- Email: [email protected]
Cinnamon extract and polyphenols affect the expression of tristetraprolin, insulin receptor, and glucose transporter 4 in mouse 3T3-L1 adipocytes
Archives of Biochemistry and Biophysics 459 (2007) 214–222 www.elsevier.com/locate/yabbi
Cinnamon extract and polyphenols aVect the expression of tristetraprolin, insulin receptor, and glucose transporter 4 in mouse 3T3-L1 adipocytes Heping Cao ¤, Marilyn M. Polansky, Richard A. Anderson ¤ Nutrient Requirements and Functions Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, US Department of Agriculture, Building 307C, BARC-East, 10300 Baltimore Avenue, Beltsville, MD 20705-2350, USA Received 8 November 2006, and in revised form 20 December 2006 Available online 25 January 2007
Abstract Cinnamon improves glucose and lipid proWles of people with type 2 diabetes. Water-soluble cinnamon extract (CE) and HPLC-puriWed cinnamon polyphenols (CP) with doubly linked procyanidin type-A polymers display insulin-like activity. The objective of this study was to investigate the eVects of cinnamon on the protein and mRNA levels of insulin receptor (IR), glucose transporter 4 (GLUT4), and tristetraprolin (TTP/ZFP36) in mouse 3T3-L1 adipocytes. Immunoblotting showed that CP increased IR levels and that both CE and CP increased GLUT4 and TTP levels in the adipocytes. Quantitative real-time PCR indicated that CE (100 g/ml) rapidly increased TTP mRNA levels by approximately 6-fold in the adipocytes. CE at higher concentrations decreased IR protein and IR mRNA levels, and its eVect on GLUT4 mRNA levels exhibited a biphasic pattern in the adipocytes. These results suggest that cinnamon exhibits the potential to increase the amount of proteins involved in insulin signaling, glucose transport, and anti-inXammatory/anti-angiogenesis response. Published by Elsevier Inc. Keywords: Adipocytes; Angiogenesis; Cinnamon extract; Diabetes; Glucose transporter; InXammation; Insulin receptor; Obesity; Polyphenol; Tristetraprolin
Diabetes has been a subject of extensive research, but the prevention and control of type 2 diabetes mellitus (type 2 DM)1 has not been resolved. Diet has been shown to play an important role in the development of type 2 DM, and the diets commonly consumed in the United States and other developed countries appear to increase the incidence of diabetes [1]. The higher incidences of diabetes in the US are probably due in part to a combination of higher content of reWned sugar and fat and lower intake of traditional herbs, spices, and other plant products. For the majority of people in developing countries, drug treatment for diabetes *
Corresponding authors. Fax: +1 301 504 9062 (H. Cao). E-mail addresses: [email protected], [email protected] (H. Cao), [email protected] (R.A. Anderson). 1 Abbreviations used: ARE, AU-rich element; CE, cinnamon extract; CP, cinnamon polyphenols; DMEM, Dulbecco’s modiWed Eagle’s medium; DMEM+, DMEM plus 10% (v/v) fetal bovine serum, 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine; GLUT4, glucose transporter 4; IR, insulin receptor; TTP, tristetraprolin. 0003-9861/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.abb.2006.12.034
is not feasible and alternative and inexpensive therapies need to be evaluated. Plants have been used for the treatment of diabetes since 1550 BC [2]. Plants are important for the prevention and control of type 2 DM, especially for people with elevated levels of blood glucose and glucose intolerance who have a greater risk of developing diabetes. Plant seeds, fruits, leaves, and bark contain polyphenols. These compounds are the end products of the Xavonoid biosynthetic pathway in plants and are used by plants for the protection against predators [3]. Plant polyphenols are also widely present in the diet [4] and are important for human health [5]. Common spices (cinnamon, cloves, turmeric, and bay leaves) and tea display insulin-like activity in vitro [6,7]. We have identiWed polyphenolic polymers from an aqueous extract of commercial cinnamon that increase glucose metabolism several fold in an epididymal fat cell assay [8]. These cinnamon polyphenols (CP) with doubly linked procyanidin type-A polymers appear to be unique for their insulin-like
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
activity, because other cinnamon compounds display little or no such activity [8]. In addition, none of the other 50 plant extracts tested displayed activity equal to that of cinnamon [7]. Strong evidence suggests that CP exhibit insulin-like activity in cells, animals and people with type 2 diabetes. First, a water-soluble cinnamon extract (CE), like insulin, increases the activity of autophosphorylation of the insulin receptor (IR) and decreases the activity of tyrosine phosphatase in vitro [9]. Second, CP, like insulin, stimulate glucose uptake and glycogen biosynthesis, activate glycogen synthase, and inhibit glycogen synthase kinase-3 [10]. Third, CE potentiates in vivo insulin-regulated glucose utilization via increasing glucose uptake, and prevents insulin resistance induced by a high-fructose diet in rats [11,12]. It also decreases glucose and increases insulin in blood of rats fed diets containing CE [13] and decreases blood pressure [14]. Finally, cinnamon was shown to decrease the levels of glucose, triglycerides, and LDL cholesterol in people with type 2 diabetes [15]. A recent study involving postmenopausal patients with type 2 diabetes under good control for diabetes (mean HbA1c of 7.1–7.4%) did not respond to cinnamon [16]. It is not clear if this lack of a response is due to selection of patients, level of control, oral hypoglycemic agents, diet or type of cinnamon used. Cinnamon polyphenols may have additional beneWts for human health. First, CE has the ability to inhibit cancer cell proliferation by altering the cell cycle pattern in three myeloid cell lines (Jurkat, Wurzburg, and U937) [17]. Second, cinnamon bark was reported to have antioxidant eVects by increasing the activities of antioxidant enzymes including glutathione S-transferase, superoxide dismutase, and catalase in rat livers and hearts [18]. Third, it was reported that CE has anti-ulcerogenic activity by preventing the occurrence of stress ulcers under cold exposure or water-immersion-stress in rats [19]. Finally, it is possible that CP may have anti-inXammatory properties because insulin induces the mRNA levels of the anti-inXammatory protein tristetraprolin (TTP) in mouse cells [20]. Cell cultures have been used as model systems in the studies of the mechanisms of plant polyphenols in animal and human health [5]. Polyphenols have been shown to alter signal transduction pathways in cultured cells [5]. To understand the molecular basis of insulin-like activity and explore additional beneWts of cinnamon polyphenols, we investigated the eVects of CE and CP on the regulation of IR, glucose transporter 4 (GLUT4) and TTP in mouse 3T3-L1 adipocytes. These three proteins are involved in the insulin signaling transduction pathway that functions in insulin receptor substrate activation [21], insulin-regulated glucose transport [22], and anti-inXammatory responses [23], respectively. Materials and methods Cinnamon extract and polyphenols Water-soluble CE was prepared as described previously [8] with modiWcations. BrieXy, ground cinnamon (Cinnamomum burmannii) was suspended in 0.1 N acetic acid. The suspension was autoclaved for 15 min at 15 psi and the supernatant was mixed with four volumes of absolute
215
ethanol and refrigerated overnight. The mixture was Wltered through glass wool and then Whatman No. 1 Wlter paper. The ethanol was removed by rotoevaporation and the remaining solution was freeze-dried. The dried CE was reconstituted at 100 mg/ml in 100% dimethylsulfoxide (DMSO) and diluted with deionized water before being added to the culture medium. CE powder was stored at room temperature and the reconstituted samples were kept at ¡20 °C for long-term storage and at 4 °C for short-time storage. Cinnamon polyphenols were puriWed from CE by high performance liquid chromatography (HPLC) [8]. BrieXy, CE was Wltered through a 0.45 m Wlter before being injected onto a Symmetry Prep C18 column (7.8 £ 300 mm) and separated by reverse phase HPLC at a Xow rate of 4 ml/min using a two-step program: (1) 0–50 min, 92% of 0.05 N HAc and 8% acetonitrile (Fractions 1–6); (2) 51–58 min, gradient to 100% acetonitrile (Fraction 7). Cinnamon polyphenol fractions from HPLC were designated as CP1A, CP1B, CP2, CP3, CP4, CP5, CP6, and CP7. Fractions 2, 4, and 6 have been characterized [8]. CP2 is a procyanidin trimer (Mr 864 Da) (Fig. 1a). CP4 is a tetramer (Mr 1152 Da). CP6 is a trimer with the same molecular mass as CP2 (Mr 864 Da). CP7 is a mixture of monomer (Mr 288 Da) plus other oligomers as determined by mass spectrometry analyses [8]. CP3 and CP5 contained mixtures of trimers and tetramers and the exact identities of CP1A and CP1B were not determined. The fractions were collected and acetonitrile removed by rotoevaporation and freezedried. The freeze-dried samples were reconstituted at 10 mg/ml in 100% DMSO and stored as described above for the storage of CE.
Cell culture Mouse 3T3-L1 Wbroblasts (American Type Culture Collection) were maintained at 37 °C in a humidiWed incubator with 5% CO2 in Dulbecco’s modiWed Eagle’s medium (DMEM) containing 4500 mg/l (25 mM) glucose (Gibco BRL, Gaithersburg, MD) supplemented with 10% (v/v) fetal bovine serum, 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (DMEM+). Adipocyte induction was as described [10]. Mouse 3T3-L1 Wbroblasts (about 0.2 million cells/2-ml medium/well) were grown in 6-well plates under the same conditions for 48–60 h and the medium was replaced with fresh DMEM+. After incubation for another 48–60 h, the medium was replaced with diVerentiation medium containing DMEM+, 1 g/ml of the recombinant human insulin expressed in yeast (Sigma Chemical Co, St. Louis, MO), 0.25 M dexamethasone (Sigma), and 250 M 1-isobutyl-3-methylxanthine (IBMX) (Sigma). Following incubation for 48–60 h, the diVerentiation medium was replaced with DMEM+ containing only 1 g/ml of insulin. After incubation for additional 48–60 h, the medium was replaced with DMEM+ and the cells were grown for an additional 4–6 days. Microscopic observation indicated that approximately 80–90% of the cells accumulated lipid drops (indication of diVerentiation from preadipocytes to adipocytes) (Fig. 1b). The cells were then serum-starved in DMEM without any supplementation for 3–4 h before various chemicals and the vehicle control at its highest concentration were added to the medium for various times as indicated in the “Result” section and the Wgure captions. Two to four independent experiments were performed. Cellular extract was prepared as described below. Mouse macrophage RAW264.7 cells (American Type Culture Collection) were cultured in Eagle’s minimum essential medium (Gibco BRL), and were treated with 0.1 g/ml lipopolysaccharide (LPS) (Sigma) for 2 h [24]. The induced TTP was used as a positive control in SDS–PAGE.
Cell extracts Cell extracts were prepared as described [24] with modiWcations. BrieXy, after washing twice with 0.9% NaCl, 100–150 l of lysis buVer containing 50 mM NaH2PO4, pH 7.6, 250 mM NaCl, 50 mM NaF, 0.5% Nonidet P-40, 1 mM phenylmethylsulfonyl Xuoride, and 0.2% (v/v) of protease inhibitor cocktails (104 mM AEBSF, 0.08 mM aprotinin, 2 mM leupeptin, 4 mM bestatin, 1.5 mM pepstatin A, and 1.4 mM E-64) (Sigma) were added to each well. The cells were scraped and transferred into microfuge tubes and left on ice for about 30 min before being centrifuged at 10,000g for 10 min at 4 °C. The 10,000g supernatant was stored at ¡20 °C.
