- Email: [email protected]
cis-Regulatory elements within the proximal promoter of the rat gene encoding corticosteroid-binding globulin
Gene, 162 (1995) 205-211 © 1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50
205
GENE 09055
cis-Regulatory elements within the proximal promoter of the rat gene encoding corticosteroid-binding globulin (Transcription; hepatocyte; glucocorticoid; DNA footprinting; electrophoretic mobility-shift assay)
D. Alan Underhill and Geoffrey L. Hammond MRC Group in Fetal and Neonatal Health and Development, and Departments of Obstetrics and Gynecology, Oncology, and Biochemistry, The University of Western Ontario, London, Ontario N6A 4L6, Canada Received by J.A. Engler: 13 January 1995; Revised/Accepted: 24 March 1995; Received at publishers: 15 May 1995
SUMMARY
Corticosteroid-binding globulin (CBG) transports and modulates the bioavailability of glucocorticoids in blood plasma. It is produced predominantly by the liver, but is also produced in a complex spatial and temporal pattern during development and is regulated hormonally. The rat Cbg promoter (pCbg) has therefore been cloned to allow identification of cis-acting sequence elements that could contribute to its regulation. Five protein-binding sites (P1 to P5) were identified within 236 bp immediately 5' of the transcription start point by DNase I footprinting with rat liver nuclear extracts. These P1-P5 sites are highly conserved in the human pCbg, and resemble recognition sequences for HNF-1, CP-2, DBP, HNF-3 and C/EBP or NF-1L6, respectively. Electrophoretic mobility-shift assays indicted that the P1 element most likely binds HNF-1, and transient transfection assays with luciferase reporter plasmids demonstrated that P1-P5 represent a positive component of rat pCbg activity, whereas additional 5' sequences repressed promoter activity 2-4-fold in H4IIEC3 rat hepatoblastoma cells.
INTRODUCTION
The gene encoding corticosteroid-binding globulin (CBG) is located in the vicinity of several genes for structurally-related members of the serine proteinase inhibitor Correspondence to: Dr. G.L. Hammond, London Regional Cancer Centre, 790 Commissioners Road East, London, Ontario N6A 4L6, Canada. Tel. (1-519) 685-8617; Fax (1-519) 685-8616; e-mail: [email protected] Abbreviations: ~I-PI, alpha 1-proteinase inhibitor; aa, amino acid(s); AMV, avian myeloblastosis virus; bp, base pair(s); BSA, bovine serum albumin; C/EBP, CAAT/enhancer-binding protein; CBG, corticosteroid-binding globulin; Cbg, gene encoding CBG; CP-2, CCAAT-binding protein-2; DBP, D-site binding protein; DTT, dithiothreitol; EMSA, electrophoretic mobility-shift assay; GR, glucocorticoid receptor; HNF, hepatocyte nuclear factors; K, G or T; kb, kilobase(s) or 1000 bp; N, A or C or G or T; NF-IL6, nuclear factor-interleukin 6; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; pCbg, Cbg promoter; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; R, A or G; tsp, transcription start point(s); Y, C or T. SSDI 0378-1119(95)00337-1
gene family (Seralini et al., 1990; Orava et al., 1994), and the remarkable sequence identity between CBG and ~l-proteinase inhibitor (~I-PI) has suggested a role for CBG in the delivery of glucocorticoids at sites of inflammation (Hammond et al., 1987; Pembert0n et al., 1988). In rodents, Cbg is expressed in fetal hepatocytes, but CBG mRNA levels in neonatal livers are low to undetectable (Smith and Hammond, 1991; Scrocchi et al., 1993a). The gene is re-expressed in the liver postnatally and reaches adult levels of activity at 3 to 6 weeks of age (Smith and Hammond, 1991; Scrocchi et al., 1993b). Mouse Cbg is also expressed transiently in the fetal exocrine pancreas and the proximal convoluted tubules of the developing kidney during the first weeks after birth (Scrocchi et al., 1993a,b). Thus, CBG biosynthesis in several developing tissues may play a distinct biological role from that provided by the adult liver, and probably influences their glucocorticoid-dependent maturation. Gender-specific differences in pulsatile growth hormone
206 secretion patterns are responsible for the sexual dimorphism in rat plasma C B G levels (Jansson et al., 1989), and dexamethasone-induced decreases in plasma C B G levels in adult rats have been attributed to decreased Cbg transcription in the liver (Smith and H a m m o n d , 1992). During acute inflammation, decreased hepatic C B G biosynthesis may be due to an interleukin-6 (IL-6) induced decrease in CBG m R N A stability (Bartalena et al., 1993). Thus, C B G provides a useful paradigm for studies of the temporal, spatial and hormonal regulation of gene expression, and we have examined the rat Cbg promoter to define cis-regulatory elements that participate in its transcriptional control.
1
2
3
4
<1
~i~i~i~i~i~iii~!i~i~i~i~i~i~i~i~ii!ii;i:i~i;~ii~i~ii~ii;ii~i~!i~i!Uii!!ii!i~!ii~ii;ii~ii~ii~i~i~i RESULTS AND DISCUSSION
(a) Identification and sequence analyses of the rat Cbg promoter (pCbg) Rat genomic D N A libraries were constructed in a pWl?15 vector using Sau3AI-cleaved D N A from rat spleen, and screened by in situ colony hybridization (IshHorowicz and Burke, 1981) with a 455-bp KpnI-RsaI restriction fragment of human genomic D N A that spans the Cbg transcription start point (tsp) and promoter (Underhill and H a m m o n d , 1989). Appropriate restriction fragments of cosmid clones that hybridized with this probe were sequenced (Sanger et al., 1977). In this way, three clones (Cbgl, Cbg2 and Cbg3) were isolated, and restriction mapping of Cbgl indicated that it comprised the entire structural gene for rat C B G (data not shown). Both Cbg2 and Cbg3 spanned a similar region of the rat genome extending 5' of Cbgl, and they differed only with respect to their 5' and 3' boundaries. A 96-bp product was identified when hepatic RNA was used as a template for primer extension (lane 4, Fig. 1). Furthermore, when genomic fragments that hybridized with the h u m a n pCbg were analysed, a sequence of 17 bp that corresponds to the 5' end of a c D N A encoding rat C B G (Smith and H a m m o n d , 1989), was followed by an intron/exon junction (Fig. 2). Since this sequence was preceded by a region displaying extensive similarity with exon I and the promoter of human Cbg (bold lower-case in Fig. 2), it can be concluded that 23 nt of the primer extension product are located within exon II of rat Cbg, while the remaining 73 nt are encoded by exon I. This would also place the tsp of human and rat Cbg in an identical context (Fig. 2). The sequence spanning (nt - 4 3 9 to + 4 ) relative to the deduced tsp in rat Cbg is accommodated within a Sau3AI-RsaI fragment that exhibits 67% identity with the corresponding region of the human pCbg (Fig. 2). However, the sequence identity
Fig. 1. Primer extension analysis of hepatic rat CBGmRNA. Lane 1 is a Maxam and Gilbert (1980) AG reaction that serves as a molecular size standard. The most abundant extension product is indicated by an arrowhead. Methods: A primer (5'-GACATTGTTCAGTTGACCAG) complementaryto nt 30 to 49 in the published rat CBGcDNAsequence (Smith and Hammond, 1989) was Y-end labeled with polynucleotide kinase and [y-32P]ATP. This was then annealed to 10 p.gof yeast tRNA (lane 2), no RNA (lane 3), or 10 gg rat liver poly(A)+RNA (lane 4) in the presence of 10 gg yeast tRNA (10 min at 85°C, 10 min at 45°C), and extended (60 min at 42°C) with 20 units AMV reverse transcriptase (Life Sciences) in 50mM Tris.HC1 (pH8.3)/40mM KC1/7mM MgCI2/1 mM DTT/1 mM dNTP/0.I mg BSA per ml. Extension products were purified by phenol:chloroformextraction and ethanol precipitation, resolved by electrophoresis through an 8M urea-8% polyacrylamidegel, and identified by autoradiography for 16 h.
is higher (85%) within the first 200 bp of these promoters which contain TATA and CAAT-box motifs (Fig. 2). We have not completely m a p p e d rat Cbg, but its promoter and first non-coding exon clearly share sequence similarity with the corresponding region of human Cbg (Fig. 2). Like ~ I - P I (Carlson et al., 1988), production of C B G is not confined to the liver, and mouse CBG m R N A has been detected in several extrahepatic tissues during fetal and postnatal development (Scrocchi et al., 1993a,b). Both genes are expressed in the kidney, and transcription of c~l-PI in the liver and kidney initiates from the same tsp (Kelsey et al., 1987). The pCbg we have characterized may therefore regulate transcription in cell types other than hepatocytes.
207 -439
GATCACTGAAT
-447
CTTCAC
CATTGGGAGG
.... C CTGAGATAG
-383
CA- - -CAT-TCATTCATGCCTCTCTGTTTCTC-CCAC : ::: :: :: :: : : :
-389
TATTC
-340
TCTTCCCCTCCTGT-GCCAGGCACCTCGCTCCCC :: : : : : : :: :: : :::::
CCCAGGGAAAGTC
CTTGCATGGCCA
- -AGTCATTGTGAAGATTTCGTGAGATAATCCAGAGGAAG
CATGTCTGT
CT CT CCCAC
CGCTTGG ............
AG
:
GAGCTAAACACCTATTTTT
:
TCATCCCCAATTG
TTCTTAACGACACCAATGAGTCCCCTGCCAGGTGGCACAGGGCAACCACAAATACTGACG
-136
:
-269
TAATTAAGGGCAC
:
::::
:
::
CTAAGA
:
::::::
::
::::::
::::::
:::
-ACCACAT
CAACT
CCAGCCACACTTTGATATTAAAAATAAAACTAGGGACAGGATGCAGTGTCAAGTT
-215
CAACT
C -AGCCACA-TTTGGTATTAAAAAGACTTC
....
