibition of lung cancer cell migration through Caveolin-1-dependent mediation of the integrin switch and the sensitization of lung cancer cells to cisplatin-mediated apoptosis

Phytomedicine 58 (2019) 152888

Contents lists available at ScienceDirect

Phytomedicine journal homepage: www.elsevier.com/locate/phymed

Original Article

Chrysotobibenzyl inhibition of lung cancer cell migration through Caveolin1-dependent mediation of the integrin switch and the sensitization of lung cancer cells to cisplatin-mediated apoptosis

T

Nalinrat Petpiroona,e, Narumol Bhummaphanb,e, Sucharat Tungsukruthaic,e, ⁎ Tatchakorn Pinkhiend,e, Arnatchai Maiutheda,e, Boonchoo Sritularakf, Pithi Chanvorachotea,e, a

Department of Pharmacology and Physiology, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand Interdisciplinary Program of Biomedical Sciences, Faculty of Graduate School, Chulalongkorn University, Bangkok 10330, Thailand Interdisciplinary Program of Pharmacology Graduate School, Chulalongkorn University, Bangkok 10330, Thailand d Pharmacuetical Technology (International) Program, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand e Cell-Based Drug and Health Product Development Research Unit, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand f Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand b c

ARTICLE INFO

ABSTRACT

Keywords: Chrysotobibenzyl Metastasis Integrin Caveolin-1 Lung cancer

Background: A Lung cancer death account for approximately 1 in 5 of all cancer-related deaths and is particularly virulent due to its enhanced metastasis and resistance to chemotherapy. Chrysotobibenzyl has been reported to decrease cell metastasis, according to the results of an anchorage-independent growth assay; however, its underlying mechanism has not been investigated yet. Purpose: The aim of this study was to investigate the effect of chrysotobibenzyl on lung cancer cell migration and drug sensitization and its mechanism. Methods: Cell viability, cell proliferation and drug sensitization were determined by MTT assay. Cell migration was analyzed using a wound-healing assay. Transwell migration and invasion were analyzed using Boyden chamber assay. Mechanisms of chrysotobibenzyl against metastasis including cell migration, invasion, and epithelial to mesenchymal transition (EMT) were evaluated by Western blot analysis and immunofluorescence. Results: Treatment with chrysotobibenzyl was applied at concentrations of 0–50 µM and the results showed noncytotoxicity in human lung cancer cells (H460, H292, A549, and H23) and other non-cancerous human cells (HCT116, primary DP1 and primary DP2). However, 50 µM of chrysotobibenzyl significantly altered cell proliferation in H292 cells at 48 h. In addition, 1–50 µM of chrysotobibenzyl significantly inhibited H460 and H292 cell migration, invasion, filopodia formation, and decreased EMT in a dose-dependent manner at 48 h, which were correlated with reduced protein levels of integrins β1, β3, and αν, p-FAK, p-AKT, Cdc42, and Cav-1. We also established shRNA-Cav-1-transfected (shCav-1) H460 and H292 cells. shCav-1 transfected cells can decrease cell migration and downregulate the expression of integrins β1, β3, and αν when compared with the control. Moreover, chrysotobibenzyl was shown to suppress EMT indicated by the reduction of EMT markers (Vimentin, Snail, and Slug), and sensitize lung cancer cells to cisplatin-mediated apoptosis. Conclusion: Treatment with chrysotobibenzyl inhibited lung cancer cell migration via Cav-1, integrins β1, β3, and αν, and EMT suppressions. The downregulation of integrins in response to the compound not only inhibited cell metastasis, but also sensitized lung cancer cells to cisplatin-mediated apoptosis.

Abbreviations: AKT, ATP-dependent tyrosine kinase; BCA, bicinchoninic acid; BSA, bovine serum albumin; Cav-1, Caveolin-1; DMSO, dimethyl sulfoxide; DNA, deoxyribonucleic acid; DP, dermal papilla cells; ECM, extracellular matrix; EDTA, ethylenediaminetetraacetic acid; EGF, epidermal growth factor; EGTA, ethylene glycol tetraacetic acid; EMT, epithelial-mesenchymal transition; FAK, focal adhesion kinase; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; MTT, 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide; NMR, Nuclear magnetic resonance; PARP, poly (ADP-ribose) polymerase; PI, propidium iodide; RPMI, Roswell Park Memorial Institute, DMEM, Dulbecco's modified eagle's medium; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TBST, trisbuffer saline with 0.1% tween ⁎ Corresponding author at: Department of Pharmacology and Physiology, Faculty of Pharmaceutical Sciences, and Cell-based Drug and Health Product Development Research Unit, Chulalongkorn University, Bangkok 10330, Thailand. E-mail address: [email protected] (P. Chanvorachote). https://doi.org/10.1016/j.phymed.2019.152888 Received 1 October 2018; Received in revised form 28 February 2019; Accepted 9 March 2019 0944-7113/ © 2019 Elsevier GmbH. All rights reserved.

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Introduction

metastasis compounds. For instance, bibenzyl 4,5,4′-trihydroxy-3,3′dimethoxybibenzyl, isolated from Dendrobium ellipsophyllum, was previously shown to inhibit EMT and to sensitize the anoikis response (Chaotham et al., 2014). Likewise, Gigantol, a pure compound from Dendrobium draconis, as well as chrysotoxine, crepidatin, and Moscatilin from Dendrobium pulchellum have been shown to possess anti-metastasis activities in lung cancer cells (Chanvorachote et al., 2013; Charoenrungruang et al., 2014). Chrysotobibenzyl, extracted from Dendrobium pulchellum has been shown to inhibit the growth of lung cancer cells in anchorage-independent condition (Chanvorachote et al., 2013). However, the anti-metastasis effect and underlying mechanisms of chrysotobibenzyl have not yet been investigated. The present study demonstrated that chrysotobibenzyl could inhibit H460 and H292 cell migration, as tested using a wound-healing assay, and decrease filopodia formation. The underlying mechanism regulated cell migration via Cav-1-dependent mediation of the integrin switch toward decreasing integrins β1, β3, and αv. Furthermore, chrysotobibenzyl sensitized lung cancer cell death mediated by cisplatin. The scientific information gained from this study may benefit the further development of this compound for anti-cancer therapy.

