- Email: [email protected]
Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx 1
Contents lists available at ScienceDirect
European Journal of Pharmaceutics and Biopharmaceutics journal homepage: www.elsevier.com/locate/ejpb
2
Research paper
6 4 7 5
Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound
8
Tinghe Yu a,⇑, Yan Yang a, Jiao Zhang a, Haining He b, Xueyi Ren c
9 10 11 13 12 14 1 2 6 8 17 18 19 20 21 22 23 24 25 26 27
a
Key Medical Laboratory of Obstetrics and Gynecology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing, China Department of Obstetrics and Gynecology, Sichuan Provincial People’s Hospital, Chengdu, China c Chongqing Institute for Food and Drug Control, Chongqing, China b
a r t i c l e
i n f o
Article history: Received 26 November 2014 Accepted in revised form 2 February 2015 Available online xxxx Keywords: Cisplatin resistance Ovarian cancer Ultrasound Cyclosporin A Chemosensitization
a b s t r a c t Cisplatin resistance is a challenge in the treatment of ovarian cancer. The aim of this study was to explore if ultrasound can overcome chemoresistance and enhance chemosensitization due to cyclosporin A. Ultrasound and/or cyclosporin A was employed to overcome cisplatin resistance in human ovarian cancer cell line COC1/DDP. Mechanisms were explored from the perspective of the following: DNA damage, intracellular platinum level, detoxification, and genes related to drug efflux and DNA repair. In vivo therapeutic efficacy was validated in a short-term model (subrenal cell-clot transplantation) in mice and the survival benefit was investigated in an orthotopic cancer model in mice using HO-8910PM cells. The findings were as follows: (i) ultrasound enhanced the effect of cisplatin leading to a lower cell-survival rate (IC50 decreased from 3.19 to 0.35 lg/ml); (ii) ultrasound enhanced cisplatin via direct (increasing the intercellular level of active platinum) and indirect (decreasing the glutathione level, and expression of LRP and ERCC1 genes) mechanisms that intensified cisplatin-induced DNA damage, thus enhancing cell apoptosis and necrosis; (iii) cisplatin followed by ultrasound led to small tumor sizes in the short-term model without exacerbation of the systemic toxicity, and prolonged the survival times in the orthotopic model; and (iv) ultrasound synergized the sensitization due to cyclosporin A in vitro and in vivo. These data demonstrated that ultrasound combined with cyclosporin A overcame cisplatin resistance in ovarian cancer. Ó 2015 Published by Elsevier B.V.
29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
48 49
1. Introduction
50
Cisplatin (DDP) is the first-line chemotherapeutic drug for management of ovarian cancer. Chemoresistance emerges rapidly, and ultimately leads to treatment failure. A satisfactory strategy to overcome chemoresistance is lacking [1]. The chemical modulator cyclosporin A (CsA) has demonstrated impressive results in vitro but produces limited clinical efficacy – the dose required for chemosensitization in vivo is unavailable [2,3]. Therefore, an alternative modality is needed. The cytotoxicity of cisplatin is mediated by the active hydrolysis species. The active species induce the formation of DNA crosslinks, thereby triggering apoptosis. Mechanisms of cisplatin resistance differ from those in multidrug resistance, and are very complex: influx, efflux and detoxification of the drugs, DNA repair, and apop-
51 52 53 54 55 56 57 58 59 60 61 62
⇑ Corresponding author. Key Medical Laboratory of Obstetrics and Gynecology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing 400010, China. Tel.: +86 23 63893711. E-mail address: [email protected] (T. Yu).
tosis malfunction [4,5]. These suggest that a strategy targeting at a specific pathway may not produce efficient sensitization. Ultrasound (US) can enhance the transmembrane delivery of drugs, thereby potentiating the effect of anticancer drugs [6–8]. Ultrasound can be focused on the predetermined deeper volume without harming adjacent tissues, allowing for targeted therapy [9]. The efficacy of sonochemotherapy is dependent upon the drugs and cell type [10]. Indeed, insonation does not improve the therapeutic efficacy in some cancer types if certain drugs are used [6]. With respect to cisplatin, controversial results have been reported. Saad and Hahn reported that insonation (1 W/cm2) did not potentiate cisplatin in Chinese hamster ovary cells HA1 [11]. Bernard et al., however, manifested that ultrasound (0.5 or 1 W/cm2) enhanced the effect of cisplatin to human ovarian cancer cells A2780 [12]. Thus, further investigations are needed to determine whether ultrasound can modulate the anticancer effect of cisplatin. Here we report the results of using ultrasound and/or cyclosporin A to enhance the effect of cisplatin against cisplatinresistant human ovarian cancer cells. Mechanisms were explored from the perspective of the following: mode of cell death,
http://dx.doi.org/10.1016/j.ejpb.2015.02.003 0939-6411/Ó 2015 Published by Elsevier B.V.
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 2
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
88
intracellular platinum level, drug detoxification, DNA damage, and genes related to drug efflux and DNA repair. In vivo anticancer efficacy was validated in a short-term model using mice, and the survival benefit was investigated in a mouse model of orthotopic cancer. The present data suggest that ultrasound combined with cyclosporin A can overcome cisplatin resistance in ovarian cancer.
89
2. Materials and methods
90
2.1. Cells
83 84 85 86 87
cytotoxicity (cell death and DNA damage) and not lead to obvious temperature increase in the cell suspension (i.e., <37 °C during insonation) [17,18]. The setup was also used to conduct in vivo experiments, and the exposure time was 10 min. Insonation was undertaken as described previously [19]. Mice were positioned on a plate with a 2 cm-diameter aperture as ultrasound window. The plate was immersed in degassed water, thereby making ultrasound delivered to the tumor.
141
2.4. Cell viability
150
Cell viability was determined using a tetrazolium assay (Sigma, St. Louis, MO) after 24 h, and the percentage of surviving cells calculated [20]. IC50 was deduced using the software CalcuSyn (Biosoft, Ferguson, MO). The percentages of dead cells (percentage of dead cells = 1 percentage of surviving cells) were used to calculate the combination index (CI), thereby analyzing the interaction between ultrasound and a drug (CI = EA+B/[EA + EB EA EB]; EA+B: effect of the combination; EA/EB: effect of a factor alone). A CI of >1.15, 0.85– 1.15 and <0.85 indicated synergism, addition and antagonism, respectively [10,21].
151
2.5. Apoptosis
162
Flow cytometry was used to detect the sub-G1 peak (indicator of apoptosis) at 24 and 48 h [22]. Cells were analyzed after being treated with RNAse (Sigma) and stained with propidium iodine (Sigma).
163
142 143 144 145 146 147 148 149
109
The cisplatin-resistant human ovarian cancer subline COC1/ DDP (China Center for Typical Culture Collection, Wuhan, China) was used. COC1/DDP was sub-cloned by exposing COC1 to cisplatin with gradually elevated concentration, and had a resistant index of 6.5 referred to the ratio of the half-maximal inhibitory concentrations (IC50) [13]. Cells were cultured in RPMI 1640 medium (Hyclone, Beijing, China) enriched with 10% fetal bovine serum (Hyclone) at 37 °C and 5% CO2; cisplatin (0.5 lg/ml; Qilu Pharm., Jinan, China) was added into the medium to maintain chemoresistance. Cells within the passage number of 30 were used for experiments. Cells were transferred to cisplatin-free medium 2 days before experiments. Single-cell suspensions were prepared, and the concentration was adjusted to 1.0 106 cells/ml. All in vitro experiments were carried out in triplicate. The highly metastatic human ovarian cancer cell line HO8910PM (Cell Bank of Chinese Academy of Sciences, Shanghai, China) was used to establish a model of orthotopic cancer [14]. Cells were cultured as described above but without cisplatin.
110
2.2. Treatments
2.6. Mitochondrial membrane potential
167
111
The mitochondrial membrane potential was measured at 24 h. Cells were stained with JC-1 (ALEXIS Biochem., San Diego, CA), and assayed with a flow cytometer. The ratio of red-to-green fluorescence reflected the potential [23].
168
2.7. Caspase-3 and caspase-9
172
The activity of caspase-3 and caspase-9 was determined by a colorimetric assay (BioVision, Mountain View, CA) as the instruction manual at 24 h. Briefly, cytosolic extract was prepared, and the substrate was added. Absorbance at 405 nm reflected the activity of enzymes.
173
2.8. High mobility group box 1 (HMGB1)
178
The biochemical marker of cell necrosis HMGB1 in the culture supernatant was determined with an enzyme-linked immunosorbent assay (Shino-Test, Kanagawa, Japan) at 12, 24 and 48 h [24].
179
129
Four treatment groups were created as follows: cisplatin only (DDP); cisplatin followed by ultrasound (DDP + US); cisplatin combined with cyclosporin A (DDP + CsA); cisplatin and cyclosporin A followed by insonation (DDP + CsA + US). Control cells were sham-insonated. Insonation was carried out immediately after drug administration. Cells were maintained at 37 °C for 3 h, and then chemicals were washed away with phosphate-buffered saline (PBS). Hence, the peak concentrations and areas under the concentration–time curves of cisplatin and cyclosporin A were within the range of human pharmacokinetics [10,15]. Fresh medium was added and cells maintained at 37 °C before assays. The concentration of cyclosporin A (Sandoz, Basel, Switzerland) was 20 lg/ml. This level did not cause cytotoxicity and can circumvent cisplatin resistance [16]. The concentrations of cisplatin were 0.1, 0.5, 1, 5 and 10 lg/ml in the cell-survival experiment, and 1 lg/ml in other trials. When exploring the expression of glutathione S-transferase (GST), glutathione (GSH) and genes, cells were treated in a similar manner but without cisplatin.
2.9. Intracellular accumulation of platinum
182
130
2.3. Ultrasound exposure Cell suspensions were insonated using a focused ultrasound device (Inst. Acoust., Nanjing University, Nanjing, China) as described previously [17]. A 60 mm-diameter transducer with a focal length of 70 mm, was mounted at the bottom of a tank filled with degassed water. A polyethylene chamber containing 1.0 ml of single-cell suspension was placed into the focus of transducer, thereby making cells exposed to insonation. The spatial average temporal average intensity was 2.0 W/cm2 in continuous waves with a frequency of 1.0 MHz. The duration of exposure for in vitro trials was 60 s. Such a level of insonation did not cause
A short-term accumulation assay was carried out [25]. Cells were washed with PBS after 1-h incubation with cisplatin (5.0 lg/ml) and homogenized in an ice bath. Cell lysates were centrifuged and supernatants prepared. Total platinum was measured with atomic absorption spectrophotometry; active platinum was derivatized with sodium diethyldithiocarbamate, and then detected with high-performance liquid chromatography (HPLC) using the Agilent 1100 system (Santa Clara, CA) [26]. A Zorbax Rx-C18 column (4.6 250 mm, particle size 5 lm; Agilent) was used. The mobile phase was methanol and water (80:20) at a flow rate of 0.8 ml/min. The eluate was detected at 254 nm. The
183
131
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108
112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
132 133 134 135 136 137 138 139 140
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
152 153 154 155 156 157 158 159 160 161
164 165 166
169 170 171
174 175 176 177
180 181
184 185 186 187 188 189 190 191 192 193
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx 194 195
percentage of active form was calculated to assess the activation of cisplatin within cells.