216
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Fig. 1. Chemical structure of cinnamon polyphenol and morphology of mouse 3T3-L1 adipocytes. (a) The structure of HPLC-puriWed cinnamon polyphenol fraction 2 (CP2) is a doubly linked procyanidin type-A polymer. The structure of cinnamon polyphenol was determined by nuclear magnetic resonance (300 MHz for 1H and 75 MHz for 13C on a Bruker QE Plus 300 NMR spectrometer), mass spectroscopy (electrospray ionization and atmospheric pressure chemical ionization on an LCQ classic ion trap instrument) and infrared spectroscopy as described in reference [8]. (b) DiVerentiated mouse 3T3-L1 adipocytes before treatments used in this study.
Protein concentration determination Protein concentrations were determined with modiWcations using the Protein Assay Dye Reagent Concentrate (Bio-Rad) following NaOH treatment of the samples [25]. BrieXy, protein samples in 96-well plates were treated with 0.5 M NaOH in 20 l for 10 min at room temperature. Then 200 l of the diluted dye reagent (1:5 in water) were added to each well. Following incubation for 10–20 min at room temperature, the absorbance at 595 nm was measured using Bio-Tek Spectrophotometer (Bio-Tek Instruments, Inc., Winooski, VT). Bovine serum albumin from Bio-Rad was used as the protein standard.
Technologies, Palo Alto, CA, USA) with RNA 6000 Ladder as the standards (Ambion, Inc., Austin, TX, USA).
cDNA synthesis The mixture (20 l) contained 5 g total RNA, 2.4 g oligo(dT)12-18 primer, 0.1 g random primers, 500 M dNTPs, 10 mM DTT, 40 u RNaseOUT, 200 u SuperScript II reverse transcriptase (Invitrogen) in 1X Wrststrand synthesis buVer. The synthesis reactions were preceded at 42 °C for 50 min.
PCR primers and TaqMan probes SDS–PAGE and immunoblotting The primers and probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA) and were synthesized by Biosearch Technologies, Inc. (Navato, CA, USA). The gene names, GenBank accession numbers, amplicon sizes, and the sequences (5´ to 3´) of the forward primers, TaqMan probes (TET–BHQ1) and reverse primers, respectively, are described in Table 1.
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS– PAGE) and immunoblotting were performed [26]. BrieXy, proteins were separated by 10% SDS–PAGE and transferred onto nitrocellulose membranes. The membranes were blocked with 5% nonfat dry milk in TTBS buVer, and successively incubated in buVers containing the primary antibodies (1:1000–2000 dilution) overnight and the secondary antibodies (1:10,000 dilution) for 4 h. Proteins on the immunoblots were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) followed by imaging with BioChemi Image Acquisition and Analysis System (UVP BioImaging Systems, UVP Inc, Upland, CA). Typical immunoblotting results were presented in the Wgures. The primary antibodies were anti-IR raised against the synthetic C-terminal peptide of human IR (Santa Cruz Biotechnology, Santa Cruz, CA), anti-GLUT4 raised against the synthetic C-terminal peptide of mouse GLUT4 (Chemicon, Temecula, CA), and anti-MBP-mTTP serum raised against the recombinant full-length mouse TTP fused to Escherichia coli maltosebinding protein [24]. The secondary antibodies were aYnity-puriWed goat anti-rabbit IgG (H+L) horseradish peroxidase conjugate with human IgG absorbed (GAR–HRP, Bio-Rad).
TaqMan reaction mixture (25 l) contained 25 ng of RNA-derived cDNAs, 200 nM each of the forward primer, reverse primer, and TaqMan probe, and 12.5 l of 2£ Absolute QPCR Mix (ABgene House, Epson, Surrey, UK). The reactions were performed in 96-well plates in a ABI Prism 7700 real time PCR instrument (Applied Biosystems) [27]. The thermal cycle conditions were as follows: 2 min at 50 °C and 10 min at 95 °C, followed by 50 cycles at 95 °C for 15 s each and 60 °C for 60 s. Fluorescence signals measured during ampliWcation were considered positive if the Xuorescence intensity was >20-fold greater than the standard deviation of the baseline Xuorescence [27]. The CT method of relative quantiWcation was used to determine the fold change in expression [28].
RNA isolation
Statistical analyses
Mouse cells were washed in 6-well plates twice with 1 ml 0.9% NaCl and lysed directly with 1 ml of TRIZOL reagent (Invitrogen). RNA was isolated according to the manufacturer’s instructions. RNA concentrations and integrity were determined using RNA 6000 Nano Assay Kit and the Bioanalyzer 2100 according to the manufacturer’s instructions (Agilent
The data were analyzed by SigmaStat 3.1 software (Systat Software, Inc., Point Richmond, CA) using One Way Analysis of Variance (ANOVA) and multiple comparisons were performed with Duncan’s Multiple Range Test. Values with diVerent lower case letters displayed above the columns of the Wgures are signiWcantly diVerent at p < 0.05.
Real-time PCR analysis
ACCTGTAACCCCAGAACTTGGA ACCACGTTGTGCAGGTAATCC ACGGCAAATAGAAGGAAGACGTA CCTGGCGTTGGGATTGG AACTCAATATAATCCTGCCTTAGCCTT TCCTCCAGCTCCTTCAGGATCTGAGAGTC TCCGCAACATACTGGAAACCCATGC AGCAGCACAGCTGGCCATCAGAGTC GGTACCCCAGGCTGGCTTT CAAAAGCACAATCAGAGTGAGTATGAC CAACTGGACCTGTAACTTCATCGT AACCGAAAAGCCATTGTAGAAA NM_011756 NM_017071 NM_012751 NM_172086 TTP IR GLUT4 RPL32
70 137 87 66
Forward primer (5´ to 3´) Amplicon (bp) Accession No. Gene
Table 1 Nucleotide sequences of real-time PCR primers and TaqMan probes
TaqMan probe (TET–BHQ1)
Reverse primer (5´ to 3´)
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
217
Results EVect of cinnamon extract and polyphenols on the protein levels of insulin receptor We Wrst examined the steady state levels of IR following initial serum starvation using IR-speciWc antibodies. Immunoblotting showed that IR protein levels were similar in adipocytes harvested in all of the time points tested, from 30 min to 3 h beyond the initial serum starvation, as well as the controls using 0.01–1% of DMSO treatments (data not shown), suggesting that the amount of IR protein was quite constant in mouse 3T3-L1 adipocytes under these experimental conditions. Immunoblotting also showed that IR protein was not detectable in mouse RAW264.7 cells treated with 0.1 g/ml LPS for 2 h under the assay conditions (data not shown). To study the dose eVect of CE on IR, 3T3-L1 adipocytes were treated with 0 (1% DMSO control), 0.01, 0.1, and 1 mg/ml of CE for 0, 0.5, 1, 1.5, 2, and 3 h. The amounts of IR in the cellular extracts were analyzed by immunoblottting. A low concentration of CE (0.01 mg/ml) did not signiWcantly aVect the amount of IR in 3T3-L1 adipocytes (Fig. 2a and b, lanes 1 vs. 2, 5 vs. 6, and 9 vs. 10). However, treatment of the cells with a high concentration of CE (1 mg/ml) resulted in signiWcant reductions of IR levels at all of the time points analyzed, ranging from 30 min to 3 h (Fig. 2a, lanes 8, 12, and Fig. 2b, lanes 4, 8, and 12). The reduction of IR protein in 3T3-L1 adipocytes treated with a high concentration of CE (Fig. 2a and b) might be due to feedback inhibition or inhibitory compounds in the unpuriWed water-soluble CE. We therefore tested the eVects of HPLC-puriWed CP on IR levels in mouse 3T3-L1 adipocytes. Cinnamon polyphenols were collected from HPLC fractions and designated as CP1A, CP1B, CP2 (trimer), CP3 (mixtures of trimers and tetramers), CP4 (tetramer), CP5 (mixtures of trimers and tetramers), and CP6 (trimer, refer to Fig. 1a) as determined by mass spectrometry analyses [8]. Immunoblotting results showed that IR levels in the mouse 3T3-L1 adipocytes were generally increased by most of the CP treatments for 3 h over the 0.1% DMSO control in lane 2 (Fig. 2c and data not shown). This immunoblot also showed that IR levels were decreased by treatment with 1 g/ml LPS (Fig. 2c, lanes 2 vs. 3). To investigate if CE and CP exhibited potential toxicity in 3T3-L1 adipocytes, we incubated the diVerentiated adipocytes with 1 mg/ml CE or 100 g/ml CP (the highest concentrations used in this study) for 4 h. The cells were apparently growing normally because there were no detectable diVerences in the morphology under microscopic observation or the total soluble protein concentrations between the cinnamon-treated and vehicle-treated adipocytes (data not shown). These lines of evidence suggest that the reduction of IR level in high concentrations of CE treatment are not due to general toxicity of the cinnamon compounds but likely due to feedback inhibition of speciWc metabolic and/or signal transduction pathways by the cinnamon compounds.
218
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Fig. 3. EVect of cinnamon extract and polyphenols on the amount of GLUT4 in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes after 3 h treatment were separated by 10% SDS– PAGE, and GLUT4 was detected by immunoblotting with anti-GLUT4 antibodies. Each lane was loaded with 100 g of protein. Lane 1, protein size standard, lane 2, DMSO control (1%); lane 3, CE (10 g/ml); lane 4, CP3 (1 g/ml).
Fig. 2. EVect of cinnamon extract and polyphenols on the amount of IR in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes were separated by 10% SDS–PAGE, and IR was detected by immunoblotting with anti-IR antibodies. Each lane was loaded with 100 g of protein. (a) Adipocytes treated with 0 (1% DMSO control), 0.01, 0.1 or 1 mg/ ml of CE for 0–1 h. Lanes 1–4, CE for 0 h; lanes 5–8, CE for 0.5 h; lanes 9–12, CE for 1 h. (b) Adipocytes treated with 0 (1% DMSO control), 0.01, 0.1 or 1 mg/ml of CE for 1.5–3 h. Lanes 1–4, CE for 1.5 h; lanes 5–8, CE for 2 h; lanes 9–12, CE for 3 h. (c) Adipocytes treated with 1 or 10 g/ml of CP for 3 h. Lane 1, protein size standards; lane 2, DMSO control (0.1%); lane 3, LPS (1 g/ml); lanes 4–5, CP3; lanes 6–7, CP4; lanes 8–9, CP5; lanes 10–11, CP6.