Lung cancer is the leading cause of cancer-related deaths worldwide, accounting for approximately 1 in 5 of all cancer deaths (Wong et al., 2017). Despite extensive drug discovery, development research, and efforts made toward the improvement of therapeutic strategies, lung cancer is still typified by a poor prognosis. As the mortality rate of lung cancer is dramatically high in metastatic patients and as metastasis is frequently detected at the time of first diagnosis (Redig et al. 2013), therapeutic approaches targeting metastasis are the great interest as they provide a promising way to improve the clinical outcome. At an early stage of metastasis, cancer cells acquire migratory activity, leading to their movement from the primary site and then subsequently entering the circulatory system. Migration in cancer cells is a complex process involving the turnover of cell–extracellular matrix (ECM) adhesion molecules, the creation of new focal adhesions in the front, and the dissociation of old adhesions in the rare part of the cells, which result in the dynamic process of cell movement (Nagano et al., 2012). At the focal adhesion, integrins are key proteins functioning as a receptor for the cells, whereby they interact and transmit the adhesion signals to the cells. Such an integrin engagement not only provides a sense of the appropriate and secure cell–ECM attachment, but also generates cellular signals that result in cell survival, migration, and invasion (Seguin et al., 2015). So far, evidence has found that integrins have 18 α subunits and 8 β subunits that pair to form at least 24 heterodimers. Among these, certain integrins have been shown to be associated with highly aggressive behaviors, such as drug resistance and metastasis in human cancers (Seguin et al., 2015). In highly metastatic cancers, a spontaneous alteration of integrin patterns, known as an integrin switch, has been shown to facilitate metastasis (Seguin et al., 2015). For instance, an augmented level of integrin β1 was shown to cause active proliferation, chemotherapeutic resistance, and the metastasis of cancers (Xu et al., 2017). Likewise, increasing in integrins αv, α5, and β3 have been shown to enhance the migration and metastasis of cancer cells (Ninsontia et al. 2014). In lung cancer, α5 and β1 integrins were demonstrated to control cell invasion and enhance the EGF survival signal (Morozevich et al. 2012). Besides, the increase in α5 and β1 levels was found to correlate with lymph node metastasis and a poor prognosis of lung cancer patients (Adachi et al., 2000). Thus, it is conceivable that the mentioned integrins could promote growth and the metastatic potentials of cancer cells. Taking a mechanistic approach, integrin engagement causes the activation of the pro-survival protein kinase B (AKT), which consequently activates focal adhesion kinase (FAK) by directly mediating phosphorylation at Y397 (Bianconi et al., 2016). The FAK then activates its downstream targets, inducing the Rho family protein and cdc42 to form filopodia to direct the migratory way. Previous study showed that Cav-1 promotes cell migration by regulating integrin expression (Grande-García et al., 2007). Caveolin-1 (Cav-1), a cell membrane component protein at Caveolae, plays a critical role in facilitating lung cancer metastasis (Chanvorachote et al., 2013). In lung cancer cells, Cav-1 was shown to regulate cell motility (Chanvorachote and Chunhacha, 2013) and anoikis resistance (Chunhacha and Chanvorachote, 2012). An increased Cav-1 expression was shown to be linked with tumor progression and metastasis in several cancers including endometrial adenocarcinoma and pancreatic cancer cells (Diaz-Valdivia et al., 2015; Salem et al., 2011). Besides, the expression of Cav-1 in metastatic lung cancer predicted a worse outcome and radioresistance, while a low expression of such a protein has been correlated with the overall survival of patients (Zhan et al., 2012), thus, proposing Cav-1 as a potential therapeutic target. It has been long known that plants are the best source of bioactive compounds for drug discovery (Chanvorachote et al., 2016). In the search for potential compounds for anti-metastasis approaches, Dendrobium orchids have been rationalized to be a good source of anti-

Materials and methods Chrysotobibenzyl preparation Chrysotobibenzyl was isolated from stem of D. pulchellum as previous described (Chanvorachote et al., 2013). Briefly, dried powder stem (0.5 kg) was extracted with 95% EtOH (3 × 10 l) to gain a viscous mass (50 g), then subjected to vacuum liquid chromatography (VLC) on silica gel (n-hexane-EtOAc gradient and MeOH) to give 7 fractions (A–G). Chrysotobibenzyl (54 mg) was obtained from fractions D (1.8 g). The purity of chrysotobibenzyl was verified by using NMR spectroscopy. Chrysotobibenzyl with more than 95% purity has been used in this study. Structure of chrysotobibenzyl shown as Fig. 1, chrysotobibenzyl was dissolved in DMSO (Sigma Chemical, St. Louis, MO, USA). The stock sample was diluted with media to achieve the desired concentrations, containing less than 0.1% DMSO at final dilution. Cell culture Human non-small lung cancer cell lines, H460, H292, H23, A549 and colorectal cancer HCT116 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). Human dermal papilla primary cell culture (primary DP1) was purchased from Celprogen Inc. (Celprogen Inc., CA, USA). Human primary hair follicle dermal papilla cells (primary DP2) were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada). H460, H292, H23 and HCT116 were cultured in Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Grand Island, NY, USA) whereas A549, primary DP1 and primary DP2 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Gibco, Grand Island, NY, USA). The medium was supplemented with 10% fetal bovine serum (FBS) (Merck, DA, Germany), 100 units/ml penicillin/ streptomycin (Gibco, Grand Island, NY, USA) and 2 mM L-glutamine (Gibco, Grand Island, NY, USA), the cells were incubated in a 5% CO2 environment at 37°C. Cell viability assay and cell proliferation assay Cell viability and cell proliferation were examined using MTT assay. Cells (1 × 104 cells/well for cell viability and 2 × 103 cells/well for cell proliferation) were seeded onto each well of a 96-well plate and incubated overnight for cell attachment. Cells were treated with different concentrations (0–100 µM) of chrysotobibenzyl for 24 h for the cell viability assay and were extended time to 48 h for cell proliferation assay. After treatments, the cells were incubated with 100 µl of MTT solution for 4 h at 37°C. An intensity reading of the MTT product was 2