196
2.10. GST and GSH
197
Cells were harvested at 24 h, and cytosolic fractions prepared. GST activity was determined using 1-chloro-2,4-dinitrobenzene as the substrate (Sigma) [27]. Total and reduced GSH were detected with the 5,50 -dithio-bis(2-nitrobenzoic acid)-glutathione reductase recycling assay (Sigma) [28]. The level of the oxidized form was calculated by subtracting the value of the reduced form from that of total GSH. Protein was determined using the Lowry assay. Levels of GST and GSH were expressed as mmol/mg protein.
198 199 200 201 202 203 204
205
2.11. DNA damage detected by the comet assay
206
DNA damage was detected with the alkaline comet assay at 12 and 24 h. The comets were stained with DAPI (Mol. Probes, Eugene, OR) and observed under a fluorescence microscope. The percentage of comets formed reflected the degree of DNA damage [18].
207 208 209
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235
2.12. Determination of gene expression with reverse transcriptionquantitative polymerase chain reaction (RT-qPCR) and western blotting The expression of genes for multidrug resistance 1 (MDR1), multidrug resistance-related protein (MRP), breast cancer resistance protein (BCRP), lung resistance protein (LRP) and excision repair cross-complementing group 1 (ERCC1) was assayed with RT-qPCR (iScript select cDNA synthesis, and SsoFast EvaGreen supermix kits; Bio-Rad, Hercules, CA) as the manufacturer protocol at 12, 24, 48 and 72 h; the B2M gene was the reference. Primers were as follows: CCACAGAGGGGATGGTCAG and TAGGCATTGGC TTCCTTGAC for MDR1, CACCACCTCCTTCTGTCATCAA and GGCACCT ATAACCAGTCCCAGTA for BCRP, CGTCTACTTTTCCCTCTTAC and CTTCTTCCAGTTCTTTACCA for MRP, TGCTGAGGTGGAGGTGAAG and ATCGGTGATGAGGGTTGATTTC for LRP, CCTCAGCCTCTCAAGT AG and GAGGTCAGGAGTTCAAGA for ERCC1, and GGGTTTCATC CCTCCGACATT and ACGGCAGGCATACTCATCTTTT for B2M. Based on the findings in RT-qPCR, LRP and ERCC1 proteins were analyzed with western blotting at 24, 48 and 72 h, using mouse monoclonal antibodies (Santa Cruz Biotechnol., Santa Cruz, CA). Proteins were extracted, separated by SDS–PAGE, and transferred onto a PVDF membrane; primary and secondary antibodies were added, and then the target protein was visualized with an enhanced chemiluminescence assay. b-actin was detected with a rabbit polyclonal antibody (Santa Cruz Biotechnol.), and served as the reference.
236
2.13. In vivo therapeutic trials
237
The use of animals was approved by Chongqing Medical University (Chongqing, China) in compliance with the Guide for the Care and Use of Laboratory Animals. Experiments were carried out in seven groups of five mice: cisplatin (DDP); insonation (US); cyclosporin A (CsA); cisplatin followed by insonation (DDP + US); combination of cisplatin and cyclosporin A (DDP + CsA); combination of cisplatin and cyclosporin A followed by insonation (DDP + CsA + US); control mice received normal saline. The tumor was subjected to insonation 15 min after drug administration. The interval was determined according to the pharmacokinetics of cisplatin in mice [29].
238 239 240 241 242 243 244 245 246 247 248
3
2.14. Efficacy in a model of subrenal tumor transplantation
249
A cancer model was established in cyclophosphamide-immunosuppressed female BALB/C mice (6–8 weeks; 17–25 g; Center for Laboratory Animals, Chongqing Medical University) by subrenal clot transplantation using COC1/DDP cells [30]. Fibrin cell clot was formed by adding fibrinogen and thrombin into the cell suspension, and then cut into pieces (1 1 1 mm3). A piece was surgically introduced into the subrenal capsule. Chemoresistance was preserved in this animal model [31]. Treatments were performed on days 2, 3, 5 and 6. Cisplatin (2 mg/kg) and cyclosporin A (100 mg/kg) were administered via the intraperitoneal route. Mice were sacrificed on day 7. The length (L, mm) and width (W, mm) of a tumor were calibrated under a stereomicroscope, and the volume (V, mm3; V = (L W2)/2) and diameter (D, mm; D = (L + W)/2) were calculated to evaluate the therapeutic outcome [19]. Cancer tissues underwent pathological examinations. Animal body masses and blood tests (erythrocyte, leukocyte, platelet and serum creatinine) at day 7 were used to assess the systemic toxicity. The tumor inhibitory rates (inhibitory rate = [tumor size in control group tumor size in treatment group]/tumor size in control group) were calculated, and then CI was deduced to determine the ultrasound–drug interaction as described in the section of cell death [10,21].
250
2.15. Survival in an orthotopic model of cancer
273
An orthotopic ovarian cancer was established in female BALB/C nude mice (4–6 weeks; Center of Laboratory Animals, Chongqing Medical University) using HO-8910PM cells as described previously [32]. This was because ovarian tumor cannot form using COC1/DDP cells, and HO-8910PM cells displayed chemoresistance [33]. HO-8910PM cells were injected subcutaneously, and a tumor formed after 6 weeks. The tumor was removed and cut into slices (1 1 1 mm3). A slice was surgically introduced into the ovary of another mouse, and the ovary was enwrapped using absorbable hemostatic gauze in which the major ingredient was cellulose. An ovarian cancer that could be palpated on the abdomen formed after 60 days. Mice were randomly divided into experimental groups. Animals were managed as described in the section on subrenal transplant tumors. The dose of cisplatin was 2 mg/kg and that of cyclosporin A was 20 mg/kg. Treatment was administered every week and each mouse received it four times. Animals were followed up until death.
274
2.16. Statistical analyses
292
All data were processed using the SAS software (SAS Inst., Cary, NC, USA). Percentages were normalized with arc-sine transformation. Analysis of variance was adopted, and multiple comparisons corrected using the Student–Newman–Keuls test. The survival time was analyzed with the Kaplan–Meier method. p < 0.05 was considered significant.
293
3. Results
299
3.1. Ultrasound enhanced cisplatin-induced cell death
300
Cell survival was decreased in groups DDP + US, DDP + CsA and DDP + CsA + US compared with group DDP (p < 0.0001). The percentage of surviving cells in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA (p < 0.05) (Fig. 1A). IC50 values were 3.19, 0.35, 0.65 and 0.09 lg/ml in groups DDP, DDP + US,
301
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272
275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291
294 295 296 297 298
302 303 304 305
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 4
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 1. Percentages of surviving cells (A): the number of surviving cells was decreased in groups DDP + US, DDP + CsA and DDP + CsA + US compared with group DDP; the percentage in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA. Apoptosis (B): higher percentages were noted in groups DDP + US, DDP + CsA and DDP + CsA + US at 24 and 48 h. Mitochondrial membrane potentials detected with the JC-1 assay (C): the potential was decreased in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US. Levels of activated caspase-3 and caspase-9 (D): caspases were activated in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US; absorbencies in groups DDP + US, DDP + CsA and DDP + CsA + US were higher than those in group DDP. Levels of HMGB1 (E): value in group DDP + US, DDP + CsA or DDP + CsA + US was higher than that in group DDP. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05.
306 307 308 309 310
DDP + CsA and DDP + CsA + US, respectively. CI showed synergism between cisplatin and ultrasound/cyclosporin A, and that ultrasound synergized the effect of cisplatin combined cyclosporin A (Table 1). These findings indicated that ultrasound enhanced cell death induced by cisplatin.
311
3.2. Ultrasound enhanced cisplatin-induced cell apoptosis
312
The percentage of apoptotic cells in groups DDP + US, DDP + CsA and DDP + CsA + US was higher than that in group DDP at 24 and 48 h (p < 0.0001, p < 0.0001). The percentage in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA (25.3 ± 0.4% vs. 12.6 ± 0.4%/18.9 ± 1.0% at 48 h, p < 0.05) (Fig. 1B). The JC-1 assay indicated that mitochondrial membrane potential was decreased in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US (p = 0.0005) (Fig. 1C). Activation of caspase-3 and caspase-9 was observed in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US. Absorbencies in groups DDP + US, DDP + CsA and DDP + CsA + US were higher than those in group DDP (p = 0.0001, p < 0.0001) (Fig. 1D). These findings suggested that ultrasound enhanced cell apoptosis induced by cisplatin.
313 314 315 316 317 318 319 320 321 322 323 324 325 326
Table 1 List of combination indices (CI). Combination
DDP and US DDP and CsA DDP + CsA and US a b
In vitro
1.43 (1.21–1.95)a 1.30 (1.06–1.66)a,b 1.42 (1.24–1.87)a
Synergism. CI was 1.06 at 0.05 lg/ml cisplatin.
In vivo Volume
Diameter
2.89a 1.52a 1.40a
2.92a 2.25a 1.96a
3.3. Ultrasound enhanced cisplatin-induced cell necrosis
327
The HMGB1 level was increased in groups DDP + US, DDP + CsA and DDP + CsA + US at 12–48 h compared with group DDP (p < 0.0001, p < 0.0001, p < 0.0001). The value in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA at 24 and 48 h (p < 0.05) (Fig. 1E). These findings showed that ultrasound enhanced cell necrosis due to cisplatin.
328
3.4. Ultrasound increased the intracellular accumulation of active platinum
334
Higher levels of total platinum occurred in groups DDP + US and DDP + CsA + US compared with group DDP (p = 0.0004), and HPLC demonstrated an increase of active platinum in those two groups (p = 0.0033) (Fig. 2A). The percentages of active form were 58.6 ± 1.1%, 62.4 ± 1.5%, 59.2 ± 3.7% and 59.7 ± 1.0% in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US, respectively (p = 0.2860); the value in COC1/DDP cells was <75% (p < 0.0001), the percentage of active platinum observed in human pharmacokinetics [26]. The high expression of transporter genes favored drug efflux, thereby decreasing the level of intracellular drugs. The expression of MDR1, MRP, BCRP and LRP was determined with RT-qPCR. No variations were detected in the mRNA levels of MDR1, MRP and BCRP (p = 0.0845–0.7165, p = 0.0805–0.7433, p = 0.1212–0.3683) (Fig. 2B–D). Level of LRP mRNA was decreased in groups US, CsA and CsA + US at 12–48 h (p < 0.0001, p < 0.0001, p < 0.0001), with the lowest value seen in group CsA + US; the level in group CsA was lower than that in group US (p < 0.05). LRP returned to the baseline level at 72 h (p = 0.9675) (Fig. 3A). LRP protein was validated using western blotting. Lower expression of LRP protein was detected in groups US, CsA and CsA + US at 24 and 48 h (p < 0.0001, p = 0.0035), with the lowest level seen in group CsA + US; the level in group CsA was lower than
336
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
329 330 331 332 333
335
337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
5
Fig. 2. Intracellular accumulation of total and active platinum (A): higher levels were detected in groups DDP + US and DDP + CsA + US. a, vs. DDP, p < 0.05; b, vs. DDP + US, p < 0.05; c, vs. DDP + CsA, p < 0.05. Expression of genes of MDR1 (B), MRP (C) and BCRP (D) assayed by RT-qPCR: no significant variations were detected. Levels of GST and GSH (E): GST level did not significantly differ between groups; levels of total and reduced GSH were decreased in groups US, CsA and CsA + US, with the lowest level seen in group CsA + US. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. US, p < 0.05; c, vs. CsA, p < 0.05.