-ATAGATTG
-ACGCAGAG
:
1
AATTTG CAGAATTGCATGTTTACCCTCACTTTTTATAAAGCCTCCCATTGGTTGATGCTC : :: : : : : ::: :::: : : :: : : :: ::::::
-160
A -TTGG
-106
AGGGGGTGGGGACCAC
CAAATGGTGAAGGCCACTG
-104
TCGGGGAGAGGACTAC
CAAGCGGTGAAGGCCACTGG
-
46
CAAGATACCAG-CAAACAAGATTTAGTAGG-AGTCTCC-CCGAAGCCTTactgtaogtgt
-
49
CCAGGAAGCTGGCAAACAAAATTTAACAGGCAGCATCCACCGCAGGCTTactgtacacat
CAG CATTCTGTGTTACTCAGCTCTCCTGACAA-
GCCTCC
:::::::
:::
:
- ATTGGTTAATGA
-C
--p, pS
F <
P1 [
q
C C CCTCTCCTCTAACCATTAAC C .....
P3 -148 -136
- CAAGTT
F
-166
1"5
TGATG
P2 I
--~,
P4
<
P3 I
zx-
-llO
P4
-226
5 10 2 0 4 0
-216 --~-214 --~-
CTTTTTACAAGTATCTGCACCTTGGTGC
CATCTCTGCCAACTGACACAGGC-
- 0.1
< -239
F---::::
AG
4
.... ACA -GAGTCCATGCCATGGTGC ::: : :: :: : : : : : :
-286
:
3
CAGACTAAGACCACTGGAAGGCAGGACCTTGCCCAAG
-329
P5
2
<
CCTTGCCTGAT :::::::
::::
1
CAGATAT
-68
CAG
-110
CCTCTAACCATTAACCAC
•
L +i
gctaggat tcctgggcagcaaagcacaaccagaaggaacagccggagcccacagcagcag ::::::
:
::
::
:::::
:
:
::::
::::::::::
::::::::
::::
gctagggt -ccaggacagcaggaccaagccagcagaaacagcctgagcccaccgcagact GACCAGT aoGTGAGTCACCCCT
::::::
::
AGggcctggt
:::
lntron
--GTTGAGTAACACCT
primer
-TGACTTGTTACAG ca-act
gaacaatgtc
:::::::::
:
AGggcctggct
atactggacaatgcc
::::
::::::
Rat
: Human
Fig. 2. Comparison of the rat and human pCbg and exon I sequences. The region from -439 relative to the tsp (+ 1) to the beginning of intron I of the rat pCbg is compared with the corresponding sequence within human Cbg. Identical residues are indicated with a colon, and gaps required to align the sequences are shown as dashes. The bold lower-case letters represent nt present in exons I and II. The region of rat DNA encompassing nt + 1 to + 73 represents the nt sequence for exon I that is separated from exon II by an intervening sequence (intron I) for which the 5' GT splice donor and 3' AG splice acceptor sites are shown (underlined). In addition, the olignucleotide used in primer extension experiments is shown above the rat exon II sequence. Sequences that resemble TATA and CAAT-box motifs are indicated in bold type, and potential cis-elements identified within DNase I footprints (see Fig. 3) which resemble consensus binding sites for known trans-acting factors are defined by brackets P1-PS. This sequence has been deposited with GenBank under accession No. U23215.
(b) DNase I footprinting of the ratpCbg to + 4 of t h e rat Cbg g e n e was
The region from -145
u s e d in a D N a s e I f o o t p r i n t i n g e x p e r i m e n t to i d e n t i f y protein-DNA
i n t e r a c t i o n s t h a t c o u l d c o n t r i b u t e to its
r e g u l a t i o n (Fig. 3A). T w o d i s t i n c t r e g i o n s of D N a s e
I
p r o t e c t i o n w e r e c r e a t e d in the p r e s e n c e of c r u d e rat liver n u c l e a r e x t r a c t s (lanes 2 a n d 3 in Fig. 3A), a n d these c o m p r i s e nt - 4 2 -136
to - 6 8
( d e n o t e d P1) a n d
-110
to
(P2). I n a d d i t i o n , t h r e e D N a s e I h y p e r s e n s i t i v e
sites ( o p e n a r r o w h e a d s
in Fig. 3A) u n d e r g o e n h a n c e d
c l e a v a g e in t h e p r e s e n c e of n u c l e a r p r o t e i n ( c o m p a r e l a n e s 1 a n d 2 to 3 a n d 4 in Fig. 3A), a n d m a y reflect c o n f o r m a t i o n a l c h a n g e s in the D N A helix. A f o u r t h site of h y p e r sensitivity
exists
at
the
upstream
boundary
of P2
-42
Fig. 3. DNase I footprints in the nt - 300 to + 4 region of the rat pCbg. Methods: Two DNase I footprinting probes were generated as follows: a DNA fragment comprising nt -145 to +4 of the rat pCbg was prepared by exonuclease III and S1 nuclease digestion of a Sau3AIRsaI fragment that spans the nt -439 to +4 bp region of the promoter. The deleted fragment was directionally cloned into pBluescript KS + such that it could be excised with EcoRI+XbaI to allow specific 3' end-labeling of the XbaI site with [~-32p]dCTP. The entire (Sau3AIRsaI) nt -439 to +4 bp fragment was excised from pBluescript KS + and labeled in the same manner. Rat liver nuclear protein extracts were prepared, and footprinting reactions and electrophoretic analyses of the products were as described by others (Lichtsteiner et al., 1987). (A) The region of the rat pCbg that spans nt -145 to +4 relative to the tsp was 3'-end-labeled on the coding strand using PolIk. Approx. 10000 cpm of probe was incubated in the absence (lanes 1 and 4) or presence of 10 gg of rat liver nuclear protein (lanes 2 and 3) and then treated with DNaseI at two different concentrations (0.033 and 0.025 units). The products of these reactions were resolved on a sequencing gel (see the legend to Fig. 1) and identified by autoradiography. The boundaries of DNase I footprints (solid arrowheads shown on the right) were determined by comparison to a Maxam and Gilbert (1980) AG cleavage reaction of the same probe. Sites of DNaseI hypersensitivity are indicated by open arrowheads (shown on the left). (B) A Sau3AI-RsaI restriction fragment that spans nt -439 to +4 of the rat pCbg was end-labeled on the coding strand using PolIk. Approx. 10000 cpm of probe was incubated in the absence (-) or presence of 0.1, 5, 10, 20 or 40 gg of rat liver nuclear protein, and then treated with DNase I. In addition, 40 gg of nuclear protein extract was subject to heat denaturation (90°C for 10 min) to identify heat-stable binding activities (A). Footprint boundaries are identified (solid arrowheads) and DNaseI hypersensitivity sites are indicated by open arrowheads.
(Fig. 3A). T h e f o o t p r i n t i n g analysis was e x t e n d e d in the 5' d i r e c t i o n to i n c l u d e a n a d d i t i o n a l 301 b p of t h e r a t
a n d t h e s e p r o t e c t e d nt - 148 to - 170, - 189 to - 2 1 4
pCbg b y u s i n g a Sau3AI-RsaI f r a g m e n t t h a t c o m p r i s e s
a n d - 2 1 6 to - 2 3 6 , r e s p e c t i v e l y (Fig. 3B). B i n d i n g to site
nt - 4 3 9
to + 4 r e l a t i v e to the m R N A c a p site (Fig. 3B).
P 2 was r e d u c e d in this c o n t e x t a n d m a y be i n h i b i t e d b y
T h r e e o t h e r b i n d i n g activities w e r e p r e s e n t (P3 to P5),
p r o t e i n s b i n d i n g to u p s t r e a m sites. T h e P 4 b i n d i n g a c t i v -
208 ity was the most prominent with protection of its recognition sequence at the lowest protein concentration used. By contrast, binding to the adjacent P5 site was only evident upon heat denaturation of the extracts (Fig. 3B).
(c) Possible identity of rat pCbg DNA-binding proteins Each of the five footprints in the rat pCbg (P1-P5) comprise a sequence related to known transcription factor binding sites (Fig. 2). The P1 binding site revealed a high degree of identity to the consensus element (Frain et al., 1989) for hepatocyte nuclear factor-1 (HNF-1). This sequence is perfectly conserved in human Cbg (at nt - 5 1 to - 6 3 ) and deviates from the HNF-1 consensus element (5'-GTTAATNATTACA) at only two positions, consistent with HNF-1 sites in other liver-specific gene promoters (Frain et al., 1989). In addition, the P2 element comprised a CAAT motif on the non-coding strand. It was, therefore, compared to consensus binding sequences for various ubiquitous CAAT-box proteins, which revealed partial identity with the consensus element (5'-YAGYNNNRRCCAATCNNNNR) for CP-2 (Chodosh et al., 1988). The sequence comprised by P3 is related to the binding sequence (5'-TATGCAATATTG) for the liver-enriched transcriptional activator DBP (Mueller et al., 1990), while the P4 site resembles the HNF-3~-binding site (5'-ATGTTTGTTCTTAAATA) in the mouse albumin gene enhancer (Costa et al., 1989). Interestingly, occupation of P4 appears to inhibit binding to the P5 site which is similar to recognition sequences (5'-TKNNGNAAK) for the heat-stable, liver-specific transcription factors C/EBP (Ryden and Beemon, 1989; Maire et al., 1989) and NF-IL6 (Akira et al., 1990). The liver-enriched factor C/EBP is expressed in the kidney (Xanthopoulos et al., 1991) and is also heat-stable (Lichtsteiner et al., 1987). It is therefore a good candidate for the heat-stable binding activity that occupies the P5 site. Glucocorticoids repress transcription of Cbg in adult rats (Smith and Hammond, 1992), but we were unable to find a glucocorticoid response element within the proximal promoters of rat or human Cbg. This was not unexpected because the glucocorticoid receptor (GR) may repress transcription via physical interactions with other transcription factors rather than by binding to GR response elements (Drouin, 1993). Glucocorticoids also participate in the hepatic acute phase response (Baumann et al., 1989), but the reduction of hepatic CBG mRNA abundance during inflammation occurs more rapidly than after glucocorticoid treatment (Hammond and Smith, 1991). In this respect, I L - 6 h a s been reported to reduce CBG mRNA levels in HepG2 cells by a mechanism that does not involve transcriptional repression (Bartalena et al., 1993), despite the presence of
NF-1IL6-binding site (Akira et al., 1990) in the rat and human pCbg.