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 1. Chemical structure of chrysotobibenzyl (A). Cytotoxicity effect of chrysotobibenzyl on human lung cancer cells and other human cells (B). Human lung cancer cells (H460, H292, A549, and H23), colon cancer cells (HCT116), and normal cells (primary DP1 and primary DP2) were treated with chrysotobibenzyl at a series of concentrations (0–100 µM) for 24 h. Percentage of cell viability was investigated using the MTT assay. H292 and H460 cells were treated with chrysotobibemzyl (1–50 µM) for 48 h. Proliferative effect of chrysotobibenzyl on H460 and H292 cells was analyzed by MTT assay (C). Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control.

measured at 570 nm using a microplate reader (Anthos, Durham, NC, USA). The percentage of viable cells was calculated in relation to control cells.

staining assay with Hoechst 33342 (Sigma Chemical, St. Louis, MO, USA) and propidium iodide (PI) (Sigma Chemical, St. Louis, MO, USA). Cells were seeded and treated with various concentrations of chrysotobibenzyl (0 − 100 μM). After treatment, the cells were incubated with 10 μg/ml Hoechst 33342 and 5 μg/ml PI for 30 min. Then, cells were visualized using fluorescence microscopy (Nikon ECLIPSE Ts2, Minatoku, Tokyo, JP). We confirmed results of cell apoptosis with Annexin V-

Apoptosis assay Apoptosis and necrosis cells were analyzed by a fluorescence DNA 3

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

FITC Apoptosis Kit (Thermo Fisher Sciencetific, Waltham, MA, USA). Cells were analyzed by guava easyCyteTM flow cytometer (Merck, DA, Germany).

Plasmid transfection H460 and H292 cells were transfected with designed plasmids by using Gene pulser Xcell™ electroporation system (Bio-Rad Laboratories Inc., CA, USA) according to standard protocol. In brief, cells were subculture as usual and subjected to transfection with 25 µg of the plasmid with cuvette (0.2 cm diameter) using square wave, PL 10 ms, 150 V. After 48 h, the transfected medium was replaced with completed medium and 1 µg/ml puromycin (Gibco, Grand Island, NY, USA) and used for selection of stable transfected cells for 30 days. The cells were cultured in antibiotic-free RPMI 1640 for at least two passages before further study.

Dansylcadaverine staining Autophagy was determined using dansylcadaverine (Sigma Chemical, St. Louis, MO, USA) staining. 5 × 103 cells were cultured in each well of 96-well plate, and treated with chrysotobibenzyl (0–100 µM) for 24 h. After that, cells were fixed in 4% paraformaldehyde and stained with 0.05 mM dansylcadaverine. The images of autophagosome were taken under a fluorescence microscope.

Western blot analysis

Migration and invasion assay

After treatments with chrysotobibenzyl or FAK inhibitor 14 (Cell Signaling, Danvers, MA, USA), cells were incubated with lysis buffer containing 20 mM Tris-HCl (pH 7.5), 1% Triton X-100, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM βglycerophosphate, 1 mM sodium orthovanadate, 50 mM sodium fluoride, 1 μg/ml leupeptin, 100 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Roche Molecular Biochemical) for 30 min on ice. Cellular lysates were collected and determined for protein content using BCA protein assay kit (Pierce Biotechnology, Rockford, IL, USA). Equal amounts of protein from each sample were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After separation, proteins were transferred onto 0.45 μm nitrocellulose membranes (Bio-Rad Laboratories Inc., CA, USA). The blots were blocked for 1 h in 5% non-fat dry milk (Merck, DA, Germany) in TBST (Tris-buffer saline with 0.1% Tween containing 25 mM Tris-HCl (pH 7.5), 125 mM NaCl, and 0.1% Tween 20) and incubated with appropriate primary antibodies including Caspase 3, GAPDH, Cdc42, Integrin αν, α4, α5, β1, β3, PARP, p-FAK, FAK, p-AKT, AKT, Cav-1, Slug, Snail, and Vimentin (Cell Signaling, Danvers, MA, USA) at 4 °C overnight. After washing for three times with TBST, the membrane blots were incubated with HRP-conjugated secondary antibodies (Cell Signaling, Danvers, MA, USA) for 2 h at room temperature. The immune blots were detected by enhanced chemiluminescence (Supersignal West Pico; Pierce, Rockford, IL, USA) and quantified using ImageJ software (NIH, Bethesda, MD, USA).

Cell migration was determined using wound healing assay. 2 × 104 cells were cultured in each well of 96-well plates, and were created wound space by micropipette tip. After that, media was removed and washed with phosphate buffered saline (PBS) (Gibco, Grand Island, NY, USA). The cell monolayers were incubated with non-toxic concentration of chrysotobibenzyl (0–50 µM) and permitted to migrate for 24 h, 48 h. Under a phase contrast microscope, the photos of cell migration were taken and were measured wound space using Image J. The percentage of the changed wound space was calculated as follows: Change in the wound space (%) = (average space at time (0 h–24, 48 h)/ average space at time 0 h) x100. Relative cell migration was calculated by dividing the percentage change in the wound space of treated cells by that of the control cells in each experiment. We confirmed the results with Boyden chamber assay. Cells were seeded at a density of 3 × 104 cells/well in the upper chamber and supplemented with 10 µM and 50 µM of chrysotobibenzyl in serum free medium (8 μm pore size) in 24well plate. Lower chamber was filled with complete medium containing 10% FBS as a chemoattractant. For the invasion assay, upper chamber of the inserts was coated with 50 μl of 0.5% Matrigel (BD Biosciences, San Jose, CA, USA). After 48 h, both of non-migrated and non-invaded cells in upper chamber were removed, and cells that migrated to the underside of membrane were fixed with cold methanol (Merck, DA, Germany) for 10 min and stained with 10 μg/ml of Hoechst 33342 for 10 min. The stained cells were visualized and scored under a fluorescence microscope. Relative migration or invasion were calculated by dividing the number of migrated cell or invaded cells treated with chrysotobibenzyl compared to the non-treated cells in each experiment.

Immunofluorescence Cells were seeded onto 96-well plates at the density of 1 × 105 cells/well. After treatment 24 h, the cells were fixed with 4% (w/v) paraformaldehyde for 15 min and permeabilized with 0.5% (v/v) Triton-X for 5 min. Next, the cells were incubated with 3% (w/v) BSA for 30 min, washed and incubated with specific antibody against Cdc42, p-FAK, Integrin αν, β1, β3 and Vimentin overnight at 4 °C, washed and incubated with Alexa Flour 488 (Invitrogen, Carlsbad, CA, USA) conjugated goat anti-rabbit IgG (H + L) secondary antibody for 1 h at room temperature in the dark. Therefore, the cells were washed with PBS, costained with 10 μg/ml Hoechst 33,342. The stained cells were washed and mounted with 50% glycerol and visualized and imaged using fluorescence microscopy.