366
that in group US at 24 h (p < 0.05). No difference was detected between groups at 72 h (p = 0.0995) (Fig. 3C). GST and GSH were the antidotes for cisplatin. The GST level did not differ significantly between groups (p = 0.4856). Levels of total and reduced GSH were decreased in groups US, CsA and CsA + US (p < 0.0001, p < 0.0001), with the lowest level in group CsA + US (Fig. 2E). These findings showed that ultrasound increased the intracellular level of active platinum.
367
3.5. Ultrasound enhanced cisplatin-induced DNA damage
368
More comets were detected in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 and 24 h compared with group DDP (p = 0.0011, p = 0.0093). The percentage of comets formed in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA at 12 h (p < 0.05) (Fig. 4). An increased capacity of DNA repair protected cells from DNA damage, and ERCC1 was the gene up-regulating DNA repair. The mRNA level of ERCC1 was decreased in groups US, CsA and CsA + US at 12–48 h (p < 0.0001, p < 0.0001, p < 0.0001), and the lowest level occurred in group CsA + US; the level in group CsA was lower than that in group US (p < 0.05). No difference was noted between groups at 72 h (p = 0.0935) (Fig. 3B). ERCC1 protein was decreased in groups US, CsA and CsA + US at 24 h (p < 0.0001), and in group CsA + US at 48 h (p = 0.0034); the level in group CsA + US was lower than that in group US or CsA (p < 0.05); the level of ERCC1 protein in group CsA was less than that in group US at 24 h (p < 0.05). No difference was observed between groups at 72 h (p = 0.1544) (Fig. 3C). These findings showed that ultrasound enhanced DNA damage induced by cisplatin.
359 360 361 362 363 364 365
369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387
388 389 390 391 392
3.6. Ultrasound enhanced the anticancer effect of cisplatin in a subrenal tumor model in mice Tumor necrosis was detected upon treatment with cisplatin, without or with insonation (Fig. 5A–C). Smaller tumor volumes and diameters were noted in groups DDP, DDP + US, DDP + CsA
and DDP + CsA + US (p = 0.0004, p < 0.0001). The diameter in group DDP + CsA + US was less than that in group DDP, DDP + US or DDP + CsA (0.44 ± 0.36 vs. 1.65 ± 0.25, 1.18 ± 0.43, or 1.16 ± 0.15 mm, p < 0.05) (Fig. 5D). CI showed that synergism occurred between cisplatin and ultrasound/cyclosporin A, and that ultrasound synergized the effect of the combination of cisplatin and cyclosporin A (Table 1). Animal body mass, counts of erythrocyte, leukocyte and platelet, and serum creatinine were not with significant differences between groups (p = 0.0767, p = 0.8622, p = 0.9917, p = 0.6575, p = 0.1126) (Table 2). These findings indicated that ultrasound enhanced the anticancer effect of cisplatin in vivo, and not exacerbate the systemic toxicity of cisplatin and cyclosporin A.
393
3.7. Ultrasound prolonged the survival time in mice with orthotopic ovarian cancer
406
Mean survival times were 29.0 ± 7.6 (19–38), 32.0 ± 10.5 (15– 42), 40.8 ± 12.6 (25–60), 58.2 ± 9.7 (43–67), 60.6 ± 10.1 (43–67), 71.2 ± 13.1 (60–89) and 95.6 ± 6.9 (89–106) days in groups control, US, CsA, DDP, DDP + US, DDP + CsA and DDP + CsA + US, respectively (p < 0.0001). The survival time was prolonged in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US compared with group control (p < 0.05). The survival time in group DDP + CsA + US was longer than that in group DDP, DDP + US or DDP + CsA (p < 0.05) (Fig. 5E). These data indicated that ultrasonic chemotherapy prolonged the animal survival.
408
4. Discussion
418
The percentage of survival cells and IC50 was deceased upon the use of ultrasound, and CI showed synergism. The peak concentrations and areas under the concentration–time curves of cisplatin and cyclosporin A were within the range of clinical pharmacokinetics [10,15]. Free radicals due to cavitation (particularly under an intensity of >104 W/cm2) can destroy drug molecules, thereby decreasing the anticancer potency [34]. Intensity was low in this study, i.e., generating far fewer reactive radicals; this favored the
419
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
394 395 396 397 398 399 400 401 402 403 404 405
407
409 410 411 412 413 414 415 416 417
420 421 422 423 424 425 426
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 6
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 3. Expression of genes of LRP (A) and ERCC1 (B) assayed by RT-qPCR: the levels of mRNA were decreased in groups US and CsA at 12–48 h, with the lowest value in group CsA + US, and returned to the baseline levels at 72 h. Expression of LRP and ERCC1 proteins validated with western blotting (C): lower level was noted after exposure to ultrasound and/or cyclosporin A at 24 and 48 h; no difference was detected between groups at 72 h. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. US, p < 0.05; c, vs. CsA, p < 0.05.
Fig. 4. Percentages of comets formed: higher values were observed in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 and 24 h. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05. 427 428 429 430 431
preservation of potency of drugs. Thus, the present data were clinically relevant, and manifested that ultrasound overcame resistance. Higher apoptosis rates were observed in groups DDP + US, DDP + CsA and DDP + CsA + US. The activity of caspase-3 displayed
similar variations. The data demonstrated a mechanism of sensitization due to ultrasound and/or cyclosporin A. The activation of caspase-9 and collapse of the membrane potential manifested that apoptosis occurred via the mitochondrial pathway. However, the percentage of apoptotic cells was far less than that of dead cells (the percentage of dead cells was 57.7% in group DDP + US but that of apoptotic cells was 16.4%), suggesting that enhancement of apoptosis was not the sole mechanism of sensitization. A higher level of HMGB1 upon use of ultrasound demonstrated the occurrence of cell necrosis [24]. These data supported our previous hypothesis: ultrasound sensitized cells, which decreased the necrosis threshold and therefore cells underwent necrosis directly; however, those cells would undergo apoptosis when exposed to anticancer drugs alone [6]. An increase of HMGB1 level in group DDP after 24 h showed that cisplatin could induce cell necrosis, which accorded with the previous verdict [35]. Therefore, ultrasound enhanced cisplatin via enhancing apoptosis and necrosis induced by cisplatin. The accumulation assay manifested that only a portion of platinum can be transformed into the active form, and that higher intracellular levels of total/active platinum occurred in groups DDP + US and DDP + CsA + US. The increase was mediated by cavitation. Cavitation produced microjets, microstreaming and free radicals that can permeabilize the cell membranes, thereby facili-
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 7
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 5. Representative pathologic results of COC1/DDP tumors (200): cancer cells were intact in control tumor (A), and necrotized if subjected to cisplatin without or with insonation (B and C); T, tumor; the scale bar was 50 lm. Tumor sizes in the subrenal cancer model (C; data were mean ± standard deviation for 5 mice): small tumor sizes were detected in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US; the tumor diameter in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA. Survival curves in an orthotopic cancer model (D; n = 5): the survival time was prolonged in group DDP, DDP + US, DDP + CsA or DDP + CsA + US compared with group control, with the longest survival time seen in group DDP + CsA + US. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article) Table 2 Systemic toxicity determined by body mass and blood tests. Group
Control US CsA DDP DDP + US DDP + CsA DDP + CsA + US
456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477
Body mass (g)
16.8 ± 0.2 16.8 ± 0.2 16.8 ± 0.3 16.6 ± 0.4 16.4 ± 0.4 16.4 ± 0.2 16.4 ± 0.3
Blood Erythrocyte (1012/l)
Leukocyte (109/l)
Platelet (109/l)
Creatinine (lmol/l)
8.5 ± 0.6 8.3 ± 0.5 8.1 ± 0.3 8.1 ± 0.7 8.2 ± 0.5 7.9 ± 0.5 8.3 ± 0.5
6.6 ± 1.4 6.4 ± 1.3 6.1 ± 2.1 5.8 ± 1.9 6.5 ± 1.5 6.4 ± 1.7 6.0 ± 2.2
864 ± 159 928 ± 44 816 ± 157 827 ± 111 852 ± 124 777 ± 159 815 ± 200
12.2 ± 1.4 11.1 ± 1.4 11.5 ± 0.8 12.8 ± 1.7 12.1 ± 1.7 10.6 ± 1.3 11.0 ± 2.1
tating drug influx (intracellular cavities detected in our previous study demonstrated the occurrence of cavitation) [6–8,36]. The percentage of active platinum in COC1/DDP cells was less than that in human pharmacokinetics, indicating a lower transformation rate within cells, which played a role in resistance. Percentages of active form suggested that ultrasound and cyclosporin A cannot exert on the bioactivation of cisplatin within cells. The intracellular drug level was not increased in group DDP + CsA despite a lower cell-survival rate in this group. Cyclosporin A increased the intracellular drug level by decreasing efflux, which was realized by down-modulating the level of transporter genes (i.e., requiring a delay) [3,37]. Variations were detected only in LRP – ultrasound and/or cyclosporin A decreased the expression. The role of transporter genes varied between cell types [4,38]. These data suggested that LRP was involved in resistance in COC1/DDP cells. The suppression of LRP (verified by RT-qPCR and western blotting) decreased drug efflux thereby prolonging the retention of drugs within cells. Thus, ultrasound increased the intracellular drug level and its duration, particularly combined with cyclosporin A. The GSH level was decreased when using insonation and/or cyclosporin A. This effect can preserve active platinum since GSH can inactivate platinum [4]. GSH may play a part in the lower
transformation rate of platinum within cells. Active radicals due to cavitation attacked hydrosulfuryl groups and unsaturated bonds to demolish molecules [34]. A chemical GSH inhibitor (e.g., buthionine sulfoximine) had limited use because of toxicities due to a lack of selectivity for tumor tissues [39]. The denaturation of GSH can be confined to the tumor as ultrasound can be focused on the target volume, which can improve the therapeutic effect and decrease toxicity as well. The lowest level in group CsA + US indicated synergism between ultrasound and cyclosporin A. Cyclosporin A inhibited the synthesis and ultrasound directly destroyed molecules, thereby extinguishing GSH [16,34]. More comets were detected in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 h, followed by an increase in apoptosis rate. The findings suggested that severer DNA damage was induced with the use of ultrasound, leading to apoptosis. Cisplatin-resistant cells had an improved capacity of DNA repair, which was mediated by ERCC1 [5]. RT-qPCR and western blotting demonstrated a decrease in the ERCC1 expression if applying ultrasound and/or cyclosporin A. This effect debased the capacity of DNA repair, thereby making cells undergo irreversible damage under cisplatin causing apoptosis/necrosis. Mechanisms of modulation of gene expression with ultrasound remained unclear. Lower levels of LRP and ERCC1 in
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 8
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
533
group CsA suggested that ultrasound was a weaker gene modulator compared with cyclosporin A. This feature as well as the temporal pattern of gene modulation should be considered, when developing biomedical applications of ultrasound. In vitro data showed that ultrasound enhanced cisplatin directly (increasing the intracellular level of active drugs) and indirectly (quenching GSH, and modulating the expression of LRP and ERCC1), and that cyclosporin A sensitized cisplatin via modulation of GSH and genes. Consequently, sensitization attributable to ultrasound emerged immediately and that due to cyclosporin A appeared after a certain interval; the combination of ultrasound and cyclosporin A produced stronger and longer chemosensitization. The reduction in tumor size in the short-term model indicated that ultrasound was effective in vivo. The smallest tumor diameter was detected in group DDP + CsA + US and CI was >1.15, which showed synergism between ultrasound and cyclosporin A with regard to sensitization. Another noticeable result was that ultrasound did not exacerbate the systemic toxicity due to cisplatin and cyclosporin A. The data in orthotopic cancer model indicated that the addition of ultrasound and cyclosporin A prolonged the survival time due to cisplatin. The model using HO-8910PM cells engendered an ovarian mass, intraperitoneal spread and distant metastasis, thereby reflecting the biological behavior of human ovarian cancer [32]. The insonation time showed that ultrasound led to temperature rise (>37 °C) [17]. Heat can enhance chemotherapy via permeabilizing cell membranes [6]. Therefore, sensitization in vivo was the combination effect of ultrasonic heat and cavitation. These effects increased the drug level within the tumor, thereby improving the therapeutic efficacy. In summary, the present findings demonstrated that ultrasound enhanced cisplatin against chemoresistant cells and synergized the sensitization due to cyclosporin A. These suggested a strategy for the treatment of cisplatin-resistant ovarian cancer.