In separate studies, we tested the safety of the cinnamon extracts from 10 to 450 g/ml using keratinocytes on cell viability and DNA damage measured using the Comet assay and the production of 8-hydroxy-2⬘-deoxyguanosine (8-OHdG) [29] and did not detect any signs of toxicity.
protein whose mRNA level is induced by insulin in mouse HIR 3.5 cells [20] but whose protein level related to insulin induction has not been investigated previously in any other system. TTP is an extraordinarily low abundance protein in endogenous tissues or cells. It is normally undetectable and can only be detected after loading mg of total proteins or after strong stimulation by agents such as bacterial endotoxin LPS [24]. Immunoblotting results showed that TTP was barely detectable in untreated cells (Fig. 4, lanes 1 and 5) but was signiWcantly induced by 100 g/ml of CE in 3T3L1 adipocytes after 3 h treatment (lane 3). The puriWed CP3 at 10 and 100 g/ml also increased the amount of TTP in the adipocytes after 3 h treatment, and higher concentrations of CP treatment resulted in more TTP in the adipocytes (Fig. 4, lanes 6–8). The size of TTP induced by CP in the adipocytes was similar to that induced by 0.1 g/ml LPS in mouse RAW264.7 cells (lanes 4 vs. 8).
EVect of cinnamon extract and polyphenols on the protein levels of glucose transporter 4 Immunoblotting showed that the levels of GLUT4 were increased in 3T3-L1 adipocytes following treatment for 3 h with 10 g/ml of the water-soluble CE (Fig. 3, lanes 2 vs. 3). Because of the similar activities of the various HPLC fractions as shown in Fig. 2c and in reference [8], we selected CP3 for this experiment. Immunoblotting showed that CP3 also increased GLUT4 accumulation in 3T3-L1 adipocytes after 3 h treatment (Fig. 3, lanes 2 vs. 4). EVect of cinnamon extract and polyphenols on the protein levels of tristetraprolin To explore other potential beneWts of cinnamon, we investigated the eVects of CE and CP on TTP, an anti-inXammatory
Fig. 4. EVect of cinnamon extract and polyphenols on the amount of TTP in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes after 3 h treatment were separated by 10% SDS–PAGE, and TTP was detected by immunoblotting with anti-MBP-mTTP antibodies. Lane 1, DMSO control; lane 2, CE (10 g/ml); lane 3, CE (100 g/ml); lane 4, extract from RAW264.7 cells treated with LPS (0.1 g/ml) for 2 h as a positive TTP control; lane 5, DMSO control (1%); and lane 6–8, CP3 (1, 10, and 100 g/ml, respectively). Lanes 1–3 (100 g of protein); lane 4 (40 g of protein); and lanes 5–8 (80 g of protein).
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
219
(Fig. 5c). The patterns of CE eVects on GLUT4 mRNA levels were opposite between the 90-min and the 120-min treatments. GLUT4 mRNA levels were decreased by CE in the 90-min treated cells but were increased by CE in the 120-min treated adipocytes (Fig. 5c). Discussion
Fig. 5. EVect of cinnamon extract on the mRNA levels of TTP, IR, and GLUT4 in 3T3-L1 adipocytes. (a) TTP mRNA levels, (b) IR mRNA levels, and (c) GLUT4 mRNA levels. Total RNAs were isolated from 3T3-L1 adipocytes treated with DMSO control (0.1%) or CE (10 or 100 g/ml) for 30, 60, 90, and 120 min. Twenty-Wve nanograms of RNA-derived cDNAs were used for quantitative real-time PCR assays. The CT method of relative quantiWcation was used to determine the fold change in expression. The results represent the means and the standard deviations from four determinations. Values with diVerent lower case letters displayed above the columns of the Wgure are signiWcantly diVerent at p < 0.05.
EVect of cinnamon extract on the mRNA levels of tristetraprolin, insulin receptor, and glucose transporter 4 In a time course study, TTP mRNA levels were rapidly increased by CE treatment for 30, 60, 90, and 120 min in the adipocytes (Fig. 5a). TTP mRNA levels in 10 g/ml CEtreated cells were 2.3-, 1.9-, 1.1-, and 1.2-fold of those in the controls, and those in 100 g/ml CE-treated cells were 5.5-, 5.7-, 3.6-, and 3.1-fold of those in the control cells. IR mRNA levels were signiWcantly reduced by a higher concentration of CE (100 g/ml) for 60–120 min treatments (Fig. 5b). CE eVect on GLUT4 mRNA levels exhibited a biphasic response. In the 30- and 60-min treated adipocytes, GLUT4 mRNA levels were not signiWcantly aVected
Plants have been used for the treatment of diabetes since 1550 BC [2]. In search for plant products for diabetic prevention and cure, we and others have shown that common spices (cinnamon, cloves, turmeric, and bay leaves) and tea display insulin-like activity in vitro. We have demonstrated that cinnamon improves glucose and lipid proWles of people with type 2 diabetes [15], and that cinnamon exhibits insulin-like activity in cells, animals and people with type 2 diabetes [8–12,15]. We investigated three of the proteins (IR, GLUT4, and TTP) involved in insulin signal transduction pathway using mouse 3T3-L1 adipocytes to understand the molecular basis for the insulin-like eVects of cinnamon with doubly linked procyanidin type-A polymers. The major Wnding reported in this study is that CE and CP increased the amount of the anti-inXammatory protein TTP and that CE rapidly increased its mRNA levels in 3T3-L1 adipocytes. TTP is an extraordinarily low abundance protein but is induced by agents such as bacterial endotoxin LPS [24]. This study showed, for the Wrst time, that TTP protein was detectable in 3T3-L1 adipocytes and that it was increased by cinnamon, a plant nutritional product. TTP is a hyper-phosphorylated protein [30] with antiinXammatory function through the down-regulation of pro-inXammatory cytokines [23,31]. TTP binds to and subsequently promotes the degradation of those mRNAs encoding pro-inXammatory cytokines such as TNF- and GM-CSF [25,32,33]. The mRNA levels of TTP are dramatically induced by nM concentrations of insulin in minutes [20] but whose protein level related to insulin induction has not been investigated previously in any other system. We showed here that CE and CP increased TTP protein accumulation in 3T3-L1 adipocytes. Furthermore, the induced TTP migrated at higher molecular masses (Mr 40–50,000) than the predicted size (Mr 33,613). The evidence that the apparent 40–50 K protein on the immunoblot is the predicated 33.6 K TTP protein was based on the speciWcity of TTP antibodies and the positive size control of TTP in LPS-stimulated macrophage RAW cells as described in a previous manuscript [24]. Similar size diVerences between the apparent 40–50 K protein on the immunoblot and the predicated 33.6 K TTP were also reported in human TTP [25,30]. The size of TTP in 3T3-L1 adipocytes, similar to that in LPS-stimulated TTP [24] suggests that TTP might be phosphorylated in CE and CP-treated 3T3-L1 adipocytes. Real-time PCR demonstrated that CE increased TTP mRNA levels rapidly within 30-min treatment in the adipocytes. LPS is known to induce TTP expression in mouse macrophage RAW264.7 cells [24]. It has also been shown that up-regulation of TTP limits inXammatory response in
220
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
macrophages [34]. Our preliminary results indicted that TTP expression was not signiWcantly aVected by LPS in mouse 3T3-L1 adipocytes (data not shown). Since adipose cells are shown to be a major source of inXammatory mediators and are responsive to a variety of inXammatory cytokines including TNF- [35], our results reported here suggest a potential role of cinnamon in the prevention of inXammatory conditions in adipose tissues. VEGF mRNA is also a potential target of TTP [36]. Therefore, it is possible that TTP induced by cinnamon in adipocytes may have other eVects such as anti-angiogenesis. The other Wnding is that HPLC-puriWed CP increased IR protein in 3T3-L1 adipocytes and suggests a beneWcial role of CP in insulin signaling. IR is auto-phosphorylated by its kinase domain, which also phosphorylates insulin receptor substrate leading to a signaling cascade [21]. The increased amount of IR reported here and the activation of IR by phosphorylation reported previously [9,10] strongly support the conclusion that CP is involved in insulin signaling. Our results showed that low concentrations of the unpuriWed water-soluble CE did not exhibit a signiWcant eVect on IR protein levels, which is in agreement with a previous report that showed that there is not a signiWcant diVerence in IR levels between rats fed with CE and the control rats fed with saline [11,12]. The inhibitory eVects of high concentrations of CE on IR protein and IR mRNA levels were probably due to minor toxic compounds in the unpuriWed CE or due to feedback inhibition. Our extraction procedure removes a great majority of the toxic lipidsoluble compounds from cinnamon bark [8]. However, the inhibition of IR level in 3T3-L1 adipocytes by high concentrations of the unpuriWed extract may suggest that the
crude extract still contains minor inhibitory compounds such as cinnamaldehyde [37]. Further analyses suggest that the reduction of IR level in high concentrations of CE treatment might not be due to general toxicity of the cinnamon compounds because the cells were grown normally by judging the cell morphology and the total soluble protein content but probably due to feedback inhibition of speciWc metabolic and/or signal transduction pathways by high concentrations of cinnamon compounds. Finally, CE and CP were shown to increase the protein levels of GLUT4 in 3T3-L1 adipocytes. It is well established that insulin promotes translocation of GLUT4 from intracellular compartment to plasma membrane [38]. The amount of GLUT4 can also be regulated by insulin [38–40] and is decreased in obesity [41]. For example, one study showed that GLUT4 level is increased in 3T3-F442A adipocytes by insulin treatment for 16 h [42]. Another study reported that insulin increases GLUT4 mRNA and protein levels in rat fetal brown adipocytes [39,40]. Recently, polyphenolic compounds have been shown to increase both the translocation and the amount of GLUT4. First, CE and CP were shown to increase glucose uptake in 3T3L1 adipocytes [10,43] and in the fructose-fed rat [44]. Second, a synthesized CP-like compound was also reported to enhance glucose uptake and GLUT4 translocation in 3T3L1 adipocytes [45]. Finally, the amount of GLUT4 is increased in fructose-fed rats with green tea supplementation resulting in amelioration of fructose-induced insulin resistance [46]. The increases of GLUT4 protein by CP reported here may therefore suggest a positive eVect of these compounds on the long-term regulation of glucose transport.
Fig. 6. A model of actions by CP and TTP in the insulin signal transduction pathway leading to the beneWcial eVects in people with type 2 diabetes: (1) CP activate IR by increasing their tyrosine phosphorylation activity and by decreasing phosphatase activity that inactivates the receptor [9]; (2) CP increase the amount of IR protein; (3) CP increase the amount of GLUT4 protein; (4) CP increase glycogen synthase activity and glycogen accumulation [10]; (5) CP decrease GSK3 activity [10]; (6) CP increase the amount of TTP protein; (7) CP may increase the activity of TTP by decreasing its phosphorylation through inhibition of GSK3 activity [10]. Refer to the text for more details (“+” represents positive eVect and “¡” represents negative eVect).