Cell morphology and filopodia characterization Cell morphology and filopodia were investigated by a phalloidinrhodamine staining assay. The cells were seeded in a 96-well plate for 48 h. After treatment, cells were washed with PBS and fixed with 4% paraformaldehyde (Sigma Chemical, St. Louis, MO, USA) in PBS for 10 min at 37 °C. Then, cells were permeabilized with 0.1% Triton X-100 (Sigma Chemical, St. Louis, MO, USA) in PBS for 4 min and blocked with 0.2% bovine serum albumin (BSA) (Merck, DA, Germany) for 30 min. Subsequently, cells were incubated with a phalloidin-rhodamine (Sigma Chemical, St. Louis, MO, USA) in PBS for 15 min, and mounted with 50% glycerol (Merck, DA, Germany). Cell morphology and filopodia were assessed under fluorescence microscope.

Statistical analysis The data were obtained from at least three independent experiments and are presented as the mean ± standard deviation (SD). Statistical differences between two groups was determined by Student's t-test and analysis of variance (ANOVA) with a post-hoc test to compare the multiple groups at a significance level of p < 0.05. SPSS version 22.0 provided by Office of Information Technology, Chulalongkorn University was used for all statistical analysis.

Plasmid construction pGFP-V-RS-shCav-1 was purchased from ORIGENE (Cat. No. TG314183) (Rockville, MA, USA). Plasmid control was purchased from ORIGENE which was conducted by cloning a scramble sequence (5′ GCACTACCAGAGCTAACTCAGATAGTACT 3′) into pGFP-V-RS plasmid. 4

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Results

and D). To confirm, Vimentin was conjugated with Alexa 594, then immunocytochemistry pictured was captured. Chrysotobibenzyltreated cells showed dramatic reduction of Vimentin signal in H460 and H292 cells (Fig. 4E and F).

Effect of chrysotobibenzyl on the cell viability of human lung cancer and normal cells and cell proliferation of H460 and H292 cells Chrysotobibenzyl (Fig. 1A), isolated from D. pulchellum, was used in this study. To determine the non-toxic doses of chrysotobibenzyl to be used in the following experiments, the cells were treated with various concentrations of chrysotobibenzyl (0–100 µM) for 24 h, and their viability was evaluated by MTT assay. As shown in Fig. 1B, treatment with 100 µM chrysotobibenzyl showed slightly cytotoxicity in three lung cancer cells, namely H460, H292 and A549 and in colorectal cancer cells, i.e., HCT116. On the other hand, chrysotobibenzyl showed no cytotoxicity in H23 cells, similar to normal cells, namely primary DP1 and primary DP2. In addition, chrysotobibenzyl had no effect on cell proliferation at 24 h in both cell types and at 48 h in H460 cells. Meanwhile, chrysotobibenzyl at 50 µM significantly altered H292 cells at 48 h, as shown in Fig. 1C.

Chrysotobibenzyl-mediated integrin switch in human lung cancer H460 and H292 cells Integrin switch has the potential to increase the ability of cell migration and metastasis in cancer cells. Therefore, we investigated the effect of chrysotobibenzyl on altering the pattern of integrin expression.Chrysotobibenzyl attenuated the expression of integrins, which reduced cancer cell migration and metastasis. Fig. 5A shows that chrysotobibenzyl reduced the protein expression of integrins β1, β3, and αv and slightly affected the protein expression of integrins α5 and α4 in H460 cells. In addition, chrysotobibenzyl decreased the protein expression of integrins β1, β3, αv, α5, and α4 in H292 cells (Fig. 5C). The protein expressions of integrins β1, β3, and αv were confirmed by immunocytochemistry. As shown in Fig. 5B and D, chrysotobibenzyl reduced the protein expression of integrins β1, β3, and αv when compared with the control. These results confirmed that the downregulation of integrins mediated by chrysotobibenzyl may be responsible for inhibiting the migration and metastasis of lung cancer cells.

Chrysotobibenzyl induces apoptotic cell death and autophagy The apoptotic and necrotic cells were evaluated by Hoechst33342/ PI nuclear staining. We found that chrysotobibenzyl at 0–50 µM had no effect on apoptosis or necrosis, whereas 100 μM of chrysotobibenzyl had slight effect on apoptosis and necrosis in H460 and H292 cells (Fig. 2A and B). In addition, chrysotobibenzyl at the concentration of 100 μM slightly induced apoptosis when evaluated by annexin V/PI (Fig. 2C and D) with cleaved PARP and cleaved Caspase 3 (Fig. 2F and G). We also evaluated for the possible autophagy induction effect of the compound and found that 10–100 μM of chrysotobibenzyl could increase autophagy (dansylcadaverine-positive cells) in both H460 and H292 cells (Fig. 2E). The results showed that chrysotobibenzyl induced apoptosis and autophagy in lung cancer cells.

Chrysotobibenzyl inhibits the migration signaling pathway in human lung cancer H460 and H292 cells To further confirm the effect of chrysotobibenzyl on cancer cell migration, the regulatory proteins for cancer cell migration, such as pFAK, p-AKT, Cdc42, and Cav-1, were determined in the treated cells (H460 and H292). It was found that chrysotobibenzyl significantly suppressed the levels of p-FAK, p-AKT, Cdc42, and Cav-1 in H460 and H292 (Fig. 6A and C). In addition, chrysotobibenzyl decreased p-FAK and Cdc42 in H460 and H292 as compared to in the non-treated control cells, as shown by the immunocytochemistry results (Fig. 6B and D). The results confirmed the previous findings illustrating that chrysotobibenzyl reduces the motility of lung cancer cells.