534
Conflict of interest
500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532
535
None declared.
536
Acknowledgments
537 539
This work was supported with Grants from the Natural Science Foundation of China (11174376, 31470822) and the State Ministry of Education (SRFDP 20135503130002).
540
References
541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565
[1] M.A. Bookman, First-line chemotherapy in epithelial ovarian cancer, Clin. Obstet. Gynecol. 55 (2012) 96–113. [2] H. Lage, C. Denkert, Resistance to chemotherapy in ovarian carcinoma, Recent Results Cancer Res. 176 (2007) 51–60. [3] H. Morjani, C. Madoulet, Immunosuppressors as multidrug resistance reversal agents, Methods Mol. Biol. 59 (2010) 433–446. [4] R. Agarwal, S.B. Kaye, Ovarian cancers: strategies for overcoming resistance to chemotherapy, Nat. Rev. Cancer 3 (2003) 502–516. [5] L. Galluzzi, L. Senovilla, I. Vitale, J. Michels, I. Martins, O. Kepp, M. Castedo, G. Kroemer, Molecular mechanisms of cisplatin resistance, Oncogene 31 (2012) 1869–1883. [6] T. Yu, S. Li, J. Zhao, T.J. Mason, Ultrasound: a chemotherapy sensitizer, Technol. Cancer Res. Treat. 6 (2006) 51–60. [7] T.J. Evjen, E. Hagtvet, A. Moussatov, S. Rønvaldsson, J.L. Mestas, R.A. Fowler, C. Lafon, E.A. Nilssen, In vivo monitoring of liposomal release in tumours following ultrasound stimulation, Eur. J. Pharm. Biopharm. 84 (2013) 526–531. [8] D. Huang, L. Wang, Y. Dong, X. Pan, G. Ge, C. Wu, A novel technology using transscleral ultrasound to deliver protein loaded nanoparticles, Eur. J. Pharm. Biopharm. 88 (2014) 104–115. [9] T. Yu, X. Fu, Extracorporeal ultrasound-guided high intensity focused ultrasound: implications from the present clinical trials, Sci. World J. 2014 (2014) 537260. [10] H. He, T. Yu, Y. Zhang, The interaction between a drug and ultrasound in sonochemotherapy against ovarian cancers, Ultraschall Med. 33 (2012) 275– 282.
538
[11] A.H. Saad, G.M. Hahn, Ultrasound enhanced drug toxicity of Chinese hamster ovary cells in vitro, Cancer Res. 49 (1989) 5931–5934. [12] V. Bernard, J. Škorpíková, V. Mornstein, I. Slaninová, Biological effects of combined ultrasound and cisplatin treatment on ovarian carcinoma cells, Ultrasonics 50 (2010) 357–362. [13] Y.Z. Zhou, H.Z. Chen, Q.Y. Yang, S.Q. Liu, H.Y. Hou, Establishment of human ovarian cancer cisplatin resistant cell line COC1/DDP and its mechanism of resistance, Natl. Med. J. China 76 (1996) 680–683. [14] X. Shenhua, Q. Lijuan, M. Hanzhou, N. Xinghao, Z. Chihong, Z. Gu, D. Weifang, G. Yongliang, Establishment of a highly metastatic human ovarian cancer cell line (HO-8910PM) and its characterization, J. Exp. Clin. Cancer Res. 18 (1999) 233–239. [15] G. Bisognol, F. Cowie1, A. Boddy, H.D. Thomas, G. Dick, C.R. Pinkerton, Highdose cyclosporin with etoposide-toxicity and pharmacokinetic interaction in children with solid tumours, Br. J. Cancer 77 (1998) 2304–2309. [16] D.G. Mutch, T.J. Herzog, C.A. Chen, J.L. Collins, The effects of cyclosporin A on the lysis of ovarian cancer cells by cisplatin or adriamycin, Gynecol. Oncol. 47 (1992) 28–33. [17] S. Zhou, T. Yu, J. Zhang, S. Liu, Y. Huo, Y. Zhang, Sonochemotherapy inhibits the adhesion, migration and invasion of human ovarian cancer cells with highly metastatic potential, Ultrascall Med. 32 (2011) s14–s20. [18] H. He, H. Huang, T. Yu, Detection of DNA damage in sonochemotherapy against cisplatin-resistant human ovarian cancer cells using the modified comet assay, Int. J. Radiat. Biol. 90 (2014) 897–902. [19] T. Yu, X. Huang, K. Hu, J. Bai, Z. Wang, Treatment of transplanted adriamycinresistant ovarian cancers in mice by combination of adriamycin and ultrasound exposure, Ultrason. Sonochem. 11 (2004) 287–291. [20] T. Mosmann, Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays, J. Immunol. Methods 65 (1983) 55–63. [21] Z.J. Jin, About the evaluation of drug combination, Acta Pharmacol. Sin. 25 (2004) 146–147. [22] I. Nicoletti, G. Migliorati, M.C. Pagliacci, F. Grignani, C. Riccardi, A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry, J. Immunol. Methods 139 (1991) 271–279. [23] A.M. Albanyan, P. Harrison, M.F. Murphy, Markers of platelet activation and apoptosis during storage of apheresis- and buffy coat-derived platelet concentrates for 7 days, Transfusion 49 (2009) 108–117. [24] A. Notte, L. Leclere, C. Michiels, Autophagy as a mediator of chemotherapyinduced cell death in cancer, Biochem. Pharmacol. 82 (2011) 427–434. [25] P.A. Andrews, S.C. Mann, H.H. Huynh, K.D. Albright, Role of the Na+, K+adenosine triphosphatase in the accumulation of cisdiamminedichloroplatinum (II) in human ovarian carcinoma cells, Cancer Res. 51 (1991) 3677–3681. [26] P.A. Andrews, W.E. Wung, S.B. Howell, A high-performance liquid chromatographic assay with improved selectivity for cisplatin and active platinum (II) complexes in plasma ultrafiltrate, Anal. Biochem. 143 (1984) 46– 56. [27] W.H. Habig, M.J. Pabst, W.B. Jakoby, Glutathione S-transferases, J. Biol. Chem. 249 (1974) 7130–7139. [28] M.A. Baker, G.J. Cerniglia, A. Zaman, Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples, Anal. Biochem. 190 (1990) 360–365. [29] A. Johnsson, C. Olsson, O. Nygren, M. Nilsson, B. Seiving, E. Cavallin-Stahl, Pharmacokinetics and tissue distribution of cisplatin in nude mice. Platinum levels and cisplatin-DNA adducts, Cancer Chemother. Pharmacol. 37 (1995) 23–31. [30] H.J. Fingert, Z. Chen, N. Mizrahi, W.H. Gajewski, M.P. Bamberg, R.L. Kradin, Rapid growth of human cancer cells in a mouse model with fibrin clot subrenal capsule assay, Cancer Res. 47 (1987) 3824–3829. [31] T. Yu, K. Hu, S. Jiang, Z. Wang, Establishment of a mouse subrenal capsular animal model for cisplatin-resistant human ovarian carcinoma cells and its clinical significance, Prog. J. Obstet. Gynecol. 10 (2001) 11–12. [32] J. Zhang, T. Yu, An orthotopic ovarian carcinoma model with metastasis in nude mice, Sci. Technol. Rev. 28 (12) (2010) 32–35. [33] P. Wang, J. Chen, L.H. Mu, Q.H. Du, X.H. Niu, N.Y. Zhang, Propofol inhibits invasion and enhances paclitaxel induced apoptosis in ovarian cancer cells through the suppression of the transcription factor slug, Eur. Rev. Med. Pharmacol. Sci. 17 (2013) 1722–1729. [34] T. Yu, Y. Zhang, H. He, S. Zhou, Y. Liu, P. Huang, Anticancer potency of cytotoxic drugs after exposure to high-intensity focused ultrasound in the presence of microbubbles and hematoporphyrin, Mol. Pharm. 8 (2011) 1408–1415. [35] V. Cepeda, M.A. Fuertes, J. Castilla, C. Alonso, C. Quevedo, J.M. Pérez, Biochemical mechanisms of cisplatin cytotoxicity, Anticancer Agents Med. Chem. 7 (2007) 3–18. [36] T. Yu, X. Huang, S. Jiang, K. Hu, B. Kong, Z. Wang, Ultrastructure alterations in adriamycin-resistant and cisplatin-resistant human ovarian cancer cell lines exposure to nonlethal ultrasound, Int. J. Gynecol. Cancer 15 (2005) 462–467. [37] N. Aouali, L. Eddabra, J. Macadré, H. Morjani, Immunosuppressors and reversion of multidrug-resistance, Crit. Rev. Oncol. Hematol. 56 (2005) 61–70. [38] C.Q. Xia, P.G. Smith, Drug efflux transporters and multidrug resistance in acute leukemia: therapeutic impact and novel approaches to mediation, Mol. Pharmacol. 82 (2012) 1008–1021. [39] D.S. Backos, C.C. Franklin, P. Reigan, The role of glutathione in brain tumor drug resistance, Biochem. Pharmacol. 83 (2012) 1005–1012.