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Based on the results of this study and the published studies, we propose a model of actions by CP and TTP in the insulin signal transduction pathway leading to the beneWcial eVects in people with type 2 diabetes (Fig. 6). Cinnamon polyphenols aVect multiple steps of the pathway: (1) CP activate insulin receptors by increasing their tyrosine phosphorylation activity and by decreasing phosphatase activity that inactivates the receptor [9]; (2) CP increase the amount of IR protein (this study); (3) CP increase the amount of GLUT4 protein (this study); (4) CP increase glycogen synthase activity and glycogen accumulation [10]; (5) CP decrease GSK3 activity [10]; (6) CP increase the amount of the anti-inXammatory protein TTP in the cells (this study); (7) CP may increase the activity of TTP by decreasing its phosphorylation through inhibition of GSK3 activity [10]. All these activities and other potential activities may eventually lead to more eYcient glucose transport and utilization. In addition, CP-induced TTP accumulation in 3T3-L1 adipocytes may provide one of the molecular bases for the beneWcial eVects of cinnamon in improving the conditions of diabetic people by down-regulating the synthesis of pro-inXammatory cytokines. A number of critical issues need to be addressed to support this model of action. First, information is needed on the absorption, metabolism, and plasma concentrations of polyphenols following human and animal consumption of cinnamon. Cell culture studies have suggested that cinnamon polyphenol-like compounds are transported into 3T3-L1 adipocytes [45]. There are other reports describing B-type procyanidin concentrations in the plasma following the consumption of various fruits and vegetables. For example, dimeric procyanidins are detected in human plasma as early as 30 min after the consumption of a Xavanol-rich food such as cocoa [47]. Second, it is unclear about the molecular mechanism of the regulation of gene expression by cinnamon polyphenols in cells, animals, or humans. It is possible that cinnamon polyphenols aVect DNA and/ or RNA directly, just as those reported for tea polyphenols [48]. Third, it is important to identify the physiological target(s) of TTP in cells, animals, and humans. TNF- is a probable target of TTP induced by green tea in rats fed a fructose-rich diet [49]. TTP could aVect a number of other molecular targets since TTP binds and destabilizes a number of ARE-containing mRNAs including TNF-, GMCSF, IL-2, COX-2, and VEGF. Finally, there are some diYculties in extrapolating the results obtained in cultured adipocytes to animals and humans. One problem is that the concentrations of test compounds used in vitro usually exceed those found in plasma or tissues after polyphenol consumption [5]. The bioavailability of dietary polyphenols is critical in their health-promoting activity in vivo, but little information is available in this area. It is therefore diYcult to determine the optimal concentrations of cinnamon polyphenols for in vitro or in vivo studies. We selected a range of concentrations from 1 g/ml to 1 mg/ml of CE or CP in the current studies. Another problem is that the time course of cell culture studies is normally restricted to a
221
relatively short time, while the animal and human studies evaluate chronic eVects of polyphenols. Therefore, caution is needed in the extrapolation of results from cell cultures to animals and humans. In summary, this study reports novel Wndings that cinnamon extract and polyphenols with procyanidin type-A polymers [8] exhibit the potential to increase the amount of TTP, IR, and GLUT4 in 3T3-L1 adipocytes. Real-time PCR assays showed that CE also increased TTP mRNA levels but decreased IR mRNAs, and its eVect on GLUT4 mRNA levels exhibited a biphasic pattern in the adipocytes. Nevertheless, the results reported here suggest that the mechanism of cinnamon’s insulin-like activity may be in part due to increases in the amounts of TTP, IR, and GLUT4 and that cinnamon polyphenols may have additional roles as anti-inXammatory and/or anti-angiogenesis agents. Acknowledgments We greatly appreciate Dr. Perry J. Blackshear (NIH/ NIEHS) for his generous support of the experiments related to TTP and Dr. Harry Dawson for designing the IR and GLUT4 primers and probes. We also thank Meghan Kelly and Noella Bryden for technical assistance, Drs. Joseph Urban, Norberta Schoene, John StriZer, and Allen Smith for valuable discussions and helpful comments on the manuscript. This work was supported in part by USDA-ARS Human Nutrition Research Program and PhytoMedical Technologies, Inc. A preliminary report of this study was presented at the Experimental Biology 2006 in San Francisco, California, on April 1–5, 2006. References [1] J.S. Carter, J.A. Pugh, A. Monterrosa, Ann. Intern. Med. 125 (1996) 221–232. [2] A.M. Gray, P.R. Flatt, Br. J. Nutr. 78 (1997) 325–334. [3] R.A. Dixon, D.Y. Xie, S.B. Sharma, New Phytol. 165 (2005) 9–28. [4] R.L. Prior, L. Gu, Phytochemistry 66 (2005) 2264–2280. [5] C.S. Yang, J.M. Landau, M.T. Huang, H.L. Newmark, Annu. Rev. Nutr. 21 (2001) 381–406. [6] R.A. Anderson, M.M. Polansky, J. Agric. Food Chem. 50 (2002) 7182–7186. [7] C.L. Broadhurst, M.M. Polansky, R.A. Anderson, J. Agric. Food Chem. 48 (2000) 849–852. [8] R.A. Anderson, C.L. Broadhurst, M.M. Polansky, W.F. Schmidt, A. Khan, V.P. Flanagan, N.W. Schoene, D.J. Graves, J. Agric. Food Chem. 52 (2004) 65–70. [9] J. Imparl-Radosevich, S. Deas, M.M. Polansky, D.A. Baedke, T.S. Ingebritsen, R.A. Anderson, D.J. Graves, Horm. Res. 50 (1998) 177–182. [10] K.J. Jarvill-Taylor, R.A. Anderson, D.J. Graves, J. Am. Coll. Nutr. 20 (2001) 327–336. [11] B. Qin, M. Nagasaki, M. Ren, G. Bajotto, Y. Oshida, Y. Sato, Diabetes Res. Clin. Pract. 62 (2003) 139–148. [12] B. Qin, M. Nagasaki, M. Ren, G. Bajotto, Y. Oshida, Y. Sato, Horm. Metab. Res. 36 (2004) 119–125. [13] E.J. Verspohl, K. Bauer, E. Neddermann, Phytother. Res. 19 (2005) 203–206.
222
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
[14] H.G. Preuss, B. Echard, M.M. Polansky, R. Anderson, J. Am. Coll. Nutr. 25 (2006) 144–150. [15] A. Khan, M. Safdar, M.M. li Khan, K.N. Khattak, R.A. Anderson, Diabetes Care 26 (2003) 3215–3218. [16] K. Vanschoonbeek, B.J. Thomassen, J.M. Senden, W.K. Wodzig, L.J. van Loon, J. Nutr. 136 (2006) 977–980. [17] N.W. Schoene, M.A. Kelly, M.M. Polansky, R.A. Anderson, Cancer Lett. 230 (2005) 134–140. [18] J.N. Dhuley, Indian J. Exp. Biol. 37 (1999) 238–242. [19] T. Akira, S. Tanaka, M. Tabata, Planta Med. (1986) 440–443. [20] W.S. Lai, D.J. Stumpo, P.J. Blackshear, J. Biol. Chem. 265 (1990) 16556–16563. [21] M.P. De, Bioessays 26 (2004) 1351–1362. [22] R.T. Watson, M. Kanzaki, J.E. Pessin, Endocr. Rev. 25 (2004) 177–204. [23] P.J. Blackshear, Biochem. Soc. Trans. 30 (2002) 945–952. [24] H. Cao, J.S. Tuttle, P.J. Blackshear, J. Biol. Chem. 279 (2004) 21489–21499. [25] H. Cao, Biochemistry 43 (2004) 13724–13738. [26] H. Cao, F. Dzineku, P.J. Blackshear, Arch. Biochem. Biophys. 412 (2003) 106–120. [27] H.D. Dawson, E. Beshah, S. Nishi, G. Solano-Aguilar, M. Morimoto, A. Zhao, K.B. Madden, T.K. Ledbetter, J.P. Dubey, T. Shea-Donohue, J.K. Lunney, J.F. Urban Jr., Infect. Immun. 73 (2005) 1116–1128. [28] K.J. Livak, T.D. Schmittgen, Methods 25 (2001) 402–408. [29] I. Hininger, R. Waters, M. Osman, C. Garrel, K. Fernholz, A.M. Roussel, R.A. Anderson, Free Radic. Biol. Med. 38 (2005) 1565–1570. [30] H. Cao, L.J. Deterding, J.D. Venable, E.A. Kennington, J.R. Yates III, K.B. Tomer, P.J. Blackshear, Biochem. J. 394 (2006) 285–297. [31] P. Anderson, K. Phillips, G. Stoecklin, N. Kedersha, J. Leukoc. Biol. 76 (2004) 42–47. [32] E. Carballo, W.S. Lai, P.J. Blackshear, Science 281 (1998) 1001–1005. [33] E. Carballo, W.S. Lai, P.J. Blackshear, Blood 95 (2000) 1891–1899.
[34] I. Sauer, B. Schaljo, C. Vogl, I. Gattermeier, T. Kolbe, M. Muller, P.J. Blackshear, P. Kovarik, Blood 107 (2006) 4790–4797. [35] H. Ruan, M.J. Zarnowski, S.W. Cushman, H.F. Lodish, J. Biol. Chem. 278 (2003) 47585–47593. [36] D. Ciais, N. Cherradi, S. Bailly, E. Grenier, E. Berra, J. Pouyssegur, J. LaMarre, J.J. Feige, Oncogene 23 (2004) 8673–8680. [37] A. Hasegawa, M. Yoshino, H. Nakamura, I. Ishii, T. Watanabe, M. Kiuchi, T. Ishikawa, S. Ohmori, M. Kitada, Drug Metab. Pharmacokinet. 17 (2002) 229–236. [38] P.R. Shepherd, B.B. Kahn, N. Engl. J. Med. 341 (1999) 248–257. [39] R. Hernandez, T. Teruel, M. Lorenzo, Biochem. J. 372 (2003) 617–624. [40] A.M. Valverde, P. Navarro, T. Teruel, R. Conejo, M. Benito, M. Lorenzo, Biochem. J. 337 (1999) 397–405. [41] W.T. Garvey, L. Maianu, T.P. Huecksteadt, M.J. Birnbaum, J.M. Molina, T.P. Ciaraldi, J. Clin. Invest. 87 (1991) 1072–1081. [42] Z.W. Yu, J. Buren, S. Enerback, E. Nilsson, L. Samuelsson, J.W. Eriksson, Biochim. Biophys. Acta 1535 (2001) 174–185. [43] B. RoVey, A. Atwal, S. Kubow, Mol. Nutr. Food Res. 50 (2006) 739–745. [44] S. Kannappan, T. Jayaraman, P. Rajasekar, M.K. Ravichandran, C.V. Anuradha, Singapore Med. J. 47 (2006) 858–863. [45] W. Kim, L.Y. Khil, R. Clark, S.H. Bok, E.E. Kim, S. Lee, H.S. Jun, J.W. Yoon, Diabetologia 49 (2006) 2437–2448. [46] L.Y. Wu, C.C. Juan, L.S. Hwang, Y.P. Hsu, P.H. Ho, L.T. Ho, Eur. J. Nutr. 43 (2004) 116–124. [47] R.R. Holt, S.A. Lazarus, M.C. Sullards, Q.Y. Zhu, D.D. Schramm, J.F. Hammerstone, C.G. Fraga, H.H. Schmitz, C.L. Keen, Am. J. Clin. Nutr. 76 (2002) 798–804. [48] T. Kuzuhara, Y. Sei, K. Yamaguchi, M. Suganuma, H. Fujiki, J. Biol. Chem. 281 (2006) 17446–17456. [49] H. Cao, M.A. Kelly, F. Kari, H.D. Dawson, J.F. Urban Jr., S. Coves, A.M. Roussel, R.A. Anderson, J. InXamm. 4 (2007) 1.
