- Email: [email protected]
Citrate utilization by homo- and heterofermentative lactobacilli
Microbiol. Res. (2000) 154, 313 - 320 http://www.urbanfischer.de/journals/microbiolres
Citrate utilization by homo- and heterofermentative lactobacilli R. Medina de Figueroaa.b, F. Alvareza, A. Pesce de Ruiz Holgadoa,b, G. a b
Olive~,
F. Sesmaa
Centro de Referencia para Lactobacilos (CERELA), Chacabuco 145,4000 Tucuman, Argentina Instituto de Microbiologia, Facultad de Bioquimica, Quimica y Farmacia, Universidad Nacional de Tucuman, Argentina
Accepted: August 3 I, 1999
Abstract Citrate utilization by several homo- and heterofermentative lactobacilli was determined in Kempler and McKay and in calcium citrate media. The last medium with glucose permitted best to distinguish citrate-fermenting lactobacilli. Lactobacillus rhamnosus ATCC 11443, Lactobacillus zeae ATCC 15820 and Lactobacillus plantarum ATCC 8014 used citrate as sole energy source, whereas in the other strains, glucose and citrate were cometabolized. Some lactobacilli strains produced aroma compounds from citrate. Citrate transport experiments suggested that all strains studied presented a citrate transport system inducible by citrate. The levels of induction were variable between several strains. Dot blot experiment showed that lactobacilli do not present an equivalent plasmid coding for citrate permease.
Key words: Lactobacillus - citrate transport and fermentation - flavour compounds
Introduction Citrate is present in milk and fermentable plant materials, and is also used as an additive for the production of fennented sausages. Some of the products of citrate metabolism, particularly diacetyl and acetoin, are important in detennining the flavour of fennented dairy products, while CO2 production is responsible for eye fonnation in some cheeses. However, in fermented food the production of succinic, formic and acetic acids from citrate by lactobacilli may become detrimental because of the pungent and penetrating odour of formic acid, the strong and characteristic odour of acetic acid and the salty and bitter flavour of succinic acid. Corresponding author: R. Medina de Figueroa e-mail: [email protected] 0944-5013/00/154/04-313
$12.00/0
Considering that citrate metabolites could be beneficial or detrimental for fermented food, it is important to control the citrate fermentation by lactic acid bacteria. Biochemical studies of citrate metabolism in several lactic acid bacteria have previously been published (Cogan 1981; Kempler and McKay 1981; Mellerick and Cogan 1981 ; Hickey et al. 1983; Verhue and Tj an 1990; Palles et al. 1998; Medina de Figueroa et al. 1998). The presence of a specific transport system is essential for the metabolism of citrate. In Lactococcus and Leuconostoc, it has been demonstrated that citrate transport requires the action of a citrate permease, whose gene is plasmid encoded (Kempler and McKay 1981; Gasson and Davies 1984; Sesma et al. 1990 ; David et al. 1990). Marty-Teysset et at. (1996) reported that, in resting cells of Leuconostoc mesenteroides grown in the presence or absence of citrate, the citrate transporter, CitP, and citrate lyase are constitutively expressed. In the genus Lactococcus, consumption of citrate and expression of its gene does not depend on the presence of citrate in the growth medium (Smith et al. 1992; Magni et al. 1994). Our laboratory has reported an inducible, glucose-regulated citrate transport system in Lactobacillus rhamnosus ATCC 7469 (De Figueroa et al. 1996). The aim of this work is to determine the ability and mechanism to utilize citrate by different lactobacilli species.
Materials and methods Bacterial cultures. The lactobacilli strains were obtained from the American Type Culture Collection and are listed in Table 1. Selection of citrate-fermenting lactobacilli in differential media. Kempler and McKay medium (KM) (Kempler and McKay 1980) and calcium citrate meMicrobiol. Res. 154 (2000) 4
313
Table 1. Screening of citrate fermenting lactobacilli strains.