566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
No. of Pages 8, Model 5G
13 February 2015 European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx 1
Contents lists available at ScienceDirect
European Journal of Pharmaceutics and Biopharmaceutics journal homepage: www.elsevier.com/locate/ejpb
2
Research paper
6 4 7 5
Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound
8
Tinghe Yu a,⇑, Yan Yang a, Jiao Zhang a, Haining He b, Xueyi Ren c
9 10 11 13 12 14 1 2 6 8 17 18 19 20 21 22 23 24 25 26 27
a
Key Medical Laboratory of Obstetrics and Gynecology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing, China Department of Obstetrics and Gynecology, Sichuan Provincial People’s Hospital, Chengdu, China c Chongqing Institute for Food and Drug Control, Chongqing, China b
a r t i c l e
i n f o
Article history: Received 26 November 2014 Accepted in revised form 2 February 2015 Available online xxxx Keywords: Cisplatin resistance Ovarian cancer Ultrasound Cyclosporin A Chemosensitization
a b s t r a c t Cisplatin resistance is a challenge in the treatment of ovarian cancer. The aim of this study was to explore if ultrasound can overcome chemoresistance and enhance chemosensitization due to cyclosporin A. Ultrasound and/or cyclosporin A was employed to overcome cisplatin resistance in human ovarian cancer cell line COC1/DDP. Mechanisms were explored from the perspective of the following: DNA damage, intracellular platinum level, detoxification, and genes related to drug efflux and DNA repair. In vivo therapeutic efficacy was validated in a short-term model (subrenal cell-clot transplantation) in mice and the survival benefit was investigated in an orthotopic cancer model in mice using HO-8910PM cells. The findings were as follows: (i) ultrasound enhanced the effect of cisplatin leading to a lower cell-survival rate (IC50 decreased from 3.19 to 0.35 lg/ml); (ii) ultrasound enhanced cisplatin via direct (increasing the intercellular level of active platinum) and indirect (decreasing the glutathione level, and expression of LRP and ERCC1 genes) mechanisms that intensified cisplatin-induced DNA damage, thus enhancing cell apoptosis and necrosis; (iii) cisplatin followed by ultrasound led to small tumor sizes in the short-term model without exacerbation of the systemic toxicity, and prolonged the survival times in the orthotopic model; and (iv) ultrasound synergized the sensitization due to cyclosporin A in vitro and in vivo. These data demonstrated that ultrasound combined with cyclosporin A overcame cisplatin resistance in ovarian cancer. Ó 2015 Published by Elsevier B.V.
29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
48 49
1. Introduction
50
Cisplatin (DDP) is the first-line chemotherapeutic drug for management of ovarian cancer. Chemoresistance emerges rapidly, and ultimately leads to treatment failure. A satisfactory strategy to overcome chemoresistance is lacking [1]. The chemical modulator cyclosporin A (CsA) has demonstrated impressive results in vitro but produces limited clinical efficacy – the dose required for chemosensitization in vivo is unavailable [2,3]. Therefore, an alternative modality is needed. The cytotoxicity of cisplatin is mediated by the active hydrolysis species. The active species induce the formation of DNA crosslinks, thereby triggering apoptosis. Mechanisms of cisplatin resistance differ from those in multidrug resistance, and are very complex: influx, efflux and detoxification of the drugs, DNA repair, and apop-
51 52 53 54 55 56 57 58 59 60 61 62
⇑ Corresponding author. Key Medical Laboratory of Obstetrics and Gynecology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing 400010, China. Tel.: +86 23 63893711. E-mail address: [email protected] (T. Yu).
tosis malfunction [4,5]. These suggest that a strategy targeting at a specific pathway may not produce efficient sensitization. Ultrasound (US) can enhance the transmembrane delivery of drugs, thereby potentiating the effect of anticancer drugs [6–8]. Ultrasound can be focused on the predetermined deeper volume without harming adjacent tissues, allowing for targeted therapy [9]. The efficacy of sonochemotherapy is dependent upon the drugs and cell type [10]. Indeed, insonation does not improve the therapeutic efficacy in some cancer types if certain drugs are used [6]. With respect to cisplatin, controversial results have been reported. Saad and Hahn reported that insonation (1 W/cm2) did not potentiate cisplatin in Chinese hamster ovary cells HA1 [11]. Bernard et al., however, manifested that ultrasound (0.5 or 1 W/cm2) enhanced the effect of cisplatin to human ovarian cancer cells A2780 [12]. Thus, further investigations are needed to determine whether ultrasound can modulate the anticancer effect of cisplatin. Here we report the results of using ultrasound and/or cyclosporin A to enhance the effect of cisplatin against cisplatinresistant human ovarian cancer cells. Mechanisms were explored from the perspective of the following: mode of cell death,
http://dx.doi.org/10.1016/j.ejpb.2015.02.003 0939-6411/Ó 2015 Published by Elsevier B.V.
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 2
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
88
intracellular platinum level, drug detoxification, DNA damage, and genes related to drug efflux and DNA repair. In vivo anticancer efficacy was validated in a short-term model using mice, and the survival benefit was investigated in a mouse model of orthotopic cancer. The present data suggest that ultrasound combined with cyclosporin A can overcome cisplatin resistance in ovarian cancer.
89
2. Materials and methods
90
2.1. Cells
83 84 85 86 87
cytotoxicity (cell death and DNA damage) and not lead to obvious temperature increase in the cell suspension (i.e., <37 °C during insonation) [17,18]. The setup was also used to conduct in vivo experiments, and the exposure time was 10 min. Insonation was undertaken as described previously [19]. Mice were positioned on a plate with a 2 cm-diameter aperture as ultrasound window. The plate was immersed in degassed water, thereby making ultrasound delivered to the tumor.
141
2.4. Cell viability
150
Cell viability was determined using a tetrazolium assay (Sigma, St. Louis, MO) after 24 h, and the percentage of surviving cells calculated [20]. IC50 was deduced using the software CalcuSyn (Biosoft, Ferguson, MO). The percentages of dead cells (percentage of dead cells = 1 percentage of surviving cells) were used to calculate the combination index (CI), thereby analyzing the interaction between ultrasound and a drug (CI = EA+B/[EA + EB EA EB]; EA+B: effect of the combination; EA/EB: effect of a factor alone). A CI of >1.15, 0.85– 1.15 and <0.85 indicated synergism, addition and antagonism, respectively [10,21].
151
2.5. Apoptosis
162
Flow cytometry was used to detect the sub-G1 peak (indicator of apoptosis) at 24 and 48 h [22]. Cells were analyzed after being treated with RNAse (Sigma) and stained with propidium iodine (Sigma).
163
142 143 144 145 146 147 148 149
109
The cisplatin-resistant human ovarian cancer subline COC1/ DDP (China Center for Typical Culture Collection, Wuhan, China) was used. COC1/DDP was sub-cloned by exposing COC1 to cisplatin with gradually elevated concentration, and had a resistant index of 6.5 referred to the ratio of the half-maximal inhibitory concentrations (IC50) [13]. Cells were cultured in RPMI 1640 medium (Hyclone, Beijing, China) enriched with 10% fetal bovine serum (Hyclone) at 37 °C and 5% CO2; cisplatin (0.5 lg/ml; Qilu Pharm., Jinan, China) was added into the medium to maintain chemoresistance. Cells within the passage number of 30 were used for experiments. Cells were transferred to cisplatin-free medium 2 days before experiments. Single-cell suspensions were prepared, and the concentration was adjusted to 1.0 106 cells/ml. All in vitro experiments were carried out in triplicate. The highly metastatic human ovarian cancer cell line HO8910PM (Cell Bank of Chinese Academy of Sciences, Shanghai, China) was used to establish a model of orthotopic cancer [14]. Cells were cultured as described above but without cisplatin.
110
2.2. Treatments
2.6. Mitochondrial membrane potential
167
111
The mitochondrial membrane potential was measured at 24 h. Cells were stained with JC-1 (ALEXIS Biochem., San Diego, CA), and assayed with a flow cytometer. The ratio of red-to-green fluorescence reflected the potential [23].
168
2.7. Caspase-3 and caspase-9
172
The activity of caspase-3 and caspase-9 was determined by a colorimetric assay (BioVision, Mountain View, CA) as the instruction manual at 24 h. Briefly, cytosolic extract was prepared, and the substrate was added. Absorbance at 405 nm reflected the activity of enzymes.
173
2.8. High mobility group box 1 (HMGB1)
178
The biochemical marker of cell necrosis HMGB1 in the culture supernatant was determined with an enzyme-linked immunosorbent assay (Shino-Test, Kanagawa, Japan) at 12, 24 and 48 h [24].
179
129
Four treatment groups were created as follows: cisplatin only (DDP); cisplatin followed by ultrasound (DDP + US); cisplatin combined with cyclosporin A (DDP + CsA); cisplatin and cyclosporin A followed by insonation (DDP + CsA + US). Control cells were sham-insonated. Insonation was carried out immediately after drug administration. Cells were maintained at 37 °C for 3 h, and then chemicals were washed away with phosphate-buffered saline (PBS). Hence, the peak concentrations and areas under the concentration–time curves of cisplatin and cyclosporin A were within the range of human pharmacokinetics [10,15]. Fresh medium was added and cells maintained at 37 °C before assays. The concentration of cyclosporin A (Sandoz, Basel, Switzerland) was 20 lg/ml. This level did not cause cytotoxicity and can circumvent cisplatin resistance [16]. The concentrations of cisplatin were 0.1, 0.5, 1, 5 and 10 lg/ml in the cell-survival experiment, and 1 lg/ml in other trials. When exploring the expression of glutathione S-transferase (GST), glutathione (GSH) and genes, cells were treated in a similar manner but without cisplatin.
2.9. Intracellular accumulation of platinum
182
130
2.3. Ultrasound exposure Cell suspensions were insonated using a focused ultrasound device (Inst. Acoust., Nanjing University, Nanjing, China) as described previously [17]. A 60 mm-diameter transducer with a focal length of 70 mm, was mounted at the bottom of a tank filled with degassed water. A polyethylene chamber containing 1.0 ml of single-cell suspension was placed into the focus of transducer, thereby making cells exposed to insonation. The spatial average temporal average intensity was 2.0 W/cm2 in continuous waves with a frequency of 1.0 MHz. The duration of exposure for in vitro trials was 60 s. Such a level of insonation did not cause
A short-term accumulation assay was carried out [25]. Cells were washed with PBS after 1-h incubation with cisplatin (5.0 lg/ml) and homogenized in an ice bath. Cell lysates were centrifuged and supernatants prepared. Total platinum was measured with atomic absorption spectrophotometry; active platinum was derivatized with sodium diethyldithiocarbamate, and then detected with high-performance liquid chromatography (HPLC) using the Agilent 1100 system (Santa Clara, CA) [26]. A Zorbax Rx-C18 column (4.6 250 mm, particle size 5 lm; Agilent) was used. The mobile phase was methanol and water (80:20) at a flow rate of 0.8 ml/min. The eluate was detected at 254 nm. The
183
131
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108
112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
132 133 134 135 136 137 138 139 140
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
152 153 154 155 156 157 158 159 160 161
164 165 166
169 170 171
174 175 176 177
180 181
184 185 186 187 188 189 190 191 192 193
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx 194 195
percentage of active form was calculated to assess the activation of cisplatin within cells.
196
2.10. GST and GSH
197
Cells were harvested at 24 h, and cytosolic fractions prepared. GST activity was determined using 1-chloro-2,4-dinitrobenzene as the substrate (Sigma) [27]. Total and reduced GSH were detected with the 5,50 -dithio-bis(2-nitrobenzoic acid)-glutathione reductase recycling assay (Sigma) [28]. The level of the oxidized form was calculated by subtracting the value of the reduced form from that of total GSH. Protein was determined using the Lowry assay. Levels of GST and GSH were expressed as mmol/mg protein.