Cinnamon extract and polyphenols aVect the expression of tristetraprolin, insulin receptor, and glucose transporter 4 in mouse 3T3-L1 adipocytes Heping Cao ¤, Marilyn M. Polansky, Richard A. Anderson ¤ Nutrient Requirements and Functions Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, US Department of Agriculture, Building 307C, BARC-East, 10300 Baltimore Avenue, Beltsville, MD 20705-2350, USA Received 8 November 2006, and in revised form 20 December 2006 Available online 25 January 2007
Abstract Cinnamon improves glucose and lipid proWles of people with type 2 diabetes. Water-soluble cinnamon extract (CE) and HPLC-puriWed cinnamon polyphenols (CP) with doubly linked procyanidin type-A polymers display insulin-like activity. The objective of this study was to investigate the eVects of cinnamon on the protein and mRNA levels of insulin receptor (IR), glucose transporter 4 (GLUT4), and tristetraprolin (TTP/ZFP36) in mouse 3T3-L1 adipocytes. Immunoblotting showed that CP increased IR levels and that both CE and CP increased GLUT4 and TTP levels in the adipocytes. Quantitative real-time PCR indicated that CE (100 g/ml) rapidly increased TTP mRNA levels by approximately 6-fold in the adipocytes. CE at higher concentrations decreased IR protein and IR mRNA levels, and its eVect on GLUT4 mRNA levels exhibited a biphasic pattern in the adipocytes. These results suggest that cinnamon exhibits the potential to increase the amount of proteins involved in insulin signaling, glucose transport, and anti-inXammatory/anti-angiogenesis response. Published by Elsevier Inc. Keywords: Adipocytes; Angiogenesis; Cinnamon extract; Diabetes; Glucose transporter; InXammation; Insulin receptor; Obesity; Polyphenol; Tristetraprolin
Diabetes has been a subject of extensive research, but the prevention and control of type 2 diabetes mellitus (type 2 DM)1 has not been resolved. Diet has been shown to play an important role in the development of type 2 DM, and the diets commonly consumed in the United States and other developed countries appear to increase the incidence of diabetes [1]. The higher incidences of diabetes in the US are probably due in part to a combination of higher content of reWned sugar and fat and lower intake of traditional herbs, spices, and other plant products. For the majority of people in developing countries, drug treatment for diabetes *
Corresponding authors. Fax: +1 301 504 9062 (H. Cao). E-mail addresses: [email protected], [email protected] (H. Cao), [email protected] (R.A. Anderson). 1 Abbreviations used: ARE, AU-rich element; CE, cinnamon extract; CP, cinnamon polyphenols; DMEM, Dulbecco’s modiWed Eagle’s medium; DMEM+, DMEM plus 10% (v/v) fetal bovine serum, 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine; GLUT4, glucose transporter 4; IR, insulin receptor; TTP, tristetraprolin. 0003-9861/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.abb.2006.12.034
is not feasible and alternative and inexpensive therapies need to be evaluated. Plants have been used for the treatment of diabetes since 1550 BC [2]. Plants are important for the prevention and control of type 2 DM, especially for people with elevated levels of blood glucose and glucose intolerance who have a greater risk of developing diabetes. Plant seeds, fruits, leaves, and bark contain polyphenols. These compounds are the end products of the Xavonoid biosynthetic pathway in plants and are used by plants for the protection against predators [3]. Plant polyphenols are also widely present in the diet [4] and are important for human health [5]. Common spices (cinnamon, cloves, turmeric, and bay leaves) and tea display insulin-like activity in vitro [6,7]. We have identiWed polyphenolic polymers from an aqueous extract of commercial cinnamon that increase glucose metabolism several fold in an epididymal fat cell assay [8]. These cinnamon polyphenols (CP) with doubly linked procyanidin type-A polymers appear to be unique for their insulin-like
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
activity, because other cinnamon compounds display little or no such activity [8]. In addition, none of the other 50 plant extracts tested displayed activity equal to that of cinnamon [7]. Strong evidence suggests that CP exhibit insulin-like activity in cells, animals and people with type 2 diabetes. First, a water-soluble cinnamon extract (CE), like insulin, increases the activity of autophosphorylation of the insulin receptor (IR) and decreases the activity of tyrosine phosphatase in vitro [9]. Second, CP, like insulin, stimulate glucose uptake and glycogen biosynthesis, activate glycogen synthase, and inhibit glycogen synthase kinase-3 [10]. Third, CE potentiates in vivo insulin-regulated glucose utilization via increasing glucose uptake, and prevents insulin resistance induced by a high-fructose diet in rats [11,12]. It also decreases glucose and increases insulin in blood of rats fed diets containing CE [13] and decreases blood pressure [14]. Finally, cinnamon was shown to decrease the levels of glucose, triglycerides, and LDL cholesterol in people with type 2 diabetes [15]. A recent study involving postmenopausal patients with type 2 diabetes under good control for diabetes (mean HbA1c of 7.1–7.4%) did not respond to cinnamon [16]. It is not clear if this lack of a response is due to selection of patients, level of control, oral hypoglycemic agents, diet or type of cinnamon used. Cinnamon polyphenols may have additional beneWts for human health. First, CE has the ability to inhibit cancer cell proliferation by altering the cell cycle pattern in three myeloid cell lines (Jurkat, Wurzburg, and U937) [17]. Second, cinnamon bark was reported to have antioxidant eVects by increasing the activities of antioxidant enzymes including glutathione S-transferase, superoxide dismutase, and catalase in rat livers and hearts [18]. Third, it was reported that CE has anti-ulcerogenic activity by preventing the occurrence of stress ulcers under cold exposure or water-immersion-stress in rats [19]. Finally, it is possible that CP may have anti-inXammatory properties because insulin induces the mRNA levels of the anti-inXammatory protein tristetraprolin (TTP) in mouse cells [20]. Cell cultures have been used as model systems in the studies of the mechanisms of plant polyphenols in animal and human health [5]. Polyphenols have been shown to alter signal transduction pathways in cultured cells [5]. To understand the molecular basis of insulin-like activity and explore additional beneWts of cinnamon polyphenols, we investigated the eVects of CE and CP on the regulation of IR, glucose transporter 4 (GLUT4) and TTP in mouse 3T3-L1 adipocytes. These three proteins are involved in the insulin signaling transduction pathway that functions in insulin receptor substrate activation [21], insulin-regulated glucose transport [22], and anti-inXammatory responses [23], respectively. Materials and methods Cinnamon extract and polyphenols Water-soluble CE was prepared as described previously [8] with modiWcations. BrieXy, ground cinnamon (Cinnamomum burmannii) was suspended in 0.1 N acetic acid. The suspension was autoclaved for 15 min at 15 psi and the supernatant was mixed with four volumes of absolute
215
ethanol and refrigerated overnight. The mixture was Wltered through glass wool and then Whatman No. 1 Wlter paper. The ethanol was removed by rotoevaporation and the remaining solution was freeze-dried. The dried CE was reconstituted at 100 mg/ml in 100% dimethylsulfoxide (DMSO) and diluted with deionized water before being added to the culture medium. CE powder was stored at room temperature and the reconstituted samples were kept at ¡20 °C for long-term storage and at 4 °C for short-time storage. Cinnamon polyphenols were puriWed from CE by high performance liquid chromatography (HPLC) [8]. BrieXy, CE was Wltered through a 0.45 m Wlter before being injected onto a Symmetry Prep C18 column (7.8 £ 300 mm) and separated by reverse phase HPLC at a Xow rate of 4 ml/min using a two-step program: (1) 0–50 min, 92% of 0.05 N HAc and 8% acetonitrile (Fractions 1–6); (2) 51–58 min, gradient to 100% acetonitrile (Fraction 7). Cinnamon polyphenol fractions from HPLC were designated as CP1A, CP1B, CP2, CP3, CP4, CP5, CP6, and CP7. Fractions 2, 4, and 6 have been characterized [8]. CP2 is a procyanidin trimer (Mr 864 Da) (Fig. 1a). CP4 is a tetramer (Mr 1152 Da). CP6 is a trimer with the same molecular mass as CP2 (Mr 864 Da). CP7 is a mixture of monomer (Mr 288 Da) plus other oligomers as determined by mass spectrometry analyses [8]. CP3 and CP5 contained mixtures of trimers and tetramers and the exact identities of CP1A and CP1B were not determined. The fractions were collected and acetonitrile removed by rotoevaporation and freezedried. The freeze-dried samples were reconstituted at 10 mg/ml in 100% DMSO and stored as described above for the storage of CE.
Cell culture Mouse 3T3-L1 Wbroblasts (American Type Culture Collection) were maintained at 37 °C in a humidiWed incubator with 5% CO2 in Dulbecco’s modiWed Eagle’s medium (DMEM) containing 4500 mg/l (25 mM) glucose (Gibco BRL, Gaithersburg, MD) supplemented with 10% (v/v) fetal bovine serum, 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (DMEM+). Adipocyte induction was as described [10]. Mouse 3T3-L1 Wbroblasts (about 0.2 million cells/2-ml medium/well) were grown in 6-well plates under the same conditions for 48–60 h and the medium was replaced with fresh DMEM+. After incubation for another 48–60 h, the medium was replaced with diVerentiation medium containing DMEM+, 1 g/ml of the recombinant human insulin expressed in yeast (Sigma Chemical Co, St. Louis, MO), 0.25 M dexamethasone (Sigma), and 250 M 1-isobutyl-3-methylxanthine (IBMX) (Sigma). Following incubation for 48–60 h, the diVerentiation medium was replaced with DMEM+ containing only 1 g/ml of insulin. After incubation for additional 48–60 h, the medium was replaced with DMEM+ and the cells were grown for an additional 4–6 days. Microscopic observation indicated that approximately 80–90% of the cells accumulated lipid drops (indication of diVerentiation from preadipocytes to adipocytes) (Fig. 1b). The cells were then serum-starved in DMEM without any supplementation for 3–4 h before various chemicals and the vehicle control at its highest concentration were added to the medium for various times as indicated in the “Result” section and the Wgure captions. Two to four independent experiments were performed. Cellular extract was prepared as described below. Mouse macrophage RAW264.7 cells (American Type Culture Collection) were cultured in Eagle’s minimum essential medium (Gibco BRL), and were treated with 0.1 g/ml lipopolysaccharide (LPS) (Sigma) for 2 h [24]. The induced TTP was used as a positive control in SDS–PAGE.
Cell extracts Cell extracts were prepared as described [24] with modiWcations. BrieXy, after washing twice with 0.9% NaCl, 100–150 l of lysis buVer containing 50 mM NaH2PO4, pH 7.6, 250 mM NaCl, 50 mM NaF, 0.5% Nonidet P-40, 1 mM phenylmethylsulfonyl Xuoride, and 0.2% (v/v) of protease inhibitor cocktails (104 mM AEBSF, 0.08 mM aprotinin, 2 mM leupeptin, 4 mM bestatin, 1.5 mM pepstatin A, and 1.4 mM E-64) (Sigma) were added to each well. The cells were scraped and transferred into microfuge tubes and left on ice for about 30 min before being centrifuged at 10,000g for 10 min at 4 °C. The 10,000g supernatant was stored at ¡20 °C.