Chrysotobibenzyl suppresses human lung cancer H460 and H292 cell migration and invasion H460 and H292 cells were investigated in terms of cell migration using a scratch assay as described in the Materials and Methods section. Fig. 3A and B show that chrysotobibenzyl significantly inhibited H460 cell migration at the concentrations of 1–50 μM at 48 h, compared with the non-treated control. The cisplatin, a widely used drug was used as a positive control. The results revealed that the anti-migratory effect of chrysotobibenzyl was greater than cisplatin at similar concentration (10 μM). These results were similar to effects on the migration of H292 cells, whereby H292 cell migration was also significantly decreased by 1–50 μM chrysotobibenzyl at 48 h (Fig. 3D and E). Consistent with these findings, filopodia formation of H460 and H292 indicated a decrease in the number of filopodia after treatment with chrysotobibenzyl (Fig. 3C and F). To confirm cell migration experiment, Boyden chamber migration assay was performed. Consistent with above findings, chrysotobibenzyl was able to decrease the number of cells migrating across the transwell filter at 48 h in a dose-dependent manner, in comparison to those of cisplatin and non-treated control (Fig. 4A). Besides, we performed invasion assay and found that chrysotobibenzyl could decrease the number of invaded H460 and H292 cells across the extracellular matrix mimic gel at 48 h in a dose-dependent manner (Fig. 4B).

Chrysotobibenzyl inhibits migration via a Cav-1-dependent pathway Cav-1 has been reported in cancer cell metastasis. Thus, we evaluated cell migration in control and shRNA-Cav-1-transfected (shCav-1) cells by using scratch assays. Fig. 7A shows that shCav-1-transfected in H460 cells decreased migratory activity when compared with H460 at 24 and 48 h. On the other hand, shCav-1-transfected in H292 cells decreased migratory activity only at 48 h (Fig. 7B). Furthermore, Cav-1 affected the integrin switch. The shCav-1-transfected cells downregulated the protein expression of integrins β1, β3, and αv as compared to H460 control cells (Fig. 7A). These results are compatible with previous reports that Cav-1 and integrins are linked with the migration of lung cancer cells. Moreover, we found new data that Cav-1 inhibits cell migration via integrins β1, β3, and αv. To evaluate possible pathway of chrysotobibenzyl in inhibition of cell migration, we utilized the FAK inhibitor 14 (0–10 μM). The results showed that FAK inhibitor 14 inhibited the activation of FAK (p-FAK) and AKT (p-AKT). However, the expression of Cav-1, integrin β1 and αv was not altered by FAK inhibitor 14 (Fig. 7C), suggested that the integrins were up-stream of FAK. Together, our results revealed that the chrysotobibenzyl-mediated integrin switch are down-stream of Cav-1 signaling. As a consequence of Cav-1-mediated integrin reductions, the activated FAK and AKT was suppressed.

Chrysotobibenzyl suppresses EMT in human lung cancer H460 and H292 cells Chrysotobibenzyl was further tested for the EMT suppression. The EMT markers, namely Vimentin, Slug, and Snail were determined in H460 and H292 cells treated with chrysotobibenzyl. Results indicated that the compound significantly reduced the cellular level of such EMT markers compared with the non-treated control cells at 48 h (Fig. 4C

Effect of chrysotobibenzyl on cisplatin-induced lung cancer cell death Chrysotobibenzyl was evaluated for its efficacy to sensitize lung 5

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 2. Apoptotic and necrotic cells of H460 and H292 were detected by Hoechst33342/PI staining and were then visualized. Percentage of apoptotic/necrotic nuclei in chrysotobibenzyl-treated cells was analyzed (A-B). Annexin/PI co-stained cells were determined by flow cytometry (C-D). Autophagic H460 and H292 cells were detected by dansylcadaverine staining and visualized under fluorescence microscopy (E). The expression levels of apoptosis markers were investigated by Western blotting (F-G). Blots were reprobed with GAPDH to confirm equal loading of samples. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control.

6

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 3. Effect of chrysotobibenzyl on lung cancer cell migration and filopodia formation. H460 and H292 cells were treated with 1–50 µM of chrysotobibenzyl or 10 μM of cisplatin for 48 h. H460 (A) and H292 (D) cells were subjected to wound-healing assay for detecting wound space, with (B) and (E) representing the relative migration levels. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. H460 (C) and H292 (F) filopodia formation was detected by phalloidinrhodamine staining assay and visualized under fluorescence microscopy. Filopodia was indicated by white arrowheads.

7

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 4. Effect of chrysotobibenzyl on lung cancer cell migration (A), invasion (B) and EMT (C-D). H460 and H292 cells were treated with 10 and 50 µM of chrysotobibenzyl or 10 μM of cisplatin for 48 h. Effect of chrysotobibenzyl on H460 and H292 cell migration and invasion was analyzed using Boyden chamber assay. The relative cell migration and invasion were investigated by comparing to control. The expression levels of EMT protein markers and integrins were investigated by Western blotting. Blots were reprobed with GAPDH to confirm equal loading of samples. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. H460 (E) and H292 (F) expression of Vimentin was analyzed by immunofluorescence staining.

cancer cell death, which is mediated by cisplatin. Cells treated with 50 μM cisplatin for 24 h displayed an approximately 58.02% and 56.71 reduction of cell viability in H460 and H292 cells, respectively (Fig. 8A

and B). Noticeably, 50–100 µM of chrysotobibenzyl applying to the cells treated with cisplatin altered the cytotoxic effect (Fig. 8C and D). The effect of chrysotobibenzyl on cisplatin-induced apoptosis was 8

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 5. Effect of chrysotobibenzyl on integrin expression. H460 (A) and H292 (C) cells were treated with chrysotobibenzyl (1–50 µM) for 48 h. The protein levels of integrins β1, β3, αν, α5, and α4 were determined by Western blotting. Blots were reprobed with GAPDH to confirm the equal loading of the samples. The immunoblot signals were quantified by densitometry. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. H460 (B) and H292 (D) Expression of integrins β1, β3, and αν was analyzed by immunofluorescence staining.

9

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 6. Chrysotobibenzyl inhibits the proteins associated migration pathway. H460 (A) and H292 (C) cells were treated with chrysotobibenzyl (1–50 µM) for 48 h. The protein levels of p-AKT/AKT, p-FAK/FAK, Cdc42, and Cav-1 were determined by Western blotting. The immunoblot signals were quantified by densitometry. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. H460 (B) and H292 (D) expression of p-FAK and Cdc-42 was analyzed by immunofluorescence staining.