198 199 200 201 202 203 204
205
2.11. DNA damage detected by the comet assay
206
DNA damage was detected with the alkaline comet assay at 12 and 24 h. The comets were stained with DAPI (Mol. Probes, Eugene, OR) and observed under a fluorescence microscope. The percentage of comets formed reflected the degree of DNA damage [18].
207 208 209
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235
2.12. Determination of gene expression with reverse transcriptionquantitative polymerase chain reaction (RT-qPCR) and western blotting The expression of genes for multidrug resistance 1 (MDR1), multidrug resistance-related protein (MRP), breast cancer resistance protein (BCRP), lung resistance protein (LRP) and excision repair cross-complementing group 1 (ERCC1) was assayed with RT-qPCR (iScript select cDNA synthesis, and SsoFast EvaGreen supermix kits; Bio-Rad, Hercules, CA) as the manufacturer protocol at 12, 24, 48 and 72 h; the B2M gene was the reference. Primers were as follows: CCACAGAGGGGATGGTCAG and TAGGCATTGGC TTCCTTGAC for MDR1, CACCACCTCCTTCTGTCATCAA and GGCACCT ATAACCAGTCCCAGTA for BCRP, CGTCTACTTTTCCCTCTTAC and CTTCTTCCAGTTCTTTACCA for MRP, TGCTGAGGTGGAGGTGAAG and ATCGGTGATGAGGGTTGATTTC for LRP, CCTCAGCCTCTCAAGT AG and GAGGTCAGGAGTTCAAGA for ERCC1, and GGGTTTCATC CCTCCGACATT and ACGGCAGGCATACTCATCTTTT for B2M. Based on the findings in RT-qPCR, LRP and ERCC1 proteins were analyzed with western blotting at 24, 48 and 72 h, using mouse monoclonal antibodies (Santa Cruz Biotechnol., Santa Cruz, CA). Proteins were extracted, separated by SDS–PAGE, and transferred onto a PVDF membrane; primary and secondary antibodies were added, and then the target protein was visualized with an enhanced chemiluminescence assay. b-actin was detected with a rabbit polyclonal antibody (Santa Cruz Biotechnol.), and served as the reference.
236
2.13. In vivo therapeutic trials
237
The use of animals was approved by Chongqing Medical University (Chongqing, China) in compliance with the Guide for the Care and Use of Laboratory Animals. Experiments were carried out in seven groups of five mice: cisplatin (DDP); insonation (US); cyclosporin A (CsA); cisplatin followed by insonation (DDP + US); combination of cisplatin and cyclosporin A (DDP + CsA); combination of cisplatin and cyclosporin A followed by insonation (DDP + CsA + US); control mice received normal saline. The tumor was subjected to insonation 15 min after drug administration. The interval was determined according to the pharmacokinetics of cisplatin in mice [29].
238 239 240 241 242 243 244 245 246 247 248
3
2.14. Efficacy in a model of subrenal tumor transplantation
249
A cancer model was established in cyclophosphamide-immunosuppressed female BALB/C mice (6–8 weeks; 17–25 g; Center for Laboratory Animals, Chongqing Medical University) by subrenal clot transplantation using COC1/DDP cells [30]. Fibrin cell clot was formed by adding fibrinogen and thrombin into the cell suspension, and then cut into pieces (1 1 1 mm3). A piece was surgically introduced into the subrenal capsule. Chemoresistance was preserved in this animal model [31]. Treatments were performed on days 2, 3, 5 and 6. Cisplatin (2 mg/kg) and cyclosporin A (100 mg/kg) were administered via the intraperitoneal route. Mice were sacrificed on day 7. The length (L, mm) and width (W, mm) of a tumor were calibrated under a stereomicroscope, and the volume (V, mm3; V = (L W2)/2) and diameter (D, mm; D = (L + W)/2) were calculated to evaluate the therapeutic outcome [19]. Cancer tissues underwent pathological examinations. Animal body masses and blood tests (erythrocyte, leukocyte, platelet and serum creatinine) at day 7 were used to assess the systemic toxicity. The tumor inhibitory rates (inhibitory rate = [tumor size in control group tumor size in treatment group]/tumor size in control group) were calculated, and then CI was deduced to determine the ultrasound–drug interaction as described in the section of cell death [10,21].
250
2.15. Survival in an orthotopic model of cancer
273
An orthotopic ovarian cancer was established in female BALB/C nude mice (4–6 weeks; Center of Laboratory Animals, Chongqing Medical University) using HO-8910PM cells as described previously [32]. This was because ovarian tumor cannot form using COC1/DDP cells, and HO-8910PM cells displayed chemoresistance [33]. HO-8910PM cells were injected subcutaneously, and a tumor formed after 6 weeks. The tumor was removed and cut into slices (1 1 1 mm3). A slice was surgically introduced into the ovary of another mouse, and the ovary was enwrapped using absorbable hemostatic gauze in which the major ingredient was cellulose. An ovarian cancer that could be palpated on the abdomen formed after 60 days. Mice were randomly divided into experimental groups. Animals were managed as described in the section on subrenal transplant tumors. The dose of cisplatin was 2 mg/kg and that of cyclosporin A was 20 mg/kg. Treatment was administered every week and each mouse received it four times. Animals were followed up until death.
274
2.16. Statistical analyses
292
All data were processed using the SAS software (SAS Inst., Cary, NC, USA). Percentages were normalized with arc-sine transformation. Analysis of variance was adopted, and multiple comparisons corrected using the Student–Newman–Keuls test. The survival time was analyzed with the Kaplan–Meier method. p < 0.05 was considered significant.
293
3. Results
299
3.1. Ultrasound enhanced cisplatin-induced cell death
300
Cell survival was decreased in groups DDP + US, DDP + CsA and DDP + CsA + US compared with group DDP (p < 0.0001). The percentage of surviving cells in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA (p < 0.05) (Fig. 1A). IC50 values were 3.19, 0.35, 0.65 and 0.09 lg/ml in groups DDP, DDP + US,
301
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272
275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291
294 295 296 297 298
302 303 304 305
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 4
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 1. Percentages of surviving cells (A): the number of surviving cells was decreased in groups DDP + US, DDP + CsA and DDP + CsA + US compared with group DDP; the percentage in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA. Apoptosis (B): higher percentages were noted in groups DDP + US, DDP + CsA and DDP + CsA + US at 24 and 48 h. Mitochondrial membrane potentials detected with the JC-1 assay (C): the potential was decreased in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US. Levels of activated caspase-3 and caspase-9 (D): caspases were activated in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US; absorbencies in groups DDP + US, DDP + CsA and DDP + CsA + US were higher than those in group DDP. Levels of HMGB1 (E): value in group DDP + US, DDP + CsA or DDP + CsA + US was higher than that in group DDP. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05.
306 307 308 309 310
DDP + CsA and DDP + CsA + US, respectively. CI showed synergism between cisplatin and ultrasound/cyclosporin A, and that ultrasound synergized the effect of cisplatin combined cyclosporin A (Table 1). These findings indicated that ultrasound enhanced cell death induced by cisplatin.
311
3.2. Ultrasound enhanced cisplatin-induced cell apoptosis
312
The percentage of apoptotic cells in groups DDP + US, DDP + CsA and DDP + CsA + US was higher than that in group DDP at 24 and 48 h (p < 0.0001, p < 0.0001). The percentage in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA (25.3 ± 0.4% vs. 12.6 ± 0.4%/18.9 ± 1.0% at 48 h, p < 0.05) (Fig. 1B). The JC-1 assay indicated that mitochondrial membrane potential was decreased in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US (p = 0.0005) (Fig. 1C). Activation of caspase-3 and caspase-9 was observed in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US. Absorbencies in groups DDP + US, DDP + CsA and DDP + CsA + US were higher than those in group DDP (p = 0.0001, p < 0.0001) (Fig. 1D). These findings suggested that ultrasound enhanced cell apoptosis induced by cisplatin.
313 314 315 316 317 318 319 320 321 322 323 324 325 326
Table 1 List of combination indices (CI). Combination
DDP and US DDP and CsA DDP + CsA and US a b
In vitro
1.43 (1.21–1.95)a 1.30 (1.06–1.66)a,b 1.42 (1.24–1.87)a
Synergism. CI was 1.06 at 0.05 lg/ml cisplatin.
In vivo Volume
Diameter
2.89a 1.52a 1.40a
2.92a 2.25a 1.96a
3.3. Ultrasound enhanced cisplatin-induced cell necrosis
327
The HMGB1 level was increased in groups DDP + US, DDP + CsA and DDP + CsA + US at 12–48 h compared with group DDP (p < 0.0001, p < 0.0001, p < 0.0001). The value in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA at 24 and 48 h (p < 0.05) (Fig. 1E). These findings showed that ultrasound enhanced cell necrosis due to cisplatin.
328
3.4. Ultrasound increased the intracellular accumulation of active platinum
334
Higher levels of total platinum occurred in groups DDP + US and DDP + CsA + US compared with group DDP (p = 0.0004), and HPLC demonstrated an increase of active platinum in those two groups (p = 0.0033) (Fig. 2A). The percentages of active form were 58.6 ± 1.1%, 62.4 ± 1.5%, 59.2 ± 3.7% and 59.7 ± 1.0% in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US, respectively (p = 0.2860); the value in COC1/DDP cells was <75% (p < 0.0001), the percentage of active platinum observed in human pharmacokinetics [26]. The high expression of transporter genes favored drug efflux, thereby decreasing the level of intracellular drugs. The expression of MDR1, MRP, BCRP and LRP was determined with RT-qPCR. No variations were detected in the mRNA levels of MDR1, MRP and BCRP (p = 0.0845–0.7165, p = 0.0805–0.7433, p = 0.1212–0.3683) (Fig. 2B–D). Level of LRP mRNA was decreased in groups US, CsA and CsA + US at 12–48 h (p < 0.0001, p < 0.0001, p < 0.0001), with the lowest value seen in group CsA + US; the level in group CsA was lower than that in group US (p < 0.05). LRP returned to the baseline level at 72 h (p = 0.9675) (Fig. 3A). LRP protein was validated using western blotting. Lower expression of LRP protein was detected in groups US, CsA and CsA + US at 24 and 48 h (p < 0.0001, p = 0.0035), with the lowest level seen in group CsA + US; the level in group CsA was lower than
336
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
329 330 331 332 333
335
337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
5
Fig. 2. Intracellular accumulation of total and active platinum (A): higher levels were detected in groups DDP + US and DDP + CsA + US. a, vs. DDP, p < 0.05; b, vs. DDP + US, p < 0.05; c, vs. DDP + CsA, p < 0.05. Expression of genes of MDR1 (B), MRP (C) and BCRP (D) assayed by RT-qPCR: no significant variations were detected. Levels of GST and GSH (E): GST level did not significantly differ between groups; levels of total and reduced GSH were decreased in groups US, CsA and CsA + US, with the lowest level seen in group CsA + US. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. US, p < 0.05; c, vs. CsA, p < 0.05.