(d) Binding of P1 by HNF-1 to rat liver and H4IIEC3 nuclear proteins The binding properties of the rat pCbg P1 sequence were compared with the HNF-1-binding sequence (B site) in the rat albumin gene promoter (Herbomel et al., 1989). As a control, these analyses were also performed using an oligo that encompasses the P2 motif, but which also comprises a sequence related to P1. Details of the oligos used in these experiments are found in the legend to Fig. 4. In EMSA, radiolabeled P1 and B site produced a retarded complex of similar mobility when incubated with rat liver nuclear extracts (compare lanes 2 and 8 with lanes 1 and 7, Fig. 4A), whereas P2 bound to a protein with greater mobility (lane 5, Fig. 4A). Furthermore, unlabeled P1 oligo effectively competes for the Pl-protein complex in proportion to its excess (compare lane 2 with lanes 3 and 4, Fig. 4B) and this is also true of the B site oligo (lanes 6-8, Fig. 4B). Although the sequence of P2 is similar to that of P1, it cannot displace labeled P1 from its binding protein (lanes 5 and 6, Fig. 4B), and that P2 probably binds a different protein. By contrast, binding of the P1 element and the mouse albumin gene promoter B site cannot be distinguished and this suggests both are targets for HNF-1. Two other experiments support this conclusion: The P1 binding activity appears to be specific to cells of hepatic origin because similar protein-DNA complexes are formed using nuclear extracts prepared from rat liver (lane 3, Fig. 4C) and H4IIEC3 cells (lanes 4-7, Fig. 4C), but no specific interaction is present when HeLa cells are the source of nuclear proteins (lanes 8-10, Fig. 4C). It is clear, however, that H4IIEC3 cells contain approx. 5-fold less HNF-1 binding activity than rat liver nuclei. Furthermore, mutations in the P1 HNF-1 core-binding sequence abolish protein-binding activity (lanes 2 and 3, Fig. 4D), and fail to compete for the P1 protein complex (compare lanes 7 and 8 with lanes 5 and 6, Fig. 4D). These data support the conclusion that the PI element is a binding site for HNF-1, but two forms of HNF-1 (HNF-I~ and HNF-113) have been identified with identical DNA-binding specificities and related primary structures (De Simone et al., 1991; Mendel et al., 1991). Both are present in the adult rat liver (Nagy et al., 1994), and in preliminary experiments we have observed a supershift of a Pl-rat liver nuclear protein complex with a HNF-113 antiserum (X.-F. Zhao and G.L.H., unpublished). This is of interest because CBG and both forms of HNF-1 are synthesized in the proximal renal tubules of neonatal rats (Lazzaro et al., 1992; Scrocchi et al., 1993b). In addition, HNF-I[3 transcripts have been
209 A C-.ligo
r~Pl
xs /zg
5
1
C ('-olig~ xs
, ~
2
P2~
100 5
-
4
5
3
r -
p-g
100 5
5
6
~
7
8
B
5
~
B C-oligo
100 5
xs /~g
.
5
5
.
.
2
.
1
1 25
1
5
10
D~ O ~ O I
2
3
10 5
D C-oligo
2
i
xs
100
10 25
P I ~ 5
9
PI 100
f
p.g
3
4
~-P2 7 ~-B~ 100 5
5
10 5
6
7
100 5
10 5
100 5
8
m-----7 w - - P l - - - 7 ~ 100 10 I00 !0 5 5 5 5 5 5
m~ 100
-
5
D 4
5
6
7
8
9
I0
l
2
3
4
5
6
7
8
9
Fig. 4. EMSA of the rat pCbg promoter Pl-binding site. Methods: Double-stranded oligos comprising the rat pCbg promoter P1 element (P1, 5 ' - C T G C C C C T C T C C T C T A A C C A T T A A C C A G C A A G A T A C C A G C ) , the P2 element (P2, 5 ' - T A A A G C C T C C C A T T G G T T G A T G C T C A G G G G G T G G G G A C C A ) , a m u t a n t P1 element (m, 5 ' - C T G C C C C T C T C C T C T A G C C A T G C C T C A G C A A G A T A C C A G C ) and the mouse albumin gene promoter B-site (B, 5 ' - T G A A A G G T T A G T G T G G T T A A T G A T C T A C A G T T A T T G G T T A ) were synthesized with 5' d(G) extensions to permit end-labeling using PolIk and [-~-32P]dCTP. Approx. 10000 cpm of end-labeled oligos were used with 5 25 lag of nuclear protein in a total reaction mixture of 20 lal (Gilman et al., 1986). Complexes were allowed to form for 15 min at ambient temperature in 10 m M Tris.HC1 (pH 7.5)/2 m M MgC12/1 m M DTT/1 m M EDTA/5% (v/v) glycerol/50 m M NaC1/0.2 mg poly(dI-dC)/0.1 mg salmon sperm D N A per ml. Samples were loaded directly onto 4% polyacrylamide gels (29:1 acrylamide/bis) and run at 10 V/cm at 4°C in 50 m M Tris (pH 8.5)/0.38 M glycine/1 m M EDTA. The gels were dried and subjected to autoradiography. In each panel, labeled oligos were incubated with or without ( - ) nuclear protein extracts and unlabeled oligonucleotides (C-oligo), and protein-DNA complexes (closed arrowheads) were separated from free probe (open arrowheads) by non-denaturing 8% polyacrylamide-gel electrophoresis. (A) Radiolabeled oligos (P1, lanes 1 3; P2, lanes 4-6; B, lanes 7 9) were incubated with or without ( ) 5 lag of rat liver nuclear protein extract and a molar excess (xs) of unlabeled P1, P2 or B oligos as competitor. (B) The P1 oligo was labeled and incubated with or without ( - ) 5 lag rat liver nuclear proteins and a molar excess (xs) of unlabelled P1, P2, or B oligos. (C) A radiolabeled P1 oligo was incubated with or without ( - ) various a m o u n t s (lag) of nuclear protein extracts from rat liver (lanes 1-3), H4IIEC3 hepatoma cells (lanes 4-7), or HeLa cells (lanes 8 10). In lanes 2 and 7, a 100-fold molar excess (xs) of unlabeled P1 oligo was included. (D) Radiolabeled m oligo was incubated in the absence (lane l) or presence of 5 lag of rat liver nuclear proteins alone (lane 2) or with (lane 3) a molar excess (xs) of unlabeled m oligo. Lanes 4 9 contain the labeled P1 oligo incubated with or without ( - ) 5 lag of rat liver nuclear extracts in the presence of the indicated -fold excess (xs) of unlabeled P1 or m oligo as a competitor.
detected in the pancreas of 14.5-day rat embryos by in situ hybridization (De Simone et al., 1991), and may therefore also contribute to the pancreatic expression of murine Cbg at this stage of development (Scrocchi et al., 1993a). (e) Positive and negative regulatory domains in the rat CBG promoter A series of plasmids containing the firefly luciferase gene under the control of various rat pCbg fragments was constructed to identify cis-domains that participate in the regulation of Cbg expression in H4IIEC3 rat hepatoma
cells. As shown in Fig. 5, the proximal pCbg contained within pCbg295, which includes the PI to P5 binding activities identified by DNase I footprinting, is the most active of the constructs tested. Moreover, the loss of sites P3 to P5 that accompanies the deletion in pCbg145 causes an approx, twofold reduction in promoter activity. Comparing CBG295 to pCbg52, it is also obvious that the removal of all five protein-binding sites results in a 13-fold loss in luciferase activity. By contrast, extending the promoter region upstream from CBG295 to pCbg439 results in a twofold loss of function that is again reduced by half with the inclusion of sequences present in
210 Relotive Luciferese Activity 2 ,
I
,
4
6
8
I
I
I
10 ,
I
12 ~
I
ACKNOWLEDGEMENTS
14 ,
I
16 ,
I
18 ,
20
I
,
I
Supported
pCbg1200
Neonatal
by a M R C Health
and
Group
Grant
Development,
in F e t a l a n d an
MRC
S t u d e n t s h i p a w a r d (to D . A . U . ) a n d an O n t a r i o C a n c e r
pCbg800
Treatment
olo
pCbg437
o
pCbg295 pCbg145
O
1
o
O
and
Research
Foundation
Scholarship
(to
G.L.H.). W e t h a n k G a i l H o w a r d for s e c r e t a r i a l assistance, Dr. W a y n e F l i n t o f f for t h e p W E 1 5 c o s m i d v e c t o r a n d Dr. G o r d o n S h o r e for the p X P 2 p l a s m i d .
pCbg64 @ pCbg52
Fig. 5. Functional analyses of the rat pCbg in H4IIEC3 rat hepatoma cells. Methods: Various rat pCbg-luciferase reporter plasmids were constructed using Sinai + BglII digested pXP2, with the 5' boundary of rat pCbg295, pCbg439 and pCbg800, corresponding to NcoI, Sau3AI and RsaI sites, respectively, and their 3' boundaries being defined by the RsaI site at +4 bp relative to the tsp in the rat Cbg gene. The pCbgl200 construct was made by the ligation of an NcoI-NcoI (-1200 to -295) fragment to pCbg295. The remaining constructs, pCbg145, pCbg64 and pCbg52, were constructed by exonuclease III and S1 nuclease digestion of pCbg439. Approx. 7.5 x l0 s H4IIEC3 cells were transfected by Ca.phosphate co-precipitation with 10 lag of test plasmid and 7.5 lag pRSVBgal as an internal control. Transfections proceeded for 16 h, at which point the cells were glycerol shocked for 1 min. The cells were harvested 24 h later using phosphate-buffered saline (0.14 M NaC1/2.7 mM KC1/10 mM Na2HPO4/1.8 mM KH2PO4, pH 7.1) containing 15 mM Na3.citrate and 0.6 mM EDTA. Cell pellets were resuspended in 100 lal lysis buffer (Promega, Madison, WI, USA) and 40 lal was used to determine luciferase activity. The fluorescence levels were adjusted to account for differences in transfection efficiency and cell number between plates. The transfection efficiency was determined by assessing ]3-galactosidase activities in a colorimetric reaction using onitrophenyl-[3-D-galactopyranoside (Maniatis et al., 1982). In each case, A42o values were in the linear 0.2 to 0.8 range and were used directly to adjust luciferase levels. These values were also normalized for protein content. Baseline values of luciferase activity for mock-transfected cells, or cells receiving the promoterless plasmid pXP2, were essentially identical and were 14-fold lower than that obtained for the pCbg64 construct.
pCbg800. T h i s r e p r e s s o r effect is p a r t i a l l y o v e r c o m e b y the a d d i t i o n of s e q u e n c e s in pCbg1200. T h u s , nt - 2 9 5 to -- 52 r e p r e s e n t a p o s i t i v e c o m p o n e n t of Cbg t r a n s c r i p t i o n a l activity, w h e r e a s s e q u e n c e s l o c a t e d b e t w e e n nt -295
and -800
repress t r a n s c r i p t i o n .