10

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 7. Chrysotobibenzyl inhibits migration via a Cav-1 dependent pathway. ShCav-1-transfected H460 (A) and H292 (B) cells and control cells were subjected to wound-healing assay for detecting wound space for 48 h, representing the relative migration level. Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. The protein levels of Cav-1, integrins β1, β3, and αν in shCav-1-transfected H460 were determined by Western blotting (A). H460 cells were treated with FAK inhibitor 14 (0–10 μM). After treatment, the protein levels of Cav-1, integrins β1, and αν, FAK and AKT were determined by Western blotting (C). Blots were reprobed with GAPDH to confirm the equal loading of the samples. 11

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 8. Effect of chrysotobibenzyl on cisplatin-induced lung cancer cell death. H460 and H292 cells were treated with 1–100 μM of cisplatin for 24 h. The cell viabilities were evaluated using the MTT assay. The results were represented in percentage of cell viability (A-B). H460 and H292 cells were pretreated with 1–100 µM of chrysotobibenzyl for 24 h and subsequently treated with 50 µM cisplatin for 24 h. The cell viabilities for drug sensitizing were evaluated using the MTT assay, then showed the results in percentage (C-D). Data represent the mean ± SD (n = 3). *p < 0.05 vs. non-treated control. H460 and H292 cells were stained with Annexin/PI and determined by flow cytometry (E).

12

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 9. HCT116 and primary DP1 cells were treated with chrysotobibenzyl (1–50 µM) for 48 h. Relative proliferation of the cells were analyzed by MTT assay (A-B). Migration and invasion were analyzed using Boyden chamber assay. The relative cell migration and invasion were investigated compared with the nontreated control (C-D). The cells were pretreated with 1–100 µM of chrysotobibenzyl for 24 h and subsequently treated with 50 µM cisplatin for 24 h. The cell viabilities for drug sensitizing were evaluated using MTT assay, then showed the results in percentage (E-F). Data represent the mean ± SD (n = 3). *p < 0.05 vs. nontreated control. HCT116 and primary DP1 cells were stained with Annexin/PI and determined by flow cytometry (G).

13

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

confirmed by Annexin V/PI (Fig. 8E). The results indicated that chrysotobibenzyl exerting an impact on cisplatin drug susceptibility.

the downstream pathways of integrin engagement to ECM are FAK and AKT for motility and survival (Bianconi et al., 2016). Consistent with this, the decrease in integrins in response to chrysotobibenzyl (Fig. 5) resulted in the depletion of FAK and AKT activities (Fig. 6). In addition, we found a reduction of Cdc42, a regulator of filopodia formation (Charoenrungruang et al., 2014), alongside the inhibited filopodia formation (Fig 3). Epithelial to mesenchymal transition (EMT) is a process of epithelial cells changing the cell phenotypes to mesenchymal cells (Kalluri and Weinberg, 2009). EMT plays a critical role in encouraging metastasis by enhancing cell migration and invasion (Kalluri and Weinberg, 2009). The up-regulation of Vimentin and EMT transcriptional factors, including, Slug and Snail, are crucial for EMT (Chanvorachote et al., 2016). Chrysotobibenzyl was shown in this study to suppress EMT (Fig. 4). Recent evidences have indicated the essential role of Cav-1 in the regulation of metastasis via the increased capability of cancer cells to motile and survive in the circulatory system (Chanvorachote and Chunhacha, 2013). Cav-1 was demonstrated in lung cancer cells to promote cell survival in an anchorage-independent condition by sustaining the level of active AKT (Chanvorachote et al., 2016) as well as the anti-apoptosis Mcl-1 (Chunhacha et al., 2012). Besides, Cav-1 was shown to regulate cancer cell adhesion to endothelial cells by regulating specific reactive oxygen species (ROS) (Chanvorachote and Chunhacha, 2013). Our previous study indicated that the Cav-1 level in lung cancer cells is regulated by the redox status and reactive oxygen species (ROS). Superoxide anion and hydrogen peroxide decreased Cav-1 expression and inhibited migration and invasion, whereas hydroxyl radicals increased the Cav-1 expression and promoted cell migration and invasion (Luanpitpong et al., 2010). Cav-1 is widely known to relate with high metastasis behaviors, such as migration and invasion in cancers (Chanvorachote et al., 2013; Diaz-Valdivia et al., 2015). Cav-1 was tightly linked with the key mechanisms potentiating cancer cell motility and invasion, including EMT and integrin switch. Furthermore, the upregulation of Cav-1 can be observed during epithelial-mesenchymal transition (EMT), cell migration, and invasion (Diaz-Valdivia et al., 2015). Cav-1 promotes cell migration by controlling polarization of cells, which linked to actin re-polymerization and integrin switch (Grande-García et al., 2007). The up-regulation of Cav-1 induces more EMT phenotype by promoting E-cadherin down-regulation and Vimentin up-regulation in liver cancer cells (Kim et al., 2017). Additionally, Cav-1 expression has been shown to regulate the expression of integrins α2, α5 and β1, which are responsible for high migration and invasion abilities in head and neck squamous cell carcinoma (Jung et al., 2015). Here, we confirm such a role of Cav-1 in the regulation of cancer cell movement by switching the pattern of expressed integrins αν, β1 and β3 in NSCLC cell lines (Fig. 7). The cellular level of Cav-1 was depleted by stable transfection of shRNA-Cav-1, causing a significant down-regulation of the integrins β1, β3, and αv (Fig. 7). Together with the findings in Fig. 7, the compound could attenuate lung cancer cell migration and invasion via Cav-1-dependent mediated-integrins switch. Furthermore, chemotherapeutic resistance is a major concern in lung cancer management. As mentioned above, integrins not only control migration, but also enhance cell survival, which we further demonstrated by showing that the change in integrin patterns in response to chrysotobibenzyl treatment sensitized lung cancer cells to chemotherapy (Fig. 8). We also confirmed the anti-migration and drug sensitization of chrysotobibenzyl in colon cancer cells (Fig. 9), however, the compound had minimal effects on human non-cancerous DP cells. Although the gathered information supported the potential use of this bibenzyl for anti-cancer approaches, the in vivo experiments are further encouraged in order to fulfill the knowledge regarding activity and toxicity of the compound. In summary, we showed that chrysotobibenzyl treatment mediated