216
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Fig. 1. Chemical structure of cinnamon polyphenol and morphology of mouse 3T3-L1 adipocytes. (a) The structure of HPLC-puriWed cinnamon polyphenol fraction 2 (CP2) is a doubly linked procyanidin type-A polymer. The structure of cinnamon polyphenol was determined by nuclear magnetic resonance (300 MHz for 1H and 75 MHz for 13C on a Bruker QE Plus 300 NMR spectrometer), mass spectroscopy (electrospray ionization and atmospheric pressure chemical ionization on an LCQ classic ion trap instrument) and infrared spectroscopy as described in reference [8]. (b) DiVerentiated mouse 3T3-L1 adipocytes before treatments used in this study.
Protein concentration determination Protein concentrations were determined with modiWcations using the Protein Assay Dye Reagent Concentrate (Bio-Rad) following NaOH treatment of the samples [25]. BrieXy, protein samples in 96-well plates were treated with 0.5 M NaOH in 20 l for 10 min at room temperature. Then 200 l of the diluted dye reagent (1:5 in water) were added to each well. Following incubation for 10–20 min at room temperature, the absorbance at 595 nm was measured using Bio-Tek Spectrophotometer (Bio-Tek Instruments, Inc., Winooski, VT). Bovine serum albumin from Bio-Rad was used as the protein standard.
Technologies, Palo Alto, CA, USA) with RNA 6000 Ladder as the standards (Ambion, Inc., Austin, TX, USA).
cDNA synthesis The mixture (20 l) contained 5 g total RNA, 2.4 g oligo(dT)12-18 primer, 0.1 g random primers, 500 M dNTPs, 10 mM DTT, 40 u RNaseOUT, 200 u SuperScript II reverse transcriptase (Invitrogen) in 1X Wrststrand synthesis buVer. The synthesis reactions were preceded at 42 °C for 50 min.
PCR primers and TaqMan probes SDS–PAGE and immunoblotting The primers and probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA) and were synthesized by Biosearch Technologies, Inc. (Navato, CA, USA). The gene names, GenBank accession numbers, amplicon sizes, and the sequences (5´ to 3´) of the forward primers, TaqMan probes (TET–BHQ1) and reverse primers, respectively, are described in Table 1.
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS– PAGE) and immunoblotting were performed [26]. BrieXy, proteins were separated by 10% SDS–PAGE and transferred onto nitrocellulose membranes. The membranes were blocked with 5% nonfat dry milk in TTBS buVer, and successively incubated in buVers containing the primary antibodies (1:1000–2000 dilution) overnight and the secondary antibodies (1:10,000 dilution) for 4 h. Proteins on the immunoblots were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) followed by imaging with BioChemi Image Acquisition and Analysis System (UVP BioImaging Systems, UVP Inc, Upland, CA). Typical immunoblotting results were presented in the Wgures. The primary antibodies were anti-IR raised against the synthetic C-terminal peptide of human IR (Santa Cruz Biotechnology, Santa Cruz, CA), anti-GLUT4 raised against the synthetic C-terminal peptide of mouse GLUT4 (Chemicon, Temecula, CA), and anti-MBP-mTTP serum raised against the recombinant full-length mouse TTP fused to Escherichia coli maltosebinding protein [24]. The secondary antibodies were aYnity-puriWed goat anti-rabbit IgG (H+L) horseradish peroxidase conjugate with human IgG absorbed (GAR–HRP, Bio-Rad).
TaqMan reaction mixture (25 l) contained 25 ng of RNA-derived cDNAs, 200 nM each of the forward primer, reverse primer, and TaqMan probe, and 12.5 l of 2£ Absolute QPCR Mix (ABgene House, Epson, Surrey, UK). The reactions were performed in 96-well plates in a ABI Prism 7700 real time PCR instrument (Applied Biosystems) [27]. The thermal cycle conditions were as follows: 2 min at 50 °C and 10 min at 95 °C, followed by 50 cycles at 95 °C for 15 s each and 60 °C for 60 s. Fluorescence signals measured during ampliWcation were considered positive if the Xuorescence intensity was >20-fold greater than the standard deviation of the baseline Xuorescence [27]. The CT method of relative quantiWcation was used to determine the fold change in expression [28].
RNA isolation
Statistical analyses
Mouse cells were washed in 6-well plates twice with 1 ml 0.9% NaCl and lysed directly with 1 ml of TRIZOL reagent (Invitrogen). RNA was isolated according to the manufacturer’s instructions. RNA concentrations and integrity were determined using RNA 6000 Nano Assay Kit and the Bioanalyzer 2100 according to the manufacturer’s instructions (Agilent
The data were analyzed by SigmaStat 3.1 software (Systat Software, Inc., Point Richmond, CA) using One Way Analysis of Variance (ANOVA) and multiple comparisons were performed with Duncan’s Multiple Range Test. Values with diVerent lower case letters displayed above the columns of the Wgures are signiWcantly diVerent at p < 0.05.
Real-time PCR analysis
ACCTGTAACCCCAGAACTTGGA ACCACGTTGTGCAGGTAATCC ACGGCAAATAGAAGGAAGACGTA CCTGGCGTTGGGATTGG AACTCAATATAATCCTGCCTTAGCCTT TCCTCCAGCTCCTTCAGGATCTGAGAGTC TCCGCAACATACTGGAAACCCATGC AGCAGCACAGCTGGCCATCAGAGTC GGTACCCCAGGCTGGCTTT CAAAAGCACAATCAGAGTGAGTATGAC CAACTGGACCTGTAACTTCATCGT AACCGAAAAGCCATTGTAGAAA NM_011756 NM_017071 NM_012751 NM_172086 TTP IR GLUT4 RPL32
70 137 87 66
Forward primer (5´ to 3´) Amplicon (bp) Accession No. Gene
Table 1 Nucleotide sequences of real-time PCR primers and TaqMan probes
TaqMan probe (TET–BHQ1)
Reverse primer (5´ to 3´)
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
217
Results EVect of cinnamon extract and polyphenols on the protein levels of insulin receptor We Wrst examined the steady state levels of IR following initial serum starvation using IR-speciWc antibodies. Immunoblotting showed that IR protein levels were similar in adipocytes harvested in all of the time points tested, from 30 min to 3 h beyond the initial serum starvation, as well as the controls using 0.01–1% of DMSO treatments (data not shown), suggesting that the amount of IR protein was quite constant in mouse 3T3-L1 adipocytes under these experimental conditions. Immunoblotting also showed that IR protein was not detectable in mouse RAW264.7 cells treated with 0.1 g/ml LPS for 2 h under the assay conditions (data not shown). To study the dose eVect of CE on IR, 3T3-L1 adipocytes were treated with 0 (1% DMSO control), 0.01, 0.1, and 1 mg/ml of CE for 0, 0.5, 1, 1.5, 2, and 3 h. The amounts of IR in the cellular extracts were analyzed by immunoblottting. A low concentration of CE (0.01 mg/ml) did not signiWcantly aVect the amount of IR in 3T3-L1 adipocytes (Fig. 2a and b, lanes 1 vs. 2, 5 vs. 6, and 9 vs. 10). However, treatment of the cells with a high concentration of CE (1 mg/ml) resulted in signiWcant reductions of IR levels at all of the time points analyzed, ranging from 30 min to 3 h (Fig. 2a, lanes 8, 12, and Fig. 2b, lanes 4, 8, and 12). The reduction of IR protein in 3T3-L1 adipocytes treated with a high concentration of CE (Fig. 2a and b) might be due to feedback inhibition or inhibitory compounds in the unpuriWed water-soluble CE. We therefore tested the eVects of HPLC-puriWed CP on IR levels in mouse 3T3-L1 adipocytes. Cinnamon polyphenols were collected from HPLC fractions and designated as CP1A, CP1B, CP2 (trimer), CP3 (mixtures of trimers and tetramers), CP4 (tetramer), CP5 (mixtures of trimers and tetramers), and CP6 (trimer, refer to Fig. 1a) as determined by mass spectrometry analyses [8]. Immunoblotting results showed that IR levels in the mouse 3T3-L1 adipocytes were generally increased by most of the CP treatments for 3 h over the 0.1% DMSO control in lane 2 (Fig. 2c and data not shown). This immunoblot also showed that IR levels were decreased by treatment with 1 g/ml LPS (Fig. 2c, lanes 2 vs. 3). To investigate if CE and CP exhibited potential toxicity in 3T3-L1 adipocytes, we incubated the diVerentiated adipocytes with 1 mg/ml CE or 100 g/ml CP (the highest concentrations used in this study) for 4 h. The cells were apparently growing normally because there were no detectable diVerences in the morphology under microscopic observation or the total soluble protein concentrations between the cinnamon-treated and vehicle-treated adipocytes (data not shown). These lines of evidence suggest that the reduction of IR level in high concentrations of CE treatment are not due to general toxicity of the cinnamon compounds but likely due to feedback inhibition of speciWc metabolic and/or signal transduction pathways by the cinnamon compounds.
218
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Fig. 3. EVect of cinnamon extract and polyphenols on the amount of GLUT4 in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes after 3 h treatment were separated by 10% SDS– PAGE, and GLUT4 was detected by immunoblotting with anti-GLUT4 antibodies. Each lane was loaded with 100 g of protein. Lane 1, protein size standard, lane 2, DMSO control (1%); lane 3, CE (10 g/ml); lane 4, CP3 (1 g/ml).
Fig. 2. EVect of cinnamon extract and polyphenols on the amount of IR in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes were separated by 10% SDS–PAGE, and IR was detected by immunoblotting with anti-IR antibodies. Each lane was loaded with 100 g of protein. (a) Adipocytes treated with 0 (1% DMSO control), 0.01, 0.1 or 1 mg/ ml of CE for 0–1 h. Lanes 1–4, CE for 0 h; lanes 5–8, CE for 0.5 h; lanes 9–12, CE for 1 h. (b) Adipocytes treated with 0 (1% DMSO control), 0.01, 0.1 or 1 mg/ml of CE for 1.5–3 h. Lanes 1–4, CE for 1.5 h; lanes 5–8, CE for 2 h; lanes 9–12, CE for 3 h. (c) Adipocytes treated with 1 or 10 g/ml of CP for 3 h. Lane 1, protein size standards; lane 2, DMSO control (0.1%); lane 3, LPS (1 g/ml); lanes 4–5, CP3; lanes 6–7, CP4; lanes 8–9, CP5; lanes 10–11, CP6.
In separate studies, we tested the safety of the cinnamon extracts from 10 to 450 g/ml using keratinocytes on cell viability and DNA damage measured using the Comet assay and the production of 8-hydroxy-2⬘-deoxyguanosine (8-OHdG) [29] and did not detect any signs of toxicity.
protein whose mRNA level is induced by insulin in mouse HIR 3.5 cells [20] but whose protein level related to insulin induction has not been investigated previously in any other system. TTP is an extraordinarily low abundance protein in endogenous tissues or cells. It is normally undetectable and can only be detected after loading mg of total proteins or after strong stimulation by agents such as bacterial endotoxin LPS [24]. Immunoblotting results showed that TTP was barely detectable in untreated cells (Fig. 4, lanes 1 and 5) but was signiWcantly induced by 100 g/ml of CE in 3T3L1 adipocytes after 3 h treatment (lane 3). The puriWed CP3 at 10 and 100 g/ml also increased the amount of TTP in the adipocytes after 3 h treatment, and higher concentrations of CP treatment resulted in more TTP in the adipocytes (Fig. 4, lanes 6–8). The size of TTP induced by CP in the adipocytes was similar to that induced by 0.1 g/ml LPS in mouse RAW264.7 cells (lanes 4 vs. 8).