(f) Conclusions W e h a v e c h a r a c t e r i z e d the p r o x i m a l p r o m o t e r of rat
Cbg a n d i d e n t i f i e d p o t e n t i a l b i n d i n g sites for several livere n r i c h e d t r a n s c r i p t i o n p r o t e i n s t h a t m a y r e g u l a t e its t r a n s c r i p t i o n a l activity. T h e s e p o t e n t i a l cis-elements are c o n s e r v e d in the h u m a n pCbg a n d o u r d a t a suggest t h a t o n e of t h e m
(P1) i n t e r a c t s w i t h H N F - 1 .
The
rat
pCbg
f u n c t i o n s in rat h e p a t o b l a s t o m a cells a n d we h a v e i d e n t i fied p r o m o t e r r e g i o n s t h a t m o d u l a t e its t r a n s c r i p t i o n a l activity.
REFERENCES Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T. and Kishimoto, T.: A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9 (1990) 1897-1906. Bartalena, L., Hammond, G.L., Farsetti, A., Flink, I.L. and Robbins, J.: Interleukin-6 inhibits corticosteroid-binding globulin synthesis by human hepatoblastoma-derived (Hep G2) cells. Endocrinology 133 (1993) 291-296. Baumann, H., Prowse, K.R., Marinkovic, S., Won, K-A. and Jahreis, G.P.: Stimulation of hepatic acute phase response by cytokines and glucocorticoids. Ann. N.Y. Acad. Sci. 557 (1989) 280 295. Carlson, J.A., Rogers, B.B., Sifers, R.N., Hawkins, H.K., Finegold, M.J. and Woo, S.L.C.: Multiple tissues express alphal-antitrypsin in transgenic mice and man. J. Clin. Invest. 82 (1988) 26 36. Chodosh, L.A., Baldwin, A.S., Carthew, R.W. and Sharp, P.A.: Human CCAAT-binding proteins have heterologous subunits. Cell 53 (1988) 11-24. Costa, R.H., Grayson, D.R. and Darnell Jr., J.E.: Multiple hepatocyteenriched nuclear factors function in the regulation of transthyretin and ~l-antitrypsin genes. Mol. Cell. Biol. 9 (1989) 1415-1425. De Simone, V., De Magistris, L., Lazzaro, D., Gerstner, J., Monaci, P., Nicosia, A. and Cortese, R.: LFB3, a heterodimer-forming homeoprotein of the LFB1 family, is expressed in specialized epithelia. EMBO J. 10 (1991) 1435 1443. Dobrovic-Jenik, D. and Milkovic, S.: Regulation of fetal Na+/K +ATPase in rat kidney by corticosteroids. Biochim. Biophys. Acta 942 (1988) 227 235. Drouin, J.: Repression of transcription by nuclear receptors. In: Parker, M.G. (Ed.), Steroid Hormone Action. Oxford University Press, New York, NY, 1993, pp. 118-140. Faict, D., Verhoeven, G., Mertens, B. and De Moor, P.: Transcortin and et2~-globulin messenger RNA activities during turpentineinduced inflammation in the rat. J. Steroid Biochem. 23 (1985) 243 246. Frain, M., Swart, G., Monaci, P., Nicosia, A., St~mpfli, S., Frank, R. and Cortese, R.: The liver-specific transcription factor LF-B1 contains a highly diverged homeobox DNA binding domain. Cell 59 (1989) 145-157. Gilman, M.Z., Wilson, R.N. and Weinberg, R.A.: Multiple proteinbinding sites in the Y-flanking region regulate c-fos expression. Mol. Cell. Biol. 6 (1986) 4305 4316. Hammond, G.L., Smith, C.L., Goping, I.S., Underhill, D.A., Harley, M.J., Reventos, J., Musto, N.A., Gunsalus, G.L. and Bardin, C.W.: Primary structure of human corticosteroid binding globulin, deduced from hepatic and pulmonary cDNAs, exhibits homology with serine protease inhibitors. Proc. Natl. Acad. Sci. USA 84 (1987)
5153-5157. Hammond, G.L. and Smith, C.L.: Bioavailability of glucocorticoids during inflammation. In: Hochberg, R.B. and Naftolin, F. (Eds.),
211 The New Biology of Steroid Hormones. Raven Press, New York, NY, 1991, pp. 177-186. Herbomel, P., Rollier, A., Tronche, F., Ott, M.-O., Yaniv, M. and Weiss, M.C.: The rat albumin promoter is composed of six distinct positive elements within 130 nucleotides. Mol. Cell. Biol. 9 (1989) 4750 4758. Ish-Horowicz, D. and Burke, J.F.: Rapid and efficient cosmid cloning. Nucleic Acids Res. 9 (1981) 2989-2998. Jansson, J-O., Oscarsson, J., Mode, A. and Ritzen, E.M.: Plasma growth hormone pattern and androgens influence the levels of corticosteroid-binding globulin in rat serum. J. Endocrinol. 122 (1989) 725 732. Kelsey, G.D., Povey, S., Bygrave, A.E. and Lovell-Badge, R.H.: Speciesand tissue-specific expression of human ~l-antitrypsin in transgenic mice. Genes Dev. 1 (1987) 161-171. Lazzaro, D., De Simone, V., De Magistris, L., Lehtonen, E. and Cortese, R.: LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development 114 (1992) 469 479. Lichtsteiner, S., Wuarin, J. and Schibler, U.: The interplay of DNAbinding proteins on the promoter of the mouse albumin gene. Cell 51 (1987) 963-973. Maire, P., Wuarin, J. and Schibler, U.: The role of cis-acting promoter elements in tissue-specific albumin gene expression. Science 244 (1989) 343-345. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982, pp. 371 372. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with basespecific chemical cleavages. Methods Enzymol. 65 (1980) 499 560. Mendel, D.B., Hansen, L.P., Graves, M.K., Conley, P.B. and Crabtree, G.R.: HNF-I~ and HNF-I[3 (vHNF-I) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev. 5 (1991) 1042-1056. Mueller, C.R., Maire, P. and Schibler, U.: DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61 (1990) 279 291. Nagy, P., Bisgaard, H.C. and Thorgeirsson, S.S.: Expression of hepatic transcription factors during liver development and oval cell differentiation. J. Cell. Biol. 126 (1994) 223-233. Orava, M., Zhao, X.F., Leiter, E. and Hammond, G.L.: Structure and chromosomal location of the gene encoding mouse corticocosteroidbinding globulin: strain differences in coding sequence and steroidbinding activity. Gene 144 (1994) 259-264.
Pemberton, P.A., Stein, P.E., Pepys, M.B., Potter, J.M. and Carrell, R.W.: Hormone binding globulins undergo serpin conformational change in inflammation. Nature 336 (1988) 257 258. Rall, L., Pictet, R., Githens, S. and Rutter, W.J.: Glucocorticoids modulate the in vitro development of the embryonic rat pancreas. J. Cell Biol. 75 (1977) 398-409. Ryden, T.A. and Beemon, K.: Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein. Mol. Cell. Biol. 9 (1989) 1155-1164. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Scrocchi, L.A., Hearn, S.A., Han, V.K.M. and Hammond, G.L.: Corticosteroid-binding globulin biosynthesis in the mouse liver and kidney during postnatal development. Endocrinology 132 (1993a) 910 916. Scrocchi, L.A., Orava, M., Smith, C.L., Han, V.K.M. and Hammond, G.L.: Spatial and temporal distribution of corticosteroid-binding globulin and its messenger ribonucleic acid in embryonic and fetal mice. Endocrinology 132 (1993b) 903-909. Seralini, G.-E., B6rub6, D., Gagn6, R. and Hammond, G.L.: The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes. Hum. Genet. 86 (1990) 73 75. Smith, C.L. and Hammond, G.L.: Rat corticosteroid binding globulin: primary structure and messenger ribonucleic acid levels in the liver under different physiological conditions. Mol. Endocrinol. 3 (1989) 420-426. Smith, C.L. and Hammond, G.L.: Ontogeny of corticosteroid-binding globulin biosynthesis in the rat. Endocrinology 128 (1991) 983-988. Smith, C.L. and Hammond, G.L.: Hormonal regulation of corticosteroid binding globulin biosynthesis in the male rat. Endocrinology 130 (1992) 2245-2251. Underhill, D.A. and Hammond, G.L.: Organization of the human corticosteroid binding globulin gene and analysis of its Y-flanking region. Mol. Endocrinol. 3 (1989) 1448-1454. Xanthopoulos, K.G., Prezioso, V.R., Chen, W.S., Sladek, F.M., Cortese, R. and Darnell Jr., J.E.: The different tissue transcription patterns of genes for HNF-1, C/EBP, HNF-3, and HNF-4, protein factors that govern liver-specific transcription. Proc. Natl. Acad. Sci. USA 88 (1991) 3807-3811.