366
that in group US at 24 h (p < 0.05). No difference was detected between groups at 72 h (p = 0.0995) (Fig. 3C). GST and GSH were the antidotes for cisplatin. The GST level did not differ significantly between groups (p = 0.4856). Levels of total and reduced GSH were decreased in groups US, CsA and CsA + US (p < 0.0001, p < 0.0001), with the lowest level in group CsA + US (Fig. 2E). These findings showed that ultrasound increased the intracellular level of active platinum.
367
3.5. Ultrasound enhanced cisplatin-induced DNA damage
368
More comets were detected in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 and 24 h compared with group DDP (p = 0.0011, p = 0.0093). The percentage of comets formed in group DDP + CsA + US was higher than that in group DDP + US or DDP + CsA at 12 h (p < 0.05) (Fig. 4). An increased capacity of DNA repair protected cells from DNA damage, and ERCC1 was the gene up-regulating DNA repair. The mRNA level of ERCC1 was decreased in groups US, CsA and CsA + US at 12–48 h (p < 0.0001, p < 0.0001, p < 0.0001), and the lowest level occurred in group CsA + US; the level in group CsA was lower than that in group US (p < 0.05). No difference was noted between groups at 72 h (p = 0.0935) (Fig. 3B). ERCC1 protein was decreased in groups US, CsA and CsA + US at 24 h (p < 0.0001), and in group CsA + US at 48 h (p = 0.0034); the level in group CsA + US was lower than that in group US or CsA (p < 0.05); the level of ERCC1 protein in group CsA was less than that in group US at 24 h (p < 0.05). No difference was observed between groups at 72 h (p = 0.1544) (Fig. 3C). These findings showed that ultrasound enhanced DNA damage induced by cisplatin.
359 360 361 362 363 364 365
369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387
388 389 390 391 392
3.6. Ultrasound enhanced the anticancer effect of cisplatin in a subrenal tumor model in mice Tumor necrosis was detected upon treatment with cisplatin, without or with insonation (Fig. 5A–C). Smaller tumor volumes and diameters were noted in groups DDP, DDP + US, DDP + CsA
and DDP + CsA + US (p = 0.0004, p < 0.0001). The diameter in group DDP + CsA + US was less than that in group DDP, DDP + US or DDP + CsA (0.44 ± 0.36 vs. 1.65 ± 0.25, 1.18 ± 0.43, or 1.16 ± 0.15 mm, p < 0.05) (Fig. 5D). CI showed that synergism occurred between cisplatin and ultrasound/cyclosporin A, and that ultrasound synergized the effect of the combination of cisplatin and cyclosporin A (Table 1). Animal body mass, counts of erythrocyte, leukocyte and platelet, and serum creatinine were not with significant differences between groups (p = 0.0767, p = 0.8622, p = 0.9917, p = 0.6575, p = 0.1126) (Table 2). These findings indicated that ultrasound enhanced the anticancer effect of cisplatin in vivo, and not exacerbate the systemic toxicity of cisplatin and cyclosporin A.
393
3.7. Ultrasound prolonged the survival time in mice with orthotopic ovarian cancer
406
Mean survival times were 29.0 ± 7.6 (19–38), 32.0 ± 10.5 (15– 42), 40.8 ± 12.6 (25–60), 58.2 ± 9.7 (43–67), 60.6 ± 10.1 (43–67), 71.2 ± 13.1 (60–89) and 95.6 ± 6.9 (89–106) days in groups control, US, CsA, DDP, DDP + US, DDP + CsA and DDP + CsA + US, respectively (p < 0.0001). The survival time was prolonged in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US compared with group control (p < 0.05). The survival time in group DDP + CsA + US was longer than that in group DDP, DDP + US or DDP + CsA (p < 0.05) (Fig. 5E). These data indicated that ultrasonic chemotherapy prolonged the animal survival.
408
4. Discussion
418
The percentage of survival cells and IC50 was deceased upon the use of ultrasound, and CI showed synergism. The peak concentrations and areas under the concentration–time curves of cisplatin and cyclosporin A were within the range of clinical pharmacokinetics [10,15]. Free radicals due to cavitation (particularly under an intensity of >104 W/cm2) can destroy drug molecules, thereby decreasing the anticancer potency [34]. Intensity was low in this study, i.e., generating far fewer reactive radicals; this favored the
419
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
394 395 396 397 398 399 400 401 402 403 404 405
407
409 410 411 412 413 414 415 416 417
420 421 422 423 424 425 426
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 6
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 3. Expression of genes of LRP (A) and ERCC1 (B) assayed by RT-qPCR: the levels of mRNA were decreased in groups US and CsA at 12–48 h, with the lowest value in group CsA + US, and returned to the baseline levels at 72 h. Expression of LRP and ERCC1 proteins validated with western blotting (C): lower level was noted after exposure to ultrasound and/or cyclosporin A at 24 and 48 h; no difference was detected between groups at 72 h. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. US, p < 0.05; c, vs. CsA, p < 0.05.
Fig. 4. Percentages of comets formed: higher values were observed in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 and 24 h. Data were mean ± standard deviation for 3 independent experiments. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05. 427 428 429 430 431
preservation of potency of drugs. Thus, the present data were clinically relevant, and manifested that ultrasound overcame resistance. Higher apoptosis rates were observed in groups DDP + US, DDP + CsA and DDP + CsA + US. The activity of caspase-3 displayed
similar variations. The data demonstrated a mechanism of sensitization due to ultrasound and/or cyclosporin A. The activation of caspase-9 and collapse of the membrane potential manifested that apoptosis occurred via the mitochondrial pathway. However, the percentage of apoptotic cells was far less than that of dead cells (the percentage of dead cells was 57.7% in group DDP + US but that of apoptotic cells was 16.4%), suggesting that enhancement of apoptosis was not the sole mechanism of sensitization. A higher level of HMGB1 upon use of ultrasound demonstrated the occurrence of cell necrosis [24]. These data supported our previous hypothesis: ultrasound sensitized cells, which decreased the necrosis threshold and therefore cells underwent necrosis directly; however, those cells would undergo apoptosis when exposed to anticancer drugs alone [6]. An increase of HMGB1 level in group DDP after 24 h showed that cisplatin could induce cell necrosis, which accorded with the previous verdict [35]. Therefore, ultrasound enhanced cisplatin via enhancing apoptosis and necrosis induced by cisplatin. The accumulation assay manifested that only a portion of platinum can be transformed into the active form, and that higher intracellular levels of total/active platinum occurred in groups DDP + US and DDP + CsA + US. The increase was mediated by cavitation. Cavitation produced microjets, microstreaming and free radicals that can permeabilize the cell membranes, thereby facili-
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 7
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
Fig. 5. Representative pathologic results of COC1/DDP tumors (200): cancer cells were intact in control tumor (A), and necrotized if subjected to cisplatin without or with insonation (B and C); T, tumor; the scale bar was 50 lm. Tumor sizes in the subrenal cancer model (C; data were mean ± standard deviation for 5 mice): small tumor sizes were detected in groups DDP, DDP + US, DDP + CsA and DDP + CsA + US; the tumor diameter in group DDP + CsA + US was less than that in group DDP + US or DDP + CsA. Survival curves in an orthotopic cancer model (D; n = 5): the survival time was prolonged in group DDP, DDP + US, DDP + CsA or DDP + CsA + US compared with group control, with the longest survival time seen in group DDP + CsA + US. a, vs. control, p < 0.05; b, vs. DDP, p < 0.05; c, vs. DDP + US, p < 0.05; d, vs. DDP + CsA, p < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article) Table 2 Systemic toxicity determined by body mass and blood tests. Group
Control US CsA DDP DDP + US DDP + CsA DDP + CsA + US
456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477
Body mass (g)
16.8 ± 0.2 16.8 ± 0.2 16.8 ± 0.3 16.6 ± 0.4 16.4 ± 0.4 16.4 ± 0.2 16.4 ± 0.3
Blood Erythrocyte (1012/l)
Leukocyte (109/l)
Platelet (109/l)
Creatinine (lmol/l)
8.5 ± 0.6 8.3 ± 0.5 8.1 ± 0.3 8.1 ± 0.7 8.2 ± 0.5 7.9 ± 0.5 8.3 ± 0.5
6.6 ± 1.4 6.4 ± 1.3 6.1 ± 2.1 5.8 ± 1.9 6.5 ± 1.5 6.4 ± 1.7 6.0 ± 2.2
864 ± 159 928 ± 44 816 ± 157 827 ± 111 852 ± 124 777 ± 159 815 ± 200
12.2 ± 1.4 11.1 ± 1.4 11.5 ± 0.8 12.8 ± 1.7 12.1 ± 1.7 10.6 ± 1.3 11.0 ± 2.1
tating drug influx (intracellular cavities detected in our previous study demonstrated the occurrence of cavitation) [6–8,36]. The percentage of active platinum in COC1/DDP cells was less than that in human pharmacokinetics, indicating a lower transformation rate within cells, which played a role in resistance. Percentages of active form suggested that ultrasound and cyclosporin A cannot exert on the bioactivation of cisplatin within cells. The intracellular drug level was not increased in group DDP + CsA despite a lower cell-survival rate in this group. Cyclosporin A increased the intracellular drug level by decreasing efflux, which was realized by down-modulating the level of transporter genes (i.e., requiring a delay) [3,37]. Variations were detected only in LRP – ultrasound and/or cyclosporin A decreased the expression. The role of transporter genes varied between cell types [4,38]. These data suggested that LRP was involved in resistance in COC1/DDP cells. The suppression of LRP (verified by RT-qPCR and western blotting) decreased drug efflux thereby prolonging the retention of drugs within cells. Thus, ultrasound increased the intracellular drug level and its duration, particularly combined with cyclosporin A. The GSH level was decreased when using insonation and/or cyclosporin A. This effect can preserve active platinum since GSH can inactivate platinum [4]. GSH may play a part in the lower
transformation rate of platinum within cells. Active radicals due to cavitation attacked hydrosulfuryl groups and unsaturated bonds to demolish molecules [34]. A chemical GSH inhibitor (e.g., buthionine sulfoximine) had limited use because of toxicities due to a lack of selectivity for tumor tissues [39]. The denaturation of GSH can be confined to the tumor as ultrasound can be focused on the target volume, which can improve the therapeutic effect and decrease toxicity as well. The lowest level in group CsA + US indicated synergism between ultrasound and cyclosporin A. Cyclosporin A inhibited the synthesis and ultrasound directly destroyed molecules, thereby extinguishing GSH [16,34]. More comets were detected in groups DDP + US, DDP + CsA and DDP + CsA + US at 12 h, followed by an increase in apoptosis rate. The findings suggested that severer DNA damage was induced with the use of ultrasound, leading to apoptosis. Cisplatin-resistant cells had an improved capacity of DNA repair, which was mediated by ERCC1 [5]. RT-qPCR and western blotting demonstrated a decrease in the ERCC1 expression if applying ultrasound and/or cyclosporin A. This effect debased the capacity of DNA repair, thereby making cells undergo irreversible damage under cisplatin causing apoptosis/necrosis. Mechanisms of modulation of gene expression with ultrasound remained unclear. Lower levels of LRP and ERCC1 in
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003
478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499
EJPB 11828
No. of Pages 8, Model 5G
13 February 2015 8
T. Yu et al. / European Journal of Pharmaceutics and Biopharmaceutics xxx (2015) xxx–xxx
533
group CsA suggested that ultrasound was a weaker gene modulator compared with cyclosporin A. This feature as well as the temporal pattern of gene modulation should be considered, when developing biomedical applications of ultrasound. In vitro data showed that ultrasound enhanced cisplatin directly (increasing the intracellular level of active drugs) and indirectly (quenching GSH, and modulating the expression of LRP and ERCC1), and that cyclosporin A sensitized cisplatin via modulation of GSH and genes. Consequently, sensitization attributable to ultrasound emerged immediately and that due to cyclosporin A appeared after a certain interval; the combination of ultrasound and cyclosporin A produced stronger and longer chemosensitization. The reduction in tumor size in the short-term model indicated that ultrasound was effective in vivo. The smallest tumor diameter was detected in group DDP + CsA + US and CI was >1.15, which showed synergism between ultrasound and cyclosporin A with regard to sensitization. Another noticeable result was that ultrasound did not exacerbate the systemic toxicity due to cisplatin and cyclosporin A. The data in orthotopic cancer model indicated that the addition of ultrasound and cyclosporin A prolonged the survival time due to cisplatin. The model using HO-8910PM cells engendered an ovarian mass, intraperitoneal spread and distant metastasis, thereby reflecting the biological behavior of human ovarian cancer [32]. The insonation time showed that ultrasound led to temperature rise (>37 °C) [17]. Heat can enhance chemotherapy via permeabilizing cell membranes [6]. Therefore, sensitization in vivo was the combination effect of ultrasonic heat and cavitation. These effects increased the drug level within the tumor, thereby improving the therapeutic efficacy. In summary, the present findings demonstrated that ultrasound enhanced cisplatin against chemoresistant cells and synergized the sensitization due to cyclosporin A. These suggested a strategy for the treatment of cisplatin-resistant ovarian cancer.