Chrysotobibenzyl decreases cancer cell proliferation, migration, invasion and drug sensitizes in other human cancer cell and normal cell Fig. 9A and B showed that chrysotobibenzyl had no effect on cell proliferation in colon cancer (HCT116) cells at 24 h. Chrysotobibenzyl significantly decreased HCT116 cell proliferation at 48 h. However, the compound caused no effect on primary DP cell proliferation. To investigate cells migration and invasion by Boyden chamber assay, HCT116 and primary DP1 cell were seeded and treated with chrysotobibenzyl (10 and 50 μM) or cisplatin (10 μM). Fig. 9C and D show that chrysotobibenzyl and cisplatin significantly inhibited HCT116 cell migration and invasion at 48 h. Whilst, chrysotobibenzyl had slightly affected on the migration and invasion of primary DP1 cells. On the contrary, 10 μM of cisplatin inhibited invasion in primary DP1 cells. For drug sensitization, Fig. 9E shows that 50 and 100 μM of chrysotobibenzyl sensitized cisplatin-mediated death in colon cancer cells. Whereas, such an effect of compound in DP cells only found at high concentration (100 μM) (Fig. 9F). The effect of chrysotobibenzyl on cisplatin-induced cell apoptosis was confirmed by Annexin V/PI (Fig. 9G). Discussion According to the proposed cancer hallmarks by Hanahan and Weinberg, the key malignancies of cancer have been identified (Hanahan et al. 2011). As integrins control cancer cell survival, growth, and motility, integrins are considered as potential therapeutic targets for the inhibition of aggressive cancers. Indeed, integrins, members of the glycoprotein family, are cell adhesion molecules that join cells and the extracellular matrix and generate important cellular signals. In anchorage cells, integrins provide a critical signal for cell survival, and the lack of or an inappropriate integrin interaction to ECM leads to detachment-induced apoptosis, termed “anoikis” (Vachon. 2011). Integrins have also been shown to promote the growth factor receptor (GFR) signaling (Morozevich et al. 2012). In addition, the cross-talk between integrins and GFR was shown to facilitate cancer progression (Morozevich et al. 2012). Evidence indicates that the increase in the level of certain integrins in cancer cells can potentially promote cancer aggressiveness and metastasis (Seguin et al., 2015). Integrins α4, α5, αv, β1, and β3 are frequently expressed in highly metastatic cells (Ninsontia et al. 2014). Integrin β1 was shown to have an important prognostic value, indicating poor prognosis in lung cancer (Adachi et al., 2000). The integrin β1/AKT regulatory axis was demonstrated to facilitate metastasis in esophageal squamous cell carcinoma (Zhang et al., 2015). Furthermore, integrin β1 has been proposed as a potential drug target in disrupting cancer's hallmarks (Blandin et al., 2015). Likewise, the integrin αv was shown to enhance invasiveness of human cancer cells. A high expression level of integrin αv was shown to be associated with brain metastasis in an athymic rat model (Wu et al., 2017). Also, heterodimers of integrin αv with other integrins, like integrins β5 and β6, are essential for cancer invasion (Duperret et al., 2015). Taken together, these studies all point out that integrins have a solid role to play in potentiating cancer aggression and that they are also promising anticancer therapeutic targets. Chrysotobibenzyl, a pure compound from D. pulchellum, has been shown to exhibit anti-metastatic activity by decreasing the growth and survival of lung cancer cells in an anchorage-independent condition (Chanvorachote et al., 2013). In the present study, we investigated the mechanism how chrysotobibenzyl reduces the migration of lung cancer cells and found that integrins αv and β1 were dramatically suppressed in both H460 and H292 cells in response to non-toxic concentrations of the compound (Fig. 5). In terms of the mechanism, it is well known that 14

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al.

Fig. 10. Schematic mechanism of chrysotobibenzyl in suppression of the migration signals in lung cancer cells.

the depletion of Cav-1, integrins β1, β3, and αv essential proteins in potentiating cancer cell migration and invasion (Fig. 10). The decrease of such integrins in response to the compound not only inhibited lung cancer cell migration and invasion, but also sensitized the cancer cells to cisplatin-induced apoptosis; therefore, chrysotobibenzyl is a promising compound for anti-cancer therapy.