205
GENE 09055
cis-Regulatory elements within the proximal promoter of the rat gene encoding corticosteroid-binding globulin (Transcription; hepatocyte; glucocorticoid; DNA footprinting; electrophoretic mobility-shift assay)
D. Alan Underhill and Geoffrey L. Hammond MRC Group in Fetal and Neonatal Health and Development, and Departments of Obstetrics and Gynecology, Oncology, and Biochemistry, The University of Western Ontario, London, Ontario N6A 4L6, Canada Received by J.A. Engler: 13 January 1995; Revised/Accepted: 24 March 1995; Received at publishers: 15 May 1995
SUMMARY
Corticosteroid-binding globulin (CBG) transports and modulates the bioavailability of glucocorticoids in blood plasma. It is produced predominantly by the liver, but is also produced in a complex spatial and temporal pattern during development and is regulated hormonally. The rat Cbg promoter (pCbg) has therefore been cloned to allow identification of cis-acting sequence elements that could contribute to its regulation. Five protein-binding sites (P1 to P5) were identified within 236 bp immediately 5' of the transcription start point by DNase I footprinting with rat liver nuclear extracts. These P1-P5 sites are highly conserved in the human pCbg, and resemble recognition sequences for HNF-1, CP-2, DBP, HNF-3 and C/EBP or NF-1L6, respectively. Electrophoretic mobility-shift assays indicted that the P1 element most likely binds HNF-1, and transient transfection assays with luciferase reporter plasmids demonstrated that P1-P5 represent a positive component of rat pCbg activity, whereas additional 5' sequences repressed promoter activity 2-4-fold in H4IIEC3 rat hepatoblastoma cells.
INTRODUCTION
The gene encoding corticosteroid-binding globulin (CBG) is located in the vicinity of several genes for structurally-related members of the serine proteinase inhibitor Correspondence to: Dr. G.L. Hammond, London Regional Cancer Centre, 790 Commissioners Road East, London, Ontario N6A 4L6, Canada. Tel. (1-519) 685-8617; Fax (1-519) 685-8616; e-mail: [email protected] Abbreviations: ~I-PI, alpha 1-proteinase inhibitor; aa, amino acid(s); AMV, avian myeloblastosis virus; bp, base pair(s); BSA, bovine serum albumin; C/EBP, CAAT/enhancer-binding protein; CBG, corticosteroid-binding globulin; Cbg, gene encoding CBG; CP-2, CCAAT-binding protein-2; DBP, D-site binding protein; DTT, dithiothreitol; EMSA, electrophoretic mobility-shift assay; GR, glucocorticoid receptor; HNF, hepatocyte nuclear factors; K, G or T; kb, kilobase(s) or 1000 bp; N, A or C or G or T; NF-IL6, nuclear factor-interleukin 6; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; pCbg, Cbg promoter; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; R, A or G; tsp, transcription start point(s); Y, C or T. SSDI 0378-1119(95)00337-1
gene family (Seralini et al., 1990; Orava et al., 1994), and the remarkable sequence identity between CBG and ~l-proteinase inhibitor (~I-PI) has suggested a role for CBG in the delivery of glucocorticoids at sites of inflammation (Hammond et al., 1987; Pembert0n et al., 1988). In rodents, Cbg is expressed in fetal hepatocytes, but CBG mRNA levels in neonatal livers are low to undetectable (Smith and Hammond, 1991; Scrocchi et al., 1993a). The gene is re-expressed in the liver postnatally and reaches adult levels of activity at 3 to 6 weeks of age (Smith and Hammond, 1991; Scrocchi et al., 1993b). Mouse Cbg is also expressed transiently in the fetal exocrine pancreas and the proximal convoluted tubules of the developing kidney during the first weeks after birth (Scrocchi et al., 1993a,b). Thus, CBG biosynthesis in several developing tissues may play a distinct biological role from that provided by the adult liver, and probably influences their glucocorticoid-dependent maturation. Gender-specific differences in pulsatile growth hormone
206 secretion patterns are responsible for the sexual dimorphism in rat plasma C B G levels (Jansson et al., 1989), and dexamethasone-induced decreases in plasma C B G levels in adult rats have been attributed to decreased Cbg transcription in the liver (Smith and H a m m o n d , 1992). During acute inflammation, decreased hepatic C B G biosynthesis may be due to an interleukin-6 (IL-6) induced decrease in CBG m R N A stability (Bartalena et al., 1993). Thus, C B G provides a useful paradigm for studies of the temporal, spatial and hormonal regulation of gene expression, and we have examined the rat Cbg promoter to define cis-regulatory elements that participate in its transcriptional control.
1
2
3
4
<1
~i~i~i~i~i~iii~!i~i~i~i~i~i~i~i~ii!ii;i:i~i;~ii~i~ii~ii;ii~i~!i~i!Uii!!ii!i~!ii~ii;ii~ii~ii~i~i~i RESULTS AND DISCUSSION
(a) Identification and sequence analyses of the rat Cbg promoter (pCbg) Rat genomic D N A libraries were constructed in a pWl?15 vector using Sau3AI-cleaved D N A from rat spleen, and screened by in situ colony hybridization (IshHorowicz and Burke, 1981) with a 455-bp KpnI-RsaI restriction fragment of human genomic D N A that spans the Cbg transcription start point (tsp) and promoter (Underhill and H a m m o n d , 1989). Appropriate restriction fragments of cosmid clones that hybridized with this probe were sequenced (Sanger et al., 1977). In this way, three clones (Cbgl, Cbg2 and Cbg3) were isolated, and restriction mapping of Cbgl indicated that it comprised the entire structural gene for rat C B G (data not shown). Both Cbg2 and Cbg3 spanned a similar region of the rat genome extending 5' of Cbgl, and they differed only with respect to their 5' and 3' boundaries. A 96-bp product was identified when hepatic RNA was used as a template for primer extension (lane 4, Fig. 1). Furthermore, when genomic fragments that hybridized with the h u m a n pCbg were analysed, a sequence of 17 bp that corresponds to the 5' end of a c D N A encoding rat C B G (Smith and H a m m o n d , 1989), was followed by an intron/exon junction (Fig. 2). Since this sequence was preceded by a region displaying extensive similarity with exon I and the promoter of human Cbg (bold lower-case in Fig. 2), it can be concluded that 23 nt of the primer extension product are located within exon II of rat Cbg, while the remaining 73 nt are encoded by exon I. This would also place the tsp of human and rat Cbg in an identical context (Fig. 2). The sequence spanning (nt - 4 3 9 to + 4 ) relative to the deduced tsp in rat Cbg is accommodated within a Sau3AI-RsaI fragment that exhibits 67% identity with the corresponding region of the human pCbg (Fig. 2). However, the sequence identity
Fig. 1. Primer extension analysis of hepatic rat CBGmRNA. Lane 1 is a Maxam and Gilbert (1980) AG reaction that serves as a molecular size standard. The most abundant extension product is indicated by an arrowhead. Methods: A primer (5'-GACATTGTTCAGTTGACCAG) complementaryto nt 30 to 49 in the published rat CBGcDNAsequence (Smith and Hammond, 1989) was Y-end labeled with polynucleotide kinase and [y-32P]ATP. This was then annealed to 10 p.gof yeast tRNA (lane 2), no RNA (lane 3), or 10 gg rat liver poly(A)+RNA (lane 4) in the presence of 10 gg yeast tRNA (10 min at 85°C, 10 min at 45°C), and extended (60 min at 42°C) with 20 units AMV reverse transcriptase (Life Sciences) in 50mM Tris.HC1 (pH8.3)/40mM KC1/7mM MgCI2/1 mM DTT/1 mM dNTP/0.I mg BSA per ml. Extension products were purified by phenol:chloroformextraction and ethanol precipitation, resolved by electrophoresis through an 8M urea-8% polyacrylamidegel, and identified by autoradiography for 16 h.
is higher (85%) within the first 200 bp of these promoters which contain TATA and CAAT-box motifs (Fig. 2). We have not completely m a p p e d rat Cbg, but its promoter and first non-coding exon clearly share sequence similarity with the corresponding region of human Cbg (Fig. 2). Like ~ I - P I (Carlson et al., 1988), production of C B G is not confined to the liver, and mouse CBG m R N A has been detected in several extrahepatic tissues during fetal and postnatal development (Scrocchi et al., 1993a,b). Both genes are expressed in the kidney, and transcription of c~l-PI in the liver and kidney initiates from the same tsp (Kelsey et al., 1987). The pCbg we have characterized may therefore regulate transcription in cell types other than hepatocytes.
207 -439
GATCACTGAAT
-447
CTTCAC
CATTGGGAGG
.... C CTGAGATAG
-383
CA- - -CAT-TCATTCATGCCTCTCTGTTTCTC-CCAC : ::: :: :: :: : : :
-389
TATTC
-340
TCTTCCCCTCCTGT-GCCAGGCACCTCGCTCCCC :: : : : : : :: :: : :::::
CCCAGGGAAAGTC
CTTGCATGGCCA
- -AGTCATTGTGAAGATTTCGTGAGATAATCCAGAGGAAG
CATGTCTGT
CT CT CCCAC
CGCTTGG ............
AG
:
GAGCTAAACACCTATTTTT
:
TCATCCCCAATTG
TTCTTAACGACACCAATGAGTCCCCTGCCAGGTGGCACAGGGCAACCACAAATACTGACG
-136
:
-269
TAATTAAGGGCAC
:
::::
:
::
CTAAGA
:
::::::
::
::::::
::::::
:::
-ACCACAT
CAACT
CCAGCCACACTTTGATATTAAAAATAAAACTAGGGACAGGATGCAGTGTCAAGTT
-215
CAACT
C -AGCCACA-TTTGGTATTAAAAAGACTTC
....