534
Conflict of interest
500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532
535
None declared.
536
Acknowledgments
537 539
This work was supported with Grants from the Natural Science Foundation of China (11174376, 31470822) and the State Ministry of Education (SRFDP 20135503130002).
540
References
541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565
[1] M.A. Bookman, First-line chemotherapy in epithelial ovarian cancer, Clin. Obstet. Gynecol. 55 (2012) 96–113. [2] H. Lage, C. Denkert, Resistance to chemotherapy in ovarian carcinoma, Recent Results Cancer Res. 176 (2007) 51–60. [3] H. Morjani, C. Madoulet, Immunosuppressors as multidrug resistance reversal agents, Methods Mol. Biol. 59 (2010) 433–446. [4] R. Agarwal, S.B. Kaye, Ovarian cancers: strategies for overcoming resistance to chemotherapy, Nat. Rev. Cancer 3 (2003) 502–516. [5] L. Galluzzi, L. Senovilla, I. Vitale, J. Michels, I. Martins, O. Kepp, M. Castedo, G. Kroemer, Molecular mechanisms of cisplatin resistance, Oncogene 31 (2012) 1869–1883. [6] T. Yu, S. Li, J. Zhao, T.J. Mason, Ultrasound: a chemotherapy sensitizer, Technol. Cancer Res. Treat. 6 (2006) 51–60. [7] T.J. Evjen, E. Hagtvet, A. Moussatov, S. Rønvaldsson, J.L. Mestas, R.A. Fowler, C. Lafon, E.A. Nilssen, In vivo monitoring of liposomal release in tumours following ultrasound stimulation, Eur. J. Pharm. Biopharm. 84 (2013) 526–531. [8] D. Huang, L. Wang, Y. Dong, X. Pan, G. Ge, C. Wu, A novel technology using transscleral ultrasound to deliver protein loaded nanoparticles, Eur. J. Pharm. Biopharm. 88 (2014) 104–115. [9] T. Yu, X. Fu, Extracorporeal ultrasound-guided high intensity focused ultrasound: implications from the present clinical trials, Sci. World J. 2014 (2014) 537260. [10] H. He, T. Yu, Y. Zhang, The interaction between a drug and ultrasound in sonochemotherapy against ovarian cancers, Ultraschall Med. 33 (2012) 275– 282.
538
[11] A.H. Saad, G.M. Hahn, Ultrasound enhanced drug toxicity of Chinese hamster ovary cells in vitro, Cancer Res. 49 (1989) 5931–5934. [12] V. Bernard, J. Škorpíková, V. Mornstein, I. Slaninová, Biological effects of combined ultrasound and cisplatin treatment on ovarian carcinoma cells, Ultrasonics 50 (2010) 357–362. [13] Y.Z. Zhou, H.Z. Chen, Q.Y. Yang, S.Q. Liu, H.Y. Hou, Establishment of human ovarian cancer cisplatin resistant cell line COC1/DDP and its mechanism of resistance, Natl. Med. J. China 76 (1996) 680–683. [14] X. Shenhua, Q. Lijuan, M. Hanzhou, N. Xinghao, Z. Chihong, Z. Gu, D. Weifang, G. Yongliang, Establishment of a highly metastatic human ovarian cancer cell line (HO-8910PM) and its characterization, J. Exp. Clin. Cancer Res. 18 (1999) 233–239. [15] G. Bisognol, F. Cowie1, A. Boddy, H.D. Thomas, G. Dick, C.R. Pinkerton, Highdose cyclosporin with etoposide-toxicity and pharmacokinetic interaction in children with solid tumours, Br. J. Cancer 77 (1998) 2304–2309. [16] D.G. Mutch, T.J. Herzog, C.A. Chen, J.L. Collins, The effects of cyclosporin A on the lysis of ovarian cancer cells by cisplatin or adriamycin, Gynecol. Oncol. 47 (1992) 28–33. [17] S. Zhou, T. Yu, J. Zhang, S. Liu, Y. Huo, Y. Zhang, Sonochemotherapy inhibits the adhesion, migration and invasion of human ovarian cancer cells with highly metastatic potential, Ultrascall Med. 32 (2011) s14–s20. [18] H. He, H. Huang, T. Yu, Detection of DNA damage in sonochemotherapy against cisplatin-resistant human ovarian cancer cells using the modified comet assay, Int. J. Radiat. Biol. 90 (2014) 897–902. [19] T. Yu, X. Huang, K. Hu, J. Bai, Z. Wang, Treatment of transplanted adriamycinresistant ovarian cancers in mice by combination of adriamycin and ultrasound exposure, Ultrason. Sonochem. 11 (2004) 287–291. [20] T. Mosmann, Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays, J. Immunol. Methods 65 (1983) 55–63. [21] Z.J. Jin, About the evaluation of drug combination, Acta Pharmacol. Sin. 25 (2004) 146–147. [22] I. Nicoletti, G. Migliorati, M.C. Pagliacci, F. Grignani, C. Riccardi, A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry, J. Immunol. Methods 139 (1991) 271–279. [23] A.M. Albanyan, P. Harrison, M.F. Murphy, Markers of platelet activation and apoptosis during storage of apheresis- and buffy coat-derived platelet concentrates for 7 days, Transfusion 49 (2009) 108–117. [24] A. Notte, L. Leclere, C. Michiels, Autophagy as a mediator of chemotherapyinduced cell death in cancer, Biochem. Pharmacol. 82 (2011) 427–434. [25] P.A. Andrews, S.C. Mann, H.H. Huynh, K.D. Albright, Role of the Na+, K+adenosine triphosphatase in the accumulation of cisdiamminedichloroplatinum (II) in human ovarian carcinoma cells, Cancer Res. 51 (1991) 3677–3681. [26] P.A. Andrews, W.E. Wung, S.B. Howell, A high-performance liquid chromatographic assay with improved selectivity for cisplatin and active platinum (II) complexes in plasma ultrafiltrate, Anal. Biochem. 143 (1984) 46– 56. [27] W.H. Habig, M.J. Pabst, W.B. Jakoby, Glutathione S-transferases, J. Biol. Chem. 249 (1974) 7130–7139. [28] M.A. Baker, G.J. Cerniglia, A. Zaman, Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples, Anal. Biochem. 190 (1990) 360–365. [29] A. Johnsson, C. Olsson, O. Nygren, M. Nilsson, B. Seiving, E. Cavallin-Stahl, Pharmacokinetics and tissue distribution of cisplatin in nude mice. Platinum levels and cisplatin-DNA adducts, Cancer Chemother. Pharmacol. 37 (1995) 23–31. [30] H.J. Fingert, Z. Chen, N. Mizrahi, W.H. Gajewski, M.P. Bamberg, R.L. Kradin, Rapid growth of human cancer cells in a mouse model with fibrin clot subrenal capsule assay, Cancer Res. 47 (1987) 3824–3829. [31] T. Yu, K. Hu, S. Jiang, Z. Wang, Establishment of a mouse subrenal capsular animal model for cisplatin-resistant human ovarian carcinoma cells and its clinical significance, Prog. J. Obstet. Gynecol. 10 (2001) 11–12. [32] J. Zhang, T. Yu, An orthotopic ovarian carcinoma model with metastasis in nude mice, Sci. Technol. Rev. 28 (12) (2010) 32–35. [33] P. Wang, J. Chen, L.H. Mu, Q.H. Du, X.H. Niu, N.Y. Zhang, Propofol inhibits invasion and enhances paclitaxel induced apoptosis in ovarian cancer cells through the suppression of the transcription factor slug, Eur. Rev. Med. Pharmacol. Sci. 17 (2013) 1722–1729. [34] T. Yu, Y. Zhang, H. He, S. Zhou, Y. Liu, P. Huang, Anticancer potency of cytotoxic drugs after exposure to high-intensity focused ultrasound in the presence of microbubbles and hematoporphyrin, Mol. Pharm. 8 (2011) 1408–1415. [35] V. Cepeda, M.A. Fuertes, J. Castilla, C. Alonso, C. Quevedo, J.M. Pérez, Biochemical mechanisms of cisplatin cytotoxicity, Anticancer Agents Med. Chem. 7 (2007) 3–18. [36] T. Yu, X. Huang, S. Jiang, K. Hu, B. Kong, Z. Wang, Ultrastructure alterations in adriamycin-resistant and cisplatin-resistant human ovarian cancer cell lines exposure to nonlethal ultrasound, Int. J. Gynecol. Cancer 15 (2005) 462–467. [37] N. Aouali, L. Eddabra, J. Macadré, H. Morjani, Immunosuppressors and reversion of multidrug-resistance, Crit. Rev. Oncol. Hematol. 56 (2005) 61–70. [38] C.Q. Xia, P.G. Smith, Drug efflux transporters and multidrug resistance in acute leukemia: therapeutic impact and novel approaches to mediation, Mol. Pharmacol. 82 (2012) 1008–1021. [39] D.S. Backos, C.C. Franklin, P. Reigan, The role of glutathione in brain tumor drug resistance, Biochem. Pharmacol. 83 (2012) 1005–1012.
566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652
Please cite this article in press as: T. Yu et al., Circumvention of cisplatin resistance in ovarian cancer by combination of cyclosporin A and low-intensity ultrasound, Eur. J. Pharm. Biopharm. (2015), http://dx.doi.org/10.1016/j.ejpb.2015.02.003