Strain
Kempler and McKay
L. alimentarius ATCC 29643 a L. buchneri ATCC 4005 a L. rhamnosus ATCC 11443b L. zeae ATCC 15820b L. confusus ATCC 1088 p.e L. curvatus ATCC 25601 a Ljermentum ATCC 9338 a L.fructivorans ATCC 15435 a L.fructosus ATCC 13162a L. helveticus ATCC 15009b L. mali ATCC 27053 a L. murinus ATCC 35020b L. paracasei susp. paracasei ATCC 25598 b L. paracasei susp. tolerans ATCC 25599b L. pentosus ATCC 8041 a L. plantarum ATCC 10241 b L. plantarum ATCC 14917b L. plantarum ATCC 10012b L. plantarum ATCC 8014b L. viridescens ATCC U706 a.d L. sake ATCC 15521 a
+
Calcium citrate Lactose
Glucose
+ +
+ + + + +
+
+ +
+ + + +
+
+ + + + + +
Kempler and McKay medium: + blue colonies; - white colonies. Calcium citrate medium: + zones of clearing around colonies; colonies without zones of clearing. a: Temperature of incubation 30 ac. b: Temperature of incubation 37 ac. c: new name Weisella confusa (Int. 1. Syst. Bacteriol., 1994, vol. 44 pp. 370-371). d: new name Weisella viridescens (Int. 1. Syst. Bacteriol., 1994, vol. 44 pp. 370-371). dium supplemented with 15 gil lactose (CCL) or 3 gil glucose (CCG) (Galeslod et al. 1961) were used for the screening of citrate-fermenting lactobacilli. The temperature of incubation is indicated in Table 1. Growth and citrate utilization in complex media LAPT. The complex medium LAPT pH 6.5 (Raibaud et al. 1973), containing 15 gil peptone, 10 gil tryptone, 10 gil yeast extract and 1 ml of Tween 80, was employed as basal culture medium. Cells were propagated in LAPTg 1% (LAPT plus 10 gil glucose). Citrate utilization was studied in LAPTc (LAPT plus 5 gil sodium citrate), LAPTg (LAPT plus 1 gil glucose) and LAPTc+g (LAPTc plus 1 gil glucose). The basal culture medium was sterilized at 121°C for 15 min. After autoclaving, sterile solutions of glucose and sodium citrate were added to give the required concentrations of sugar and citrate. The media were inoculated at 2 % with a cell suspension from an over night culture in LAPTg 1%. After inoculation the absorbance was measured at 540 nm. Citrate transport assays. The assays were carried out as described previously by Sesma et af. (1990) with [l,5_ 14C]citrate (82.20 mCi/mmol). Lactobacilli strains 314
Microbiol. Res. 154 (2000) 4
were grown on LAPTg, LAPTc, LAPTc+g. All cultures, in log phase of growth, were washed and res upended in 50 mM sodium phosphate buffer pH 5.5, containing 10 mM glucose at a protein concentration of 0.1-0.5 mg/m!. The scintillation counter cocktail was Aquasol-2 (Dupont). The strain Lactobacillus fermentum ATCC 9338 was used as negative control of citrate transport, since this microorganism does not utilize citrate (Table 1). Genetic manipulations. Plasmid DNA from lactobacilli were isolated from 5 ml cultures as described previously by Muriana and Klaenhammer (1991) with 20 mglml of lysozyme. Chromosomal DNA was isolated by the method of Pospiech and Newman (1995). Dot blot hybridization and detection were performed by using the NEBlot™ Phototope™ kit (Biolabs, New England). DNA hybridization and stringent washing were carried out at 68°C and 58 °C, respectively. The probe was obtained by PCR of citP gene (citrate permease P) of Lactococcus lactis biovar diacetylactis CRL 1127, using the primers CitP 1 (5' AGACATATGATGAATCACCCG) and CitP2 (5'CTTGGATCCAAGGTTTCCTCG), according to the nucleotide sequence of
the citP gene of Lactococcus lac tis CRL 264 (P. Lopez, unpublished data). The probe was labeled using Biotin-16 dUTP in the PCR mixture. The reaction mixture contained 2.5 )11 of 10 x Taq DNA polymerase buffer, 0.5 U Taq DNA polymerase (PROMEGA), 0.5 U Pfu DNA polymerase, 2 mM MgCl 2, 20 ng of genomic DNA, 200 )1M dATP, dCTP and dGTP, 190 )1M dTTP, and 0.25 )1M of each primer (CitP 1 and CitP2) in a final volume of 25 )11. DNA amplification was preformed in a DNA thermal cycler (Perkin Elmer 480) for 35 cycles consisting of a denaturation step for 5 min at 94°C, an annealing step for 1 min at 55 °C, and an elongation step for 2 min at 72 0c. Analytical methods. Citrate was determined by an enzymatic method (Boehringer, Mannheim, Germany). Glucose was estimated with a glucose oxidase-peroxidase system (Wiener, Rosario, Argentina). Protein concentration was estimated by the method of Lowry et al. (1951) with bovine serum albumin as standard. Diacetyl, acetoin and 2,3 butanediol were determined by the method of Hill et al. (1954)