-ATAGATTG
-ACGCAGAG
:
1
AATTTG CAGAATTGCATGTTTACCCTCACTTTTTATAAAGCCTCCCATTGGTTGATGCTC : :: : : : : ::: :::: : : :: : : :: ::::::
-160
A -TTGG
-106
AGGGGGTGGGGACCAC
CAAATGGTGAAGGCCACTG
-104
TCGGGGAGAGGACTAC
CAAGCGGTGAAGGCCACTGG
-
46
CAAGATACCAG-CAAACAAGATTTAGTAGG-AGTCTCC-CCGAAGCCTTactgtaogtgt
-
49
CCAGGAAGCTGGCAAACAAAATTTAACAGGCAGCATCCACCGCAGGCTTactgtacacat
CAG CATTCTGTGTTACTCAGCTCTCCTGACAA-
GCCTCC
:::::::
:::
:
- ATTGGTTAATGA
-C
--p, pS
F <
P1 [
q
C C CCTCTCCTCTAACCATTAAC C .....
P3 -148 -136
- CAAGTT
F
-166
1"5
TGATG
P2 I
--~,
P4
<
P3 I
zx-
-llO
P4
-226
5 10 2 0 4 0
-216 --~-214 --~-
CTTTTTACAAGTATCTGCACCTTGGTGC
CATCTCTGCCAACTGACACAGGC-
- 0.1
< -239
F---::::
AG
4
.... ACA -GAGTCCATGCCATGGTGC ::: : :: :: : : : : : :
-286
:
3
CAGACTAAGACCACTGGAAGGCAGGACCTTGCCCAAG
-329
P5
2
<
CCTTGCCTGAT :::::::
::::
1
CAGATAT
-68
CAG
-110
CCTCTAACCATTAACCAC
•
L +i
gctaggat tcctgggcagcaaagcacaaccagaaggaacagccggagcccacagcagcag ::::::
:
::
::
:::::
:
:
::::
::::::::::
::::::::
::::
gctagggt -ccaggacagcaggaccaagccagcagaaacagcctgagcccaccgcagact GACCAGT aoGTGAGTCACCCCT
::::::
::
AGggcctggt
:::
lntron
--GTTGAGTAACACCT
primer
-TGACTTGTTACAG ca-act
gaacaatgtc
:::::::::
:
AGggcctggct
atactggacaatgcc
::::
::::::
Rat
: Human
Fig. 2. Comparison of the rat and human pCbg and exon I sequences. The region from -439 relative to the tsp (+ 1) to the beginning of intron I of the rat pCbg is compared with the corresponding sequence within human Cbg. Identical residues are indicated with a colon, and gaps required to align the sequences are shown as dashes. The bold lower-case letters represent nt present in exons I and II. The region of rat DNA encompassing nt + 1 to + 73 represents the nt sequence for exon I that is separated from exon II by an intervening sequence (intron I) for which the 5' GT splice donor and 3' AG splice acceptor sites are shown (underlined). In addition, the olignucleotide used in primer extension experiments is shown above the rat exon II sequence. Sequences that resemble TATA and CAAT-box motifs are indicated in bold type, and potential cis-elements identified within DNase I footprints (see Fig. 3) which resemble consensus binding sites for known trans-acting factors are defined by brackets P1-PS. This sequence has been deposited with GenBank under accession No. U23215.
(b) DNase I footprinting of the ratpCbg to + 4 of t h e rat Cbg g e n e was
The region from -145
u s e d in a D N a s e I f o o t p r i n t i n g e x p e r i m e n t to i d e n t i f y protein-DNA
i n t e r a c t i o n s t h a t c o u l d c o n t r i b u t e to its
r e g u l a t i o n (Fig. 3A). T w o d i s t i n c t r e g i o n s of D N a s e
I
p r o t e c t i o n w e r e c r e a t e d in the p r e s e n c e of c r u d e rat liver n u c l e a r e x t r a c t s (lanes 2 a n d 3 in Fig. 3A), a n d these c o m p r i s e nt - 4 2 -136
to - 6 8
( d e n o t e d P1) a n d
-110
to
(P2). I n a d d i t i o n , t h r e e D N a s e I h y p e r s e n s i t i v e
sites ( o p e n a r r o w h e a d s
in Fig. 3A) u n d e r g o e n h a n c e d
c l e a v a g e in t h e p r e s e n c e of n u c l e a r p r o t e i n ( c o m p a r e l a n e s 1 a n d 2 to 3 a n d 4 in Fig. 3A), a n d m a y reflect c o n f o r m a t i o n a l c h a n g e s in the D N A helix. A f o u r t h site of h y p e r sensitivity
exists
at
the
upstream
boundary
of P2
-42
Fig. 3. DNase I footprints in the nt - 300 to + 4 region of the rat pCbg. Methods: Two DNase I footprinting probes were generated as follows: a DNA fragment comprising nt -145 to +4 of the rat pCbg was prepared by exonuclease III and S1 nuclease digestion of a Sau3AIRsaI fragment that spans the nt -439 to +4 bp region of the promoter. The deleted fragment was directionally cloned into pBluescript KS + such that it could be excised with EcoRI+XbaI to allow specific 3' end-labeling of the XbaI site with [~-32p]dCTP. The entire (Sau3AIRsaI) nt -439 to +4 bp fragment was excised from pBluescript KS + and labeled in the same manner. Rat liver nuclear protein extracts were prepared, and footprinting reactions and electrophoretic analyses of the products were as described by others (Lichtsteiner et al., 1987). (A) The region of the rat pCbg that spans nt -145 to +4 relative to the tsp was 3'-end-labeled on the coding strand using PolIk. Approx. 10000 cpm of probe was incubated in the absence (lanes 1 and 4) or presence of 10 gg of rat liver nuclear protein (lanes 2 and 3) and then treated with DNaseI at two different concentrations (0.033 and 0.025 units). The products of these reactions were resolved on a sequencing gel (see the legend to Fig. 1) and identified by autoradiography. The boundaries of DNase I footprints (solid arrowheads shown on the right) were determined by comparison to a Maxam and Gilbert (1980) AG cleavage reaction of the same probe. Sites of DNaseI hypersensitivity are indicated by open arrowheads (shown on the left). (B) A Sau3AI-RsaI restriction fragment that spans nt -439 to +4 of the rat pCbg was end-labeled on the coding strand using PolIk. Approx. 10000 cpm of probe was incubated in the absence (-) or presence of 0.1, 5, 10, 20 or 40 gg of rat liver nuclear protein, and then treated with DNase I. In addition, 40 gg of nuclear protein extract was subject to heat denaturation (90°C for 10 min) to identify heat-stable binding activities (A). Footprint boundaries are identified (solid arrowheads) and DNaseI hypersensitivity sites are indicated by open arrowheads.
(Fig. 3A). T h e f o o t p r i n t i n g analysis was e x t e n d e d in the 5' d i r e c t i o n to i n c l u d e a n a d d i t i o n a l 301 b p of t h e r a t
a n d t h e s e p r o t e c t e d nt - 148 to - 170, - 189 to - 2 1 4
pCbg b y u s i n g a Sau3AI-RsaI f r a g m e n t t h a t c o m p r i s e s
a n d - 2 1 6 to - 2 3 6 , r e s p e c t i v e l y (Fig. 3B). B i n d i n g to site
nt - 4 3 9
to + 4 r e l a t i v e to the m R N A c a p site (Fig. 3B).
P 2 was r e d u c e d in this c o n t e x t a n d m a y be i n h i b i t e d b y
T h r e e o t h e r b i n d i n g activities w e r e p r e s e n t (P3 to P5),
p r o t e i n s b i n d i n g to u p s t r e a m sites. T h e P 4 b i n d i n g a c t i v -
208 ity was the most prominent with protection of its recognition sequence at the lowest protein concentration used. By contrast, binding to the adjacent P5 site was only evident upon heat denaturation of the extracts (Fig. 3B).
(c) Possible identity of rat pCbg DNA-binding proteins Each of the five footprints in the rat pCbg (P1-P5) comprise a sequence related to known transcription factor binding sites (Fig. 2). The P1 binding site revealed a high degree of identity to the consensus element (Frain et al., 1989) for hepatocyte nuclear factor-1 (HNF-1). This sequence is perfectly conserved in human Cbg (at nt - 5 1 to - 6 3 ) and deviates from the HNF-1 consensus element (5'-GTTAATNATTACA) at only two positions, consistent with HNF-1 sites in other liver-specific gene promoters (Frain et al., 1989). In addition, the P2 element comprised a CAAT motif on the non-coding strand. It was, therefore, compared to consensus binding sequences for various ubiquitous CAAT-box proteins, which revealed partial identity with the consensus element (5'-YAGYNNNRRCCAATCNNNNR) for CP-2 (Chodosh et al., 1988). The sequence comprised by P3 is related to the binding sequence (5'-TATGCAATATTG) for the liver-enriched transcriptional activator DBP (Mueller et al., 1990), while the P4 site resembles the HNF-3~-binding site (5'-ATGTTTGTTCTTAAATA) in the mouse albumin gene enhancer (Costa et al., 1989). Interestingly, occupation of P4 appears to inhibit binding to the P5 site which is similar to recognition sequences (5'-TKNNGNAAK) for the heat-stable, liver-specific transcription factors C/EBP (Ryden and Beemon, 1989; Maire et al., 1989) and NF-IL6 (Akira et al., 1990). The liver-enriched factor C/EBP is expressed in the kidney (Xanthopoulos et al., 1991) and is also heat-stable (Lichtsteiner et al., 1987). It is therefore a good candidate for the heat-stable binding activity that occupies the P5 site. Glucocorticoids repress transcription of Cbg in adult rats (Smith and Hammond, 1992), but we were unable to find a glucocorticoid response element within the proximal promoters of rat or human Cbg. This was not unexpected because the glucocorticoid receptor (GR) may repress transcription via physical interactions with other transcription factors rather than by binding to GR response elements (Drouin, 1993). Glucocorticoids also participate in the hepatic acute phase response (Baumann et al., 1989), but the reduction of hepatic CBG mRNA abundance during inflammation occurs more rapidly than after glucocorticoid treatment (Hammond and Smith, 1991). In this respect, I L - 6 h a s been reported to reduce CBG mRNA levels in HepG2 cells by a mechanism that does not involve transcriptional repression (Bartalena et al., 1993), despite the presence of
NF-1IL6-binding site (Akira et al., 1990) in the rat and human pCbg.