EVect of cinnamon extract and polyphenols on the protein levels of glucose transporter 4 Immunoblotting showed that the levels of GLUT4 were increased in 3T3-L1 adipocytes following treatment for 3 h with 10 g/ml of the water-soluble CE (Fig. 3, lanes 2 vs. 3). Because of the similar activities of the various HPLC fractions as shown in Fig. 2c and in reference [8], we selected CP3 for this experiment. Immunoblotting showed that CP3 also increased GLUT4 accumulation in 3T3-L1 adipocytes after 3 h treatment (Fig. 3, lanes 2 vs. 4). EVect of cinnamon extract and polyphenols on the protein levels of tristetraprolin To explore other potential beneWts of cinnamon, we investigated the eVects of CE and CP on TTP, an anti-inXammatory
Fig. 4. EVect of cinnamon extract and polyphenols on the amount of TTP in 3T3-L1 adipocytes. Proteins in the 10,000g supernatants of 3T3-L1 adipocytes after 3 h treatment were separated by 10% SDS–PAGE, and TTP was detected by immunoblotting with anti-MBP-mTTP antibodies. Lane 1, DMSO control; lane 2, CE (10 g/ml); lane 3, CE (100 g/ml); lane 4, extract from RAW264.7 cells treated with LPS (0.1 g/ml) for 2 h as a positive TTP control; lane 5, DMSO control (1%); and lane 6–8, CP3 (1, 10, and 100 g/ml, respectively). Lanes 1–3 (100 g of protein); lane 4 (40 g of protein); and lanes 5–8 (80 g of protein).
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
219
(Fig. 5c). The patterns of CE eVects on GLUT4 mRNA levels were opposite between the 90-min and the 120-min treatments. GLUT4 mRNA levels were decreased by CE in the 90-min treated cells but were increased by CE in the 120-min treated adipocytes (Fig. 5c). Discussion
Fig. 5. EVect of cinnamon extract on the mRNA levels of TTP, IR, and GLUT4 in 3T3-L1 adipocytes. (a) TTP mRNA levels, (b) IR mRNA levels, and (c) GLUT4 mRNA levels. Total RNAs were isolated from 3T3-L1 adipocytes treated with DMSO control (0.1%) or CE (10 or 100 g/ml) for 30, 60, 90, and 120 min. Twenty-Wve nanograms of RNA-derived cDNAs were used for quantitative real-time PCR assays. The CT method of relative quantiWcation was used to determine the fold change in expression. The results represent the means and the standard deviations from four determinations. Values with diVerent lower case letters displayed above the columns of the Wgure are signiWcantly diVerent at p < 0.05.
EVect of cinnamon extract on the mRNA levels of tristetraprolin, insulin receptor, and glucose transporter 4 In a time course study, TTP mRNA levels were rapidly increased by CE treatment for 30, 60, 90, and 120 min in the adipocytes (Fig. 5a). TTP mRNA levels in 10 g/ml CEtreated cells were 2.3-, 1.9-, 1.1-, and 1.2-fold of those in the controls, and those in 100 g/ml CE-treated cells were 5.5-, 5.7-, 3.6-, and 3.1-fold of those in the control cells. IR mRNA levels were signiWcantly reduced by a higher concentration of CE (100 g/ml) for 60–120 min treatments (Fig. 5b). CE eVect on GLUT4 mRNA levels exhibited a biphasic response. In the 30- and 60-min treated adipocytes, GLUT4 mRNA levels were not signiWcantly aVected
Plants have been used for the treatment of diabetes since 1550 BC [2]. In search for plant products for diabetic prevention and cure, we and others have shown that common spices (cinnamon, cloves, turmeric, and bay leaves) and tea display insulin-like activity in vitro. We have demonstrated that cinnamon improves glucose and lipid proWles of people with type 2 diabetes [15], and that cinnamon exhibits insulin-like activity in cells, animals and people with type 2 diabetes [8–12,15]. We investigated three of the proteins (IR, GLUT4, and TTP) involved in insulin signal transduction pathway using mouse 3T3-L1 adipocytes to understand the molecular basis for the insulin-like eVects of cinnamon with doubly linked procyanidin type-A polymers. The major Wnding reported in this study is that CE and CP increased the amount of the anti-inXammatory protein TTP and that CE rapidly increased its mRNA levels in 3T3-L1 adipocytes. TTP is an extraordinarily low abundance protein but is induced by agents such as bacterial endotoxin LPS [24]. This study showed, for the Wrst time, that TTP protein was detectable in 3T3-L1 adipocytes and that it was increased by cinnamon, a plant nutritional product. TTP is a hyper-phosphorylated protein [30] with antiinXammatory function through the down-regulation of pro-inXammatory cytokines [23,31]. TTP binds to and subsequently promotes the degradation of those mRNAs encoding pro-inXammatory cytokines such as TNF- and GM-CSF [25,32,33]. The mRNA levels of TTP are dramatically induced by nM concentrations of insulin in minutes [20] but whose protein level related to insulin induction has not been investigated previously in any other system. We showed here that CE and CP increased TTP protein accumulation in 3T3-L1 adipocytes. Furthermore, the induced TTP migrated at higher molecular masses (Mr 40–50,000) than the predicted size (Mr 33,613). The evidence that the apparent 40–50 K protein on the immunoblot is the predicated 33.6 K TTP protein was based on the speciWcity of TTP antibodies and the positive size control of TTP in LPS-stimulated macrophage RAW cells as described in a previous manuscript [24]. Similar size diVerences between the apparent 40–50 K protein on the immunoblot and the predicated 33.6 K TTP were also reported in human TTP [25,30]. The size of TTP in 3T3-L1 adipocytes, similar to that in LPS-stimulated TTP [24] suggests that TTP might be phosphorylated in CE and CP-treated 3T3-L1 adipocytes. Real-time PCR demonstrated that CE increased TTP mRNA levels rapidly within 30-min treatment in the adipocytes. LPS is known to induce TTP expression in mouse macrophage RAW264.7 cells [24]. It has also been shown that up-regulation of TTP limits inXammatory response in
220
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
macrophages [34]. Our preliminary results indicted that TTP expression was not signiWcantly aVected by LPS in mouse 3T3-L1 adipocytes (data not shown). Since adipose cells are shown to be a major source of inXammatory mediators and are responsive to a variety of inXammatory cytokines including TNF- [35], our results reported here suggest a potential role of cinnamon in the prevention of inXammatory conditions in adipose tissues. VEGF mRNA is also a potential target of TTP [36]. Therefore, it is possible that TTP induced by cinnamon in adipocytes may have other eVects such as anti-angiogenesis. The other Wnding is that HPLC-puriWed CP increased IR protein in 3T3-L1 adipocytes and suggests a beneWcial role of CP in insulin signaling. IR is auto-phosphorylated by its kinase domain, which also phosphorylates insulin receptor substrate leading to a signaling cascade [21]. The increased amount of IR reported here and the activation of IR by phosphorylation reported previously [9,10] strongly support the conclusion that CP is involved in insulin signaling. Our results showed that low concentrations of the unpuriWed water-soluble CE did not exhibit a signiWcant eVect on IR protein levels, which is in agreement with a previous report that showed that there is not a signiWcant diVerence in IR levels between rats fed with CE and the control rats fed with saline [11,12]. The inhibitory eVects of high concentrations of CE on IR protein and IR mRNA levels were probably due to minor toxic compounds in the unpuriWed CE or due to feedback inhibition. Our extraction procedure removes a great majority of the toxic lipidsoluble compounds from cinnamon bark [8]. However, the inhibition of IR level in 3T3-L1 adipocytes by high concentrations of the unpuriWed extract may suggest that the
crude extract still contains minor inhibitory compounds such as cinnamaldehyde [37]. Further analyses suggest that the reduction of IR level in high concentrations of CE treatment might not be due to general toxicity of the cinnamon compounds because the cells were grown normally by judging the cell morphology and the total soluble protein content but probably due to feedback inhibition of speciWc metabolic and/or signal transduction pathways by high concentrations of cinnamon compounds. Finally, CE and CP were shown to increase the protein levels of GLUT4 in 3T3-L1 adipocytes. It is well established that insulin promotes translocation of GLUT4 from intracellular compartment to plasma membrane [38]. The amount of GLUT4 can also be regulated by insulin [38–40] and is decreased in obesity [41]. For example, one study showed that GLUT4 level is increased in 3T3-F442A adipocytes by insulin treatment for 16 h [42]. Another study reported that insulin increases GLUT4 mRNA and protein levels in rat fetal brown adipocytes [39,40]. Recently, polyphenolic compounds have been shown to increase both the translocation and the amount of GLUT4. First, CE and CP were shown to increase glucose uptake in 3T3L1 adipocytes [10,43] and in the fructose-fed rat [44]. Second, a synthesized CP-like compound was also reported to enhance glucose uptake and GLUT4 translocation in 3T3L1 adipocytes [45]. Finally, the amount of GLUT4 is increased in fructose-fed rats with green tea supplementation resulting in amelioration of fructose-induced insulin resistance [46]. The increases of GLUT4 protein by CP reported here may therefore suggest a positive eVect of these compounds on the long-term regulation of glucose transport.
Fig. 6. A model of actions by CP and TTP in the insulin signal transduction pathway leading to the beneWcial eVects in people with type 2 diabetes: (1) CP activate IR by increasing their tyrosine phosphorylation activity and by decreasing phosphatase activity that inactivates the receptor [9]; (2) CP increase the amount of IR protein; (3) CP increase the amount of GLUT4 protein; (4) CP increase glycogen synthase activity and glycogen accumulation [10]; (5) CP decrease GSK3 activity [10]; (6) CP increase the amount of TTP protein; (7) CP may increase the activity of TTP by decreasing its phosphorylation through inhibition of GSK3 activity [10]. Refer to the text for more details (“+” represents positive eVect and “¡” represents negative eVect).