non-small cell lung cancer cells. J. Nat. Prod. 77, 1359–1366. Chunhacha, P., Chanvorachote, P., 2012. Roles of caveolin-1 on anoikis resistance in non small cell lung cancer. Int. J. Physiol. Pathophysiol. Pharmacol. 4, 149–155. Chunhacha, P., Pongrakhananon, V., Rojanasakul, Y., Chanvorachote, P., 2012. Caveolin1 regulates Mcl-1 stability and anoikis in lung carcinoma cells. Am. J. Physiol. Cell Physiol. 302, C1284–C1292. Diaz-Valdivia, N., Bravo, D., Huerta, H., Henriquez, S., Gabler, F., Vega, M., Romero, C., Calderon, C., Owen, G.I., Leyton, L., Quest, A.F.G., 2015. Enhanced caveolin-1 expression increases migration, anchorage-independent growth and invasion of endometrial adenocarcinoma cells. BMC Cancer 15, 463 463. Duperret, E.K., Dahal, A., Ridky, T.W., 2015. Focal-adhesion-independent integrin-alphav regulation of FAK and c-Myc is necessary for 3D skin formation and tumor invasion. J. Cell Sci. 128, 3997–4013. Grande-García, A., Echarri, A., de Rooij, J., Alderson, N.B., Waterman-Storer, C.M., Valdivielso, J.M., del Pozo, M.A., 2007. Caveolin-1 regulates cell polarization and directional migration through Src kinase and Rho GTPases. J. Cell Biol. 177, 683–694. Hanahan, D., Weinberg, R.A., 2011. Hallmarks of cancer: the next generation. Cell 144, 646–674. Jung, A.C., Ray, A.-M., Ramolu, L., Macabre, C., Simon, F., Noulet, F., Blandin, A.-F., Renner, G., Lehmann, M., Choulier, L., Kessler, H., Abecassis, J., Dontenwill, M., Martin, S., 2015. Caveolin-1-negative head and neck squamous cell carcinoma primary tumors display increased epithelial to mesenchymal transition and prometastatic properties. Oncotarget 6, 41884–41901. Kalluri, R., Weinberg, R.A., 2009. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 119, 1420–1428. Kim, E.-S., Kwon, J.H., Shin, J.H., You, S., Hong, S.M., Choi, K.Y., 2017. Identification of caveolin-1 as an invasion-associated gene in liver cancer cells using Dendron-coated DNA microarrays. Appl. Biochem. Biotechnol. 182, 1276–1289. Luanpitpong, S., Talbott, S., Rojanasakul, Y., Nimmannit, U., Pongrakananon, V., Wang, L., Chanvorachote, P., 2010. Regulation of lung cancer cell migration and invasion by reactive oxygen species and caveolin-1. J. Biol. Chem. 285 (50), 38832–38840. Morozevichs, G.E., Kozlova, N.I., Ushakova, N.A., Preobrazhenskaya, M.E., Berman, A.E., 2012. Integrin alpha5beta1 simultaneously controls EGFR-dependent proliferation and Akt-dependent pro-survival signaling in epidermoid carcinoma cells. Aging 4, 368–374. Nagano, M., Hoshino, D., Koshikawa, N., Akizawa, T., Seiki, M., 2012. Turnover of focal adhesions and cancer cell migration. Int. J. Cell Biol. 2012, 310616. Ninsontia, C., Chanvorachote, P., 2014. Ouabain mediates integrin switch in human lung cancer cells. Anticancer Res. 34, 5495–5502. Redig, A.J., McAllister, S.S., 2013. Breast cancer as a systemic disease: a view of metastasis. J. Internal Med. 274, 113–126. Salem, A.F., Bonuccelli, G., Bevilacqua, G., Arafat, H., Pestell, R.G., Sotgia, F., Lisanti, M.P., 2011. Caveolin-1 promotes pancreatic cancer cell differentiation and restores membranous E-cadherin via suppression of the epithelial-mesenchymal transition. Cell Cycle 10, 3692–3700. Seguin, L., Desgrosellier, J.S., Weis, S.M., Cheresh, D.A., 2015. Integrins and cancer: regulators of cancer stemness, metastasis, and drug resistance. Trends Cell Biol. 25, 234–240. Vachon, P.H., 2011. Integrin signaling, cell survival, and anoikis: distinctions, differences, and differentiation. J. Signal Transduct. 2011, 738137.

Conflict of interest The authors declare that they have no competing interests. Acknowledgments We sincerely thank the Cell-based Drug and Health Products Development Research Unit, Faculty of Pharmaceutical Sciences, Chulalongkorn University, for their support with this study. This study was supported by a grant from the Ratchadaphisek Somphot Fund for Postdoctoral Fellowship, Chulalongkorn University and Grant for International Research Integration: Chula Research Scholar, Ratchadaphiseksomphot Endowment Fund. References Adachi, M., Taki, T., Higashiyama, M., Kohno, N., Inufusa, H., Miyake, M., 2000. Significance of integrin alpha5 gene expression as a prognostic factor in node-negative non-small cell lung cancer. Clin. Cancer Res. 6, 96–101. Bianconi, D., Unseld, M., Prager, G.W., 2016. Integrins in the spotlight of cancer. Int. J. Mol. Sci. 17, 2037. Blandin, A.-F., Renner, G., Lehmann, M., Lelong-Rebel, I., Martin, S., Dontenwill, M., 2015. β1 integrins as therapeutic targets to disrupt hallmarks of cancer. Front. Pharmacol. 6, 279. Chanvorachote, P., Chamni, S., Ninsontia, C., Phiboonchaiyanan, P.P., 2016. Potential anti-metastasis natural compounds for lung cancer. Anticancer Res. 36, 5707–5717. Chanvorachote, P., Chunhacha, P., 2013. Caveolin-1 regulates endothelial adhesion of lung cancer cells via reactive oxygen species-dependent mechanism. PLoS One 8, e57466. Chanvorachote, P., Kowitdamrong, A., Ruanghirun, T., Sritularak, B., Mungmee, C., Likhitwitayawuid, K., 2013. Anti-metastatic activities of bibenzyls from Dendrobium pulchellum. Nat. Prod. Commun. 8, 115–118. Chaotham, C., Pongrakhananon, V., Sritularak, B., Chanvorachote, P., 2014. A Bibenzyl from Dendrobium ellipsophyllum inhibits epithelial-to-mesenchymal transition and sensitizes lung cancer cells to anoikis. Anticancer Res. 34, 1931–1938. Charoenrungruang, S., Chanvorachote, P., Sritularak, B., Pongrakhananon, V., 2014. Gigantol, a Bibenzyl from Dendrobium draconis, inhibits the migratory behavior of

15

Phytomedicine 58 (2019) 152888

N. Petpiroon, et al. Wong, M.C.S., Lao, X.Q., Ho, K.-F., Goggins, W.B., Tse, S.L.A., 2017. Incidence and mortality of lung cancer: global trends and association with socioeconomic status. Sci. Rep. 7, 14300. Wu, Y.J., Pagel, M.A., Muldoon, L.L., Fu, R., Neuwelt, E.A., 2017. High alphav integrin level of cancer cells is associated with development of brain metastasis in athymic rats. Anticancer Res. 37, 4029–4040. Xu, Z., Zou, L., Ma, G., Wu, X., Huang, F., Feng, T., Li, S., Lin, Q., He, X., Liu, Z., Cao, X., 2017. Integrin beta1 is a critical effector in promoting metastasis and chemo-resistance of esophageal squamous cell carcinoma. Am. J. Cancer Res. 7, 531–542.

Zhan, P., Shen, X.-K., Qian, Q., Wang, Q.I.N., Zhu, J.-P., Zhang, Y.U., Xie, H.-Y., Xu, C.-H., Hao, K.-K., Hu, W.E.I., Xia, N., Lu, G.-J., Yu, L.-K., 2012. Expression of caveolin-1 is correlated with disease stage and survival in lung adenocarcinomas. Oncol. Rep. 27, 1072–1078. Zhang, H.-F., Alshareef, A., Wu, C., Li, S., Jiao, J.-W., Cao, H.-H., Lai, R., Xu, L.-Y., Li, E.M., 2015. Loss of miR-200b promotes invasion via activating the Kindlin-2/integrin β1/AKT pathway in esophageal squamous cell carcinoma: an E-cadherin-independent mechanism. Oncotarget 6, 28949–28960.

16