(d) Binding of P1 by HNF-1 to rat liver and H4IIEC3 nuclear proteins The binding properties of the rat pCbg P1 sequence were compared with the HNF-1-binding sequence (B site) in the rat albumin gene promoter (Herbomel et al., 1989). As a control, these analyses were also performed using an oligo that encompasses the P2 motif, but which also comprises a sequence related to P1. Details of the oligos used in these experiments are found in the legend to Fig. 4. In EMSA, radiolabeled P1 and B site produced a retarded complex of similar mobility when incubated with rat liver nuclear extracts (compare lanes 2 and 8 with lanes 1 and 7, Fig. 4A), whereas P2 bound to a protein with greater mobility (lane 5, Fig. 4A). Furthermore, unlabeled P1 oligo effectively competes for the Pl-protein complex in proportion to its excess (compare lane 2 with lanes 3 and 4, Fig. 4B) and this is also true of the B site oligo (lanes 6-8, Fig. 4B). Although the sequence of P2 is similar to that of P1, it cannot displace labeled P1 from its binding protein (lanes 5 and 6, Fig. 4B), and that P2 probably binds a different protein. By contrast, binding of the P1 element and the mouse albumin gene promoter B site cannot be distinguished and this suggests both are targets for HNF-1. Two other experiments support this conclusion: The P1 binding activity appears to be specific to cells of hepatic origin because similar protein-DNA complexes are formed using nuclear extracts prepared from rat liver (lane 3, Fig. 4C) and H4IIEC3 cells (lanes 4-7, Fig. 4C), but no specific interaction is present when HeLa cells are the source of nuclear proteins (lanes 8-10, Fig. 4C). It is clear, however, that H4IIEC3 cells contain approx. 5-fold less HNF-1 binding activity than rat liver nuclei. Furthermore, mutations in the P1 HNF-1 core-binding sequence abolish protein-binding activity (lanes 2 and 3, Fig. 4D), and fail to compete for the P1 protein complex (compare lanes 7 and 8 with lanes 5 and 6, Fig. 4D). These data support the conclusion that the PI element is a binding site for HNF-1, but two forms of HNF-1 (HNF-I~ and HNF-113) have been identified with identical DNA-binding specificities and related primary structures (De Simone et al., 1991; Mendel et al., 1991). Both are present in the adult rat liver (Nagy et al., 1994), and in preliminary experiments we have observed a supershift of a Pl-rat liver nuclear protein complex with a HNF-113 antiserum (X.-F. Zhao and G.L.H., unpublished). This is of interest because CBG and both forms of HNF-1 are synthesized in the proximal renal tubules of neonatal rats (Lazzaro et al., 1992; Scrocchi et al., 1993b). In addition, HNF-I[3 transcripts have been
209 A C-.ligo
r~Pl
xs /zg
5
1
C ('-olig~ xs
, ~
2
P2~
100 5
-
4
5
3
r -
p-g
100 5
5
6
~
7
8
B
5
~
B C-oligo
100 5
xs /~g
.
5
5
.
.
2
.
1
1 25
1
5
10
D~ O ~ O I
2
3
10 5
D C-oligo
2
i
xs
100
10 25
P I ~ 5
9
PI 100
f
p.g
3
4
~-P2 7 ~-B~ 100 5
5
10 5
6
7
100 5
10 5
100 5
8
m-----7 w - - P l - - - 7 ~ 100 10 I00 !0 5 5 5 5 5 5
m~ 100
-
5
D 4
5
6
7
8
9
I0
l
2
3
4
5
6
7
8
9
Fig. 4. EMSA of the rat pCbg promoter Pl-binding site. Methods: Double-stranded oligos comprising the rat pCbg promoter P1 element (P1, 5 ' - C T G C C C C T C T C C T C T A A C C A T T A A C C A G C A A G A T A C C A G C ) , the P2 element (P2, 5 ' - T A A A G C C T C C C A T T G G T T G A T G C T C A G G G G G T G G G G A C C A ) , a m u t a n t P1 element (m, 5 ' - C T G C C C C T C T C C T C T A G C C A T G C C T C A G C A A G A T A C C A G C ) and the mouse albumin gene promoter B-site (B, 5 ' - T G A A A G G T T A G T G T G G T T A A T G A T C T A C A G T T A T T G G T T A ) were synthesized with 5' d(G) extensions to permit end-labeling using PolIk and [-~-32P]dCTP. Approx. 10000 cpm of end-labeled oligos were used with 5 25 lag of nuclear protein in a total reaction mixture of 20 lal (Gilman et al., 1986). Complexes were allowed to form for 15 min at ambient temperature in 10 m M Tris.HC1 (pH 7.5)/2 m M MgC12/1 m M DTT/1 m M EDTA/5% (v/v) glycerol/50 m M NaC1/0.2 mg poly(dI-dC)/0.1 mg salmon sperm D N A per ml. Samples were loaded directly onto 4% polyacrylamide gels (29:1 acrylamide/bis) and run at 10 V/cm at 4°C in 50 m M Tris (pH 8.5)/0.38 M glycine/1 m M EDTA. The gels were dried and subjected to autoradiography. In each panel, labeled oligos were incubated with or without ( - ) nuclear protein extracts and unlabeled oligonucleotides (C-oligo), and protein-DNA complexes (closed arrowheads) were separated from free probe (open arrowheads) by non-denaturing 8% polyacrylamide-gel electrophoresis. (A) Radiolabeled oligos (P1, lanes 1 3; P2, lanes 4-6; B, lanes 7 9) were incubated with or without ( ) 5 lag of rat liver nuclear protein extract and a molar excess (xs) of unlabeled P1, P2 or B oligos as competitor. (B) The P1 oligo was labeled and incubated with or without ( - ) 5 lag rat liver nuclear proteins and a molar excess (xs) of unlabelled P1, P2, or B oligos. (C) A radiolabeled P1 oligo was incubated with or without ( - ) various a m o u n t s (lag) of nuclear protein extracts from rat liver (lanes 1-3), H4IIEC3 hepatoma cells (lanes 4-7), or HeLa cells (lanes 8 10). In lanes 2 and 7, a 100-fold molar excess (xs) of unlabeled P1 oligo was included. (D) Radiolabeled m oligo was incubated in the absence (lane l) or presence of 5 lag of rat liver nuclear proteins alone (lane 2) or with (lane 3) a molar excess (xs) of unlabeled m oligo. Lanes 4 9 contain the labeled P1 oligo incubated with or without ( - ) 5 lag of rat liver nuclear extracts in the presence of the indicated -fold excess (xs) of unlabeled P1 or m oligo as a competitor.
detected in the pancreas of 14.5-day rat embryos by in situ hybridization (De Simone et al., 1991), and may therefore also contribute to the pancreatic expression of murine Cbg at this stage of development (Scrocchi et al., 1993a). (e) Positive and negative regulatory domains in the rat CBG promoter A series of plasmids containing the firefly luciferase gene under the control of various rat pCbg fragments was constructed to identify cis-domains that participate in the regulation of Cbg expression in H4IIEC3 rat hepatoma
cells. As shown in Fig. 5, the proximal pCbg contained within pCbg295, which includes the PI to P5 binding activities identified by DNase I footprinting, is the most active of the constructs tested. Moreover, the loss of sites P3 to P5 that accompanies the deletion in pCbg145 causes an approx, twofold reduction in promoter activity. Comparing CBG295 to pCbg52, it is also obvious that the removal of all five protein-binding sites results in a 13-fold loss in luciferase activity. By contrast, extending the promoter region upstream from CBG295 to pCbg439 results in a twofold loss of function that is again reduced by half with the inclusion of sequences present in
210 Relotive Luciferese Activity 2 ,
I
,
4
6
8
I
I
I
10 ,
I
12 ~
I
ACKNOWLEDGEMENTS
14 ,
I
16 ,
I
18 ,
20
I
,
I
Supported
pCbg1200
Neonatal
by a M R C Health
and
Group
Grant
Development,
in F e t a l a n d an
MRC
S t u d e n t s h i p a w a r d (to D . A . U . ) a n d an O n t a r i o C a n c e r
pCbg800
Treatment
olo
pCbg437
o
pCbg295 pCbg145
O
1
o
O
and
Research
Foundation
Scholarship
(to
G.L.H.). W e t h a n k G a i l H o w a r d for s e c r e t a r i a l assistance, Dr. W a y n e F l i n t o f f for t h e p W E 1 5 c o s m i d v e c t o r a n d Dr. G o r d o n S h o r e for the p X P 2 p l a s m i d .
pCbg64 @ pCbg52
Fig. 5. Functional analyses of the rat pCbg in H4IIEC3 rat hepatoma cells. Methods: Various rat pCbg-luciferase reporter plasmids were constructed using Sinai + BglII digested pXP2, with the 5' boundary of rat pCbg295, pCbg439 and pCbg800, corresponding to NcoI, Sau3AI and RsaI sites, respectively, and their 3' boundaries being defined by the RsaI site at +4 bp relative to the tsp in the rat Cbg gene. The pCbgl200 construct was made by the ligation of an NcoI-NcoI (-1200 to -295) fragment to pCbg295. The remaining constructs, pCbg145, pCbg64 and pCbg52, were constructed by exonuclease III and S1 nuclease digestion of pCbg439. Approx. 7.5 x l0 s H4IIEC3 cells were transfected by Ca.phosphate co-precipitation with 10 lag of test plasmid and 7.5 lag pRSVBgal as an internal control. Transfections proceeded for 16 h, at which point the cells were glycerol shocked for 1 min. The cells were harvested 24 h later using phosphate-buffered saline (0.14 M NaC1/2.7 mM KC1/10 mM Na2HPO4/1.8 mM KH2PO4, pH 7.1) containing 15 mM Na3.citrate and 0.6 mM EDTA. Cell pellets were resuspended in 100 lal lysis buffer (Promega, Madison, WI, USA) and 40 lal was used to determine luciferase activity. The fluorescence levels were adjusted to account for differences in transfection efficiency and cell number between plates. The transfection efficiency was determined by assessing ]3-galactosidase activities in a colorimetric reaction using onitrophenyl-[3-D-galactopyranoside (Maniatis et al., 1982). In each case, A42o values were in the linear 0.2 to 0.8 range and were used directly to adjust luciferase levels. These values were also normalized for protein content. Baseline values of luciferase activity for mock-transfected cells, or cells receiving the promoterless plasmid pXP2, were essentially identical and were 14-fold lower than that obtained for the pCbg64 construct.
pCbg800. T h i s r e p r e s s o r effect is p a r t i a l l y o v e r c o m e b y the a d d i t i o n of s e q u e n c e s in pCbg1200. T h u s , nt - 2 9 5 to -- 52 r e p r e s e n t a p o s i t i v e c o m p o n e n t of Cbg t r a n s c r i p t i o n a l activity, w h e r e a s s e q u e n c e s l o c a t e d b e t w e e n nt -295
and -800
repress t r a n s c r i p t i o n .