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
Based on the results of this study and the published studies, we propose a model of actions by CP and TTP in the insulin signal transduction pathway leading to the beneWcial eVects in people with type 2 diabetes (Fig. 6). Cinnamon polyphenols aVect multiple steps of the pathway: (1) CP activate insulin receptors by increasing their tyrosine phosphorylation activity and by decreasing phosphatase activity that inactivates the receptor [9]; (2) CP increase the amount of IR protein (this study); (3) CP increase the amount of GLUT4 protein (this study); (4) CP increase glycogen synthase activity and glycogen accumulation [10]; (5) CP decrease GSK3 activity [10]; (6) CP increase the amount of the anti-inXammatory protein TTP in the cells (this study); (7) CP may increase the activity of TTP by decreasing its phosphorylation through inhibition of GSK3 activity [10]. All these activities and other potential activities may eventually lead to more eYcient glucose transport and utilization. In addition, CP-induced TTP accumulation in 3T3-L1 adipocytes may provide one of the molecular bases for the beneWcial eVects of cinnamon in improving the conditions of diabetic people by down-regulating the synthesis of pro-inXammatory cytokines. A number of critical issues need to be addressed to support this model of action. First, information is needed on the absorption, metabolism, and plasma concentrations of polyphenols following human and animal consumption of cinnamon. Cell culture studies have suggested that cinnamon polyphenol-like compounds are transported into 3T3-L1 adipocytes [45]. There are other reports describing B-type procyanidin concentrations in the plasma following the consumption of various fruits and vegetables. For example, dimeric procyanidins are detected in human plasma as early as 30 min after the consumption of a Xavanol-rich food such as cocoa [47]. Second, it is unclear about the molecular mechanism of the regulation of gene expression by cinnamon polyphenols in cells, animals, or humans. It is possible that cinnamon polyphenols aVect DNA and/ or RNA directly, just as those reported for tea polyphenols [48]. Third, it is important to identify the physiological target(s) of TTP in cells, animals, and humans. TNF- is a probable target of TTP induced by green tea in rats fed a fructose-rich diet [49]. TTP could aVect a number of other molecular targets since TTP binds and destabilizes a number of ARE-containing mRNAs including TNF-, GMCSF, IL-2, COX-2, and VEGF. Finally, there are some diYculties in extrapolating the results obtained in cultured adipocytes to animals and humans. One problem is that the concentrations of test compounds used in vitro usually exceed those found in plasma or tissues after polyphenol consumption [5]. The bioavailability of dietary polyphenols is critical in their health-promoting activity in vivo, but little information is available in this area. It is therefore diYcult to determine the optimal concentrations of cinnamon polyphenols for in vitro or in vivo studies. We selected a range of concentrations from 1 g/ml to 1 mg/ml of CE or CP in the current studies. Another problem is that the time course of cell culture studies is normally restricted to a
221
relatively short time, while the animal and human studies evaluate chronic eVects of polyphenols. Therefore, caution is needed in the extrapolation of results from cell cultures to animals and humans. In summary, this study reports novel Wndings that cinnamon extract and polyphenols with procyanidin type-A polymers [8] exhibit the potential to increase the amount of TTP, IR, and GLUT4 in 3T3-L1 adipocytes. Real-time PCR assays showed that CE also increased TTP mRNA levels but decreased IR mRNAs, and its eVect on GLUT4 mRNA levels exhibited a biphasic pattern in the adipocytes. Nevertheless, the results reported here suggest that the mechanism of cinnamon’s insulin-like activity may be in part due to increases in the amounts of TTP, IR, and GLUT4 and that cinnamon polyphenols may have additional roles as anti-inXammatory and/or anti-angiogenesis agents. Acknowledgments We greatly appreciate Dr. Perry J. Blackshear (NIH/ NIEHS) for his generous support of the experiments related to TTP and Dr. Harry Dawson for designing the IR and GLUT4 primers and probes. We also thank Meghan Kelly and Noella Bryden for technical assistance, Drs. Joseph Urban, Norberta Schoene, John StriZer, and Allen Smith for valuable discussions and helpful comments on the manuscript. This work was supported in part by USDA-ARS Human Nutrition Research Program and PhytoMedical Technologies, Inc. A preliminary report of this study was presented at the Experimental Biology 2006 in San Francisco, California, on April 1–5, 2006. References [1] J.S. Carter, J.A. Pugh, A. Monterrosa, Ann. Intern. Med. 125 (1996) 221–232. [2] A.M. Gray, P.R. Flatt, Br. J. Nutr. 78 (1997) 325–334. [3] R.A. Dixon, D.Y. Xie, S.B. Sharma, New Phytol. 165 (2005) 9–28. [4] R.L. Prior, L. Gu, Phytochemistry 66 (2005) 2264–2280. [5] C.S. Yang, J.M. Landau, M.T. Huang, H.L. Newmark, Annu. Rev. Nutr. 21 (2001) 381–406. [6] R.A. Anderson, M.M. Polansky, J. Agric. Food Chem. 50 (2002) 7182–7186. [7] C.L. Broadhurst, M.M. Polansky, R.A. Anderson, J. Agric. Food Chem. 48 (2000) 849–852. [8] R.A. Anderson, C.L. Broadhurst, M.M. Polansky, W.F. Schmidt, A. Khan, V.P. Flanagan, N.W. Schoene, D.J. Graves, J. Agric. Food Chem. 52 (2004) 65–70. [9] J. Imparl-Radosevich, S. Deas, M.M. Polansky, D.A. Baedke, T.S. Ingebritsen, R.A. Anderson, D.J. Graves, Horm. Res. 50 (1998) 177–182. [10] K.J. Jarvill-Taylor, R.A. Anderson, D.J. Graves, J. Am. Coll. Nutr. 20 (2001) 327–336. [11] B. Qin, M. Nagasaki, M. Ren, G. Bajotto, Y. Oshida, Y. Sato, Diabetes Res. Clin. Pract. 62 (2003) 139–148. [12] B. Qin, M. Nagasaki, M. Ren, G. Bajotto, Y. Oshida, Y. Sato, Horm. Metab. Res. 36 (2004) 119–125. [13] E.J. Verspohl, K. Bauer, E. Neddermann, Phytother. Res. 19 (2005) 203–206.
222
H. Cao et al. / Archives of Biochemistry and Biophysics 459 (2007) 214–222
[14] H.G. Preuss, B. Echard, M.M. Polansky, R. Anderson, J. Am. Coll. Nutr. 25 (2006) 144–150. [15] A. Khan, M. Safdar, M.M. li Khan, K.N. Khattak, R.A. Anderson, Diabetes Care 26 (2003) 3215–3218. [16] K. Vanschoonbeek, B.J. Thomassen, J.M. Senden, W.K. Wodzig, L.J. van Loon, J. Nutr. 136 (2006) 977–980. [17] N.W. Schoene, M.A. Kelly, M.M. Polansky, R.A. Anderson, Cancer Lett. 230 (2005) 134–140. [18] J.N. Dhuley, Indian J. Exp. Biol. 37 (1999) 238–242. [19] T. Akira, S. Tanaka, M. Tabata, Planta Med. (1986) 440–443. [20] W.S. Lai, D.J. Stumpo, P.J. Blackshear, J. Biol. Chem. 265 (1990) 16556–16563. [21] M.P. De, Bioessays 26 (2004) 1351–1362. [22] R.T. Watson, M. Kanzaki, J.E. Pessin, Endocr. Rev. 25 (2004) 177–204. [23] P.J. Blackshear, Biochem. Soc. Trans. 30 (2002) 945–952. [24] H. Cao, J.S. Tuttle, P.J. Blackshear, J. Biol. Chem. 279 (2004) 21489–21499. [25] H. Cao, Biochemistry 43 (2004) 13724–13738. [26] H. Cao, F. Dzineku, P.J. Blackshear, Arch. Biochem. Biophys. 412 (2003) 106–120. [27] H.D. Dawson, E. Beshah, S. Nishi, G. Solano-Aguilar, M. Morimoto, A. Zhao, K.B. Madden, T.K. Ledbetter, J.P. Dubey, T. Shea-Donohue, J.K. Lunney, J.F. Urban Jr., Infect. Immun. 73 (2005) 1116–1128. [28] K.J. Livak, T.D. Schmittgen, Methods 25 (2001) 402–408. [29] I. Hininger, R. Waters, M. Osman, C. Garrel, K. Fernholz, A.M. Roussel, R.A. Anderson, Free Radic. Biol. Med. 38 (2005) 1565–1570. [30] H. Cao, L.J. Deterding, J.D. Venable, E.A. Kennington, J.R. Yates III, K.B. Tomer, P.J. Blackshear, Biochem. J. 394 (2006) 285–297. [31] P. Anderson, K. Phillips, G. Stoecklin, N. Kedersha, J. Leukoc. Biol. 76 (2004) 42–47. [32] E. Carballo, W.S. Lai, P.J. Blackshear, Science 281 (1998) 1001–1005. [33] E. Carballo, W.S. Lai, P.J. Blackshear, Blood 95 (2000) 1891–1899.
[34] I. Sauer, B. Schaljo, C. Vogl, I. Gattermeier, T. Kolbe, M. Muller, P.J. Blackshear, P. Kovarik, Blood 107 (2006) 4790–4797. [35] H. Ruan, M.J. Zarnowski, S.W. Cushman, H.F. Lodish, J. Biol. Chem. 278 (2003) 47585–47593. [36] D. Ciais, N. Cherradi, S. Bailly, E. Grenier, E. Berra, J. Pouyssegur, J. LaMarre, J.J. Feige, Oncogene 23 (2004) 8673–8680. [37] A. Hasegawa, M. Yoshino, H. Nakamura, I. Ishii, T. Watanabe, M. Kiuchi, T. Ishikawa, S. Ohmori, M. Kitada, Drug Metab. Pharmacokinet. 17 (2002) 229–236. [38] P.R. Shepherd, B.B. Kahn, N. Engl. J. Med. 341 (1999) 248–257. [39] R. Hernandez, T. Teruel, M. Lorenzo, Biochem. J. 372 (2003) 617–624. [40] A.M. Valverde, P. Navarro, T. Teruel, R. Conejo, M. Benito, M. Lorenzo, Biochem. J. 337 (1999) 397–405. [41] W.T. Garvey, L. Maianu, T.P. Huecksteadt, M.J. Birnbaum, J.M. Molina, T.P. Ciaraldi, J. Clin. Invest. 87 (1991) 1072–1081. [42] Z.W. Yu, J. Buren, S. Enerback, E. Nilsson, L. Samuelsson, J.W. Eriksson, Biochim. Biophys. Acta 1535 (2001) 174–185. [43] B. RoVey, A. Atwal, S. Kubow, Mol. Nutr. Food Res. 50 (2006) 739–745. [44] S. Kannappan, T. Jayaraman, P. Rajasekar, M.K. Ravichandran, C.V. Anuradha, Singapore Med. J. 47 (2006) 858–863. [45] W. Kim, L.Y. Khil, R. Clark, S.H. Bok, E.E. Kim, S. Lee, H.S. Jun, J.W. Yoon, Diabetologia 49 (2006) 2437–2448. [46] L.Y. Wu, C.C. Juan, L.S. Hwang, Y.P. Hsu, P.H. Ho, L.T. Ho, Eur. J. Nutr. 43 (2004) 116–124. [47] R.R. Holt, S.A. Lazarus, M.C. Sullards, Q.Y. Zhu, D.D. Schramm, J.F. Hammerstone, C.G. Fraga, H.H. Schmitz, C.L. Keen, Am. J. Clin. Nutr. 76 (2002) 798–804. [48] T. Kuzuhara, Y. Sei, K. Yamaguchi, M. Suganuma, H. Fujiki, J. Biol. Chem. 281 (2006) 17446–17456. [49] H. Cao, M.A. Kelly, F. Kari, H.D. Dawson, J.F. Urban Jr., S. Coves, A.M. Roussel, R.A. Anderson, J. InXamm. 4 (2007) 1.