(f) Conclusions W e h a v e c h a r a c t e r i z e d the p r o x i m a l p r o m o t e r of rat
Cbg a n d i d e n t i f i e d p o t e n t i a l b i n d i n g sites for several livere n r i c h e d t r a n s c r i p t i o n p r o t e i n s t h a t m a y r e g u l a t e its t r a n s c r i p t i o n a l activity. T h e s e p o t e n t i a l cis-elements are c o n s e r v e d in the h u m a n pCbg a n d o u r d a t a suggest t h a t o n e of t h e m
(P1) i n t e r a c t s w i t h H N F - 1 .
The
rat
pCbg
f u n c t i o n s in rat h e p a t o b l a s t o m a cells a n d we h a v e i d e n t i fied p r o m o t e r r e g i o n s t h a t m o d u l a t e its t r a n s c r i p t i o n a l activity.
REFERENCES Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T. and Kishimoto, T.: A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9 (1990) 1897-1906. Bartalena, L., Hammond, G.L., Farsetti, A., Flink, I.L. and Robbins, J.: Interleukin-6 inhibits corticosteroid-binding globulin synthesis by human hepatoblastoma-derived (Hep G2) cells. Endocrinology 133 (1993) 291-296. Baumann, H., Prowse, K.R., Marinkovic, S., Won, K-A. and Jahreis, G.P.: Stimulation of hepatic acute phase response by cytokines and glucocorticoids. Ann. N.Y. Acad. Sci. 557 (1989) 280 295. Carlson, J.A., Rogers, B.B., Sifers, R.N., Hawkins, H.K., Finegold, M.J. and Woo, S.L.C.: Multiple tissues express alphal-antitrypsin in transgenic mice and man. J. Clin. Invest. 82 (1988) 26 36. Chodosh, L.A., Baldwin, A.S., Carthew, R.W. and Sharp, P.A.: Human CCAAT-binding proteins have heterologous subunits. Cell 53 (1988) 11-24. Costa, R.H., Grayson, D.R. and Darnell Jr., J.E.: Multiple hepatocyteenriched nuclear factors function in the regulation of transthyretin and ~l-antitrypsin genes. Mol. Cell. Biol. 9 (1989) 1415-1425. De Simone, V., De Magistris, L., Lazzaro, D., Gerstner, J., Monaci, P., Nicosia, A. and Cortese, R.: LFB3, a heterodimer-forming homeoprotein of the LFB1 family, is expressed in specialized epithelia. EMBO J. 10 (1991) 1435 1443. Dobrovic-Jenik, D. and Milkovic, S.: Regulation of fetal Na+/K +ATPase in rat kidney by corticosteroids. Biochim. Biophys. Acta 942 (1988) 227 235. Drouin, J.: Repression of transcription by nuclear receptors. In: Parker, M.G. (Ed.), Steroid Hormone Action. Oxford University Press, New York, NY, 1993, pp. 118-140. Faict, D., Verhoeven, G., Mertens, B. and De Moor, P.: Transcortin and et2~-globulin messenger RNA activities during turpentineinduced inflammation in the rat. J. Steroid Biochem. 23 (1985) 243 246. Frain, M., Swart, G., Monaci, P., Nicosia, A., St~mpfli, S., Frank, R. and Cortese, R.: The liver-specific transcription factor LF-B1 contains a highly diverged homeobox DNA binding domain. Cell 59 (1989) 145-157. Gilman, M.Z., Wilson, R.N. and Weinberg, R.A.: Multiple proteinbinding sites in the Y-flanking region regulate c-fos expression. Mol. Cell. Biol. 6 (1986) 4305 4316. Hammond, G.L., Smith, C.L., Goping, I.S., Underhill, D.A., Harley, M.J., Reventos, J., Musto, N.A., Gunsalus, G.L. and Bardin, C.W.: Primary structure of human corticosteroid binding globulin, deduced from hepatic and pulmonary cDNAs, exhibits homology with serine protease inhibitors. Proc. Natl. Acad. Sci. USA 84 (1987)
5153-5157. Hammond, G.L. and Smith, C.L.: Bioavailability of glucocorticoids during inflammation. In: Hochberg, R.B. and Naftolin, F. (Eds.),
211 The New Biology of Steroid Hormones. Raven Press, New York, NY, 1991, pp. 177-186. Herbomel, P., Rollier, A., Tronche, F., Ott, M.-O., Yaniv, M. and Weiss, M.C.: The rat albumin promoter is composed of six distinct positive elements within 130 nucleotides. Mol. Cell. Biol. 9 (1989) 4750 4758. Ish-Horowicz, D. and Burke, J.F.: Rapid and efficient cosmid cloning. Nucleic Acids Res. 9 (1981) 2989-2998. Jansson, J-O., Oscarsson, J., Mode, A. and Ritzen, E.M.: Plasma growth hormone pattern and androgens influence the levels of corticosteroid-binding globulin in rat serum. J. Endocrinol. 122 (1989) 725 732. Kelsey, G.D., Povey, S., Bygrave, A.E. and Lovell-Badge, R.H.: Speciesand tissue-specific expression of human ~l-antitrypsin in transgenic mice. Genes Dev. 1 (1987) 161-171. Lazzaro, D., De Simone, V., De Magistris, L., Lehtonen, E. and Cortese, R.: LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development 114 (1992) 469 479. Lichtsteiner, S., Wuarin, J. and Schibler, U.: The interplay of DNAbinding proteins on the promoter of the mouse albumin gene. Cell 51 (1987) 963-973. Maire, P., Wuarin, J. and Schibler, U.: The role of cis-acting promoter elements in tissue-specific albumin gene expression. Science 244 (1989) 343-345. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982, pp. 371 372. Maxam, A.M. and Gilbert, W.: Sequencing end-labeled DNA with basespecific chemical cleavages. Methods Enzymol. 65 (1980) 499 560. Mendel, D.B., Hansen, L.P., Graves, M.K., Conley, P.B. and Crabtree, G.R.: HNF-I~ and HNF-I[3 (vHNF-I) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev. 5 (1991) 1042-1056. Mueller, C.R., Maire, P. and Schibler, U.: DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61 (1990) 279 291. Nagy, P., Bisgaard, H.C. and Thorgeirsson, S.S.: Expression of hepatic transcription factors during liver development and oval cell differentiation. J. Cell. Biol. 126 (1994) 223-233. Orava, M., Zhao, X.F., Leiter, E. and Hammond, G.L.: Structure and chromosomal location of the gene encoding mouse corticocosteroidbinding globulin: strain differences in coding sequence and steroidbinding activity. Gene 144 (1994) 259-264.
Pemberton, P.A., Stein, P.E., Pepys, M.B., Potter, J.M. and Carrell, R.W.: Hormone binding globulins undergo serpin conformational change in inflammation. Nature 336 (1988) 257 258. Rall, L., Pictet, R., Githens, S. and Rutter, W.J.: Glucocorticoids modulate the in vitro development of the embryonic rat pancreas. J. Cell Biol. 75 (1977) 398-409. Ryden, T.A. and Beemon, K.: Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein. Mol. Cell. Biol. 9 (1989) 1155-1164. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Scrocchi, L.A., Hearn, S.A., Han, V.K.M. and Hammond, G.L.: Corticosteroid-binding globulin biosynthesis in the mouse liver and kidney during postnatal development. Endocrinology 132 (1993a) 910 916. Scrocchi, L.A., Orava, M., Smith, C.L., Han, V.K.M. and Hammond, G.L.: Spatial and temporal distribution of corticosteroid-binding globulin and its messenger ribonucleic acid in embryonic and fetal mice. Endocrinology 132 (1993b) 903-909. Seralini, G.-E., B6rub6, D., Gagn6, R. and Hammond, G.L.: The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes. Hum. Genet. 86 (1990) 73 75. Smith, C.L. and Hammond, G.L.: Rat corticosteroid binding globulin: primary structure and messenger ribonucleic acid levels in the liver under different physiological conditions. Mol. Endocrinol. 3 (1989) 420-426. Smith, C.L. and Hammond, G.L.: Ontogeny of corticosteroid-binding globulin biosynthesis in the rat. Endocrinology 128 (1991) 983-988. Smith, C.L. and Hammond, G.L.: Hormonal regulation of corticosteroid binding globulin biosynthesis in the male rat. Endocrinology 130 (1992) 2245-2251. Underhill, D.A. and Hammond, G.L.: Organization of the human corticosteroid binding globulin gene and analysis of its Y-flanking region. Mol. Endocrinol. 3 (1989) 1448-1454. Xanthopoulos, K.G., Prezioso, V.R., Chen, W.S., Sladek, F.M., Cortese, R. and Darnell Jr., J.E.: The different tissue transcription patterns of genes for HNF-1, C/EBP, HNF-3, and HNF-4, protein factors that govern liver-specific transcription. Proc. Natl. Acad. Sci. USA 88 (1991) 3807-3811.