Results Screening of citrate-fermenting lactobacilli in differential media Table 1 shows the citrate utilization ability of 23 lactobacilli strains on Kempler and McKay and calcium citrate media supplemented with glucose or lactose. L. con/usus ATCC 10881, L. mali ATCC 27053, L. pentosus ATCC 8041, L. plantarum ATCC 10241, L. plantarum ATCC 14917 and L. plantarum ATCC 8014 grew as blue colonies on Kempler and McKay medium. L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 showed zones of clearing around colonies on CCL. The CCG medium permitted to detect 12 additional citrate-fermenting strains compared with KM medium (Table l). L. alimentarius ATCC 29643, L. buchneri ATCC 4005, L. curvatus
ATCC 25601, L. /ermentum ATCC 9338, L. helveticus ATCC 15009, L. paracasei subsp, paracasei ATCC 25598 andL. paracasei subsp. tolerans ATCC 25599 did not utilize citrate in both media studied. L. pentosus ATCC 8041 presented a particular behavior since this strain was citrate positive only in KM medium L. con/usus ATCC 10881 and L. mali ATCC 27053 utilized citrate on KM and CCG, but were negative on CCL. Growth and citrate utilization in complex medium The effect of citrate on the growth rate and its utilization by lactobacilli were determined in complex LAPT media, supplemented with citrate (LAPTc), glucose in limiting concentration (LAPTg) and glucose plus citrate (LAPTc+g) (Table 2). The citrate-fermenting strains selected for this study were L. rhamnosus ATCC 11443, L. zeae ATCC 15820, L. sake ATCC 15521 (negative on KM medium), L. con/usus ATCC 10881, L. mali ATCC 27053, L. plantarum ATCC 10241, L. plantarum ATCC 8014 and L. pentosus ATCC 8041 (positive on KM medium). The growth rate of L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 increased when citrate was added to LAPT medium. This result suggests that these strains could use citrate as sole energy source (Table 2). The growth rates of L. con/usus, L. mali, L. plantarum ATCC 10241, L. sake and L. pentosus in LAPT and LAPTc media were similar, indicating that these microorganisms did not utilize citrate as sole energy source. Citrate had no effect on the growth rate in media with glucose (LAPTc+g), except for L. rhamnosus ATCC 11443 (Table 2). The citrate utilization during the growth was studied in L. rhamnosus ATCC 11443, L. zeae ATCC 15820, L. con/usus ATCC 10881 and L. mali ATCC 27053. The 00 was increased on LAPTc compared with LAPT media in L. rhamnosus and L. zeae (Fig. Ie, D). The addition of glucose to LAPT or LAPTc resulted in
Table 2. Growth rate of lactobacilli strains in complex medium. Growth rate (h- 1) Microorganisms
LAPT
LAPTc
LAPTg
LAPTc+g
L. L. L. L. L. L. L. L.
0.19 0.17 0.13 0.12 0.18 0.17 0.18 0.21
0.26 0.18 0.28 0.14 0.20 0.25 0.21 0.21
0.35 0.36 0.43 0.36 0.47 0.32 0.38 0.30
0.45 0.37 0.44 0.38 0.35 0.36 0.39 0.33
rhamnosus ATCC 11443 confusus ATCC 10881 zeae ATCC 15820 mali ATCC 27053 plantarum ATCC 10241 plantarum ATCC 8014 sake ATCC 15521 pentosus ATCC 8041
Microbiol. Res. 154 (2000) 4
315
6 A
6B
10
5
- B---o...
5
~ G
"-
~
'E' t:: 0
it
!l
(Q
\
0.1
~ d 0
B:
4
0- -
~
9
3
2
0.01
. 2
0
§
d
.=
't- _
4
- -. "6
"-
7 8 9 Time (h)
- - -- 0 10 12 24
-111- III ;:: -Q -
-x ,
-o--~
'>\
\
3 I
f cc
I
0
,:,
2
0.1 I
2
4
-., -., 6
,
7 8 9 Time (h)
2
~
E'
81/1 CD
.-..
'0
.=
(Q
2
\
1
~.,
• -., 6
4
\
\
7 8 9 Time (h)
10 12 24
0
6
10
e-
5
-0, ~~
,
D
4
1
'E' t:: 0
3
;j!) ~
d 0
B:
a-!
E'
§
CD ...... (Q
2
0.1
.=
I
I
- t_ ..
0
B:
it
\
~ x
Et::
~
.. -
- 181::: -0- '%.
iii
c:i
0.01
C
4 S:
Q
\
5
\
3 \
0.1
~
"-
"-
"-
\
6
0
d
\
"-
~
~
10
0.01
-t
.-.. (Q
CD
til
0
1.0
I I
-
E'
4
1
'E' t::
\
\ I I \ I I I
x
0 10 12 24
- "--t0.01
0
2
4
I
-. 6
\
"-
"-
7 8 9 Time (h)
\ I II
1
0 10 12 24
Fig. 1. Growth and citrate and glucose utilization by lactobacilli in complex medium. Solid lines, growth in LAPT Ce); LAPTg (_); LAPTc (D ); LAPTc+g (.... ). Dotted lines, citrate utilization in LAPTc medium (X), in LAPTc+g medium (0); glucose utilization in LAPTc+g medium (.) . A: L. confusus ATCC 10881; B: L. mali ATCC 27053; C: L. rhamnosus ATCC11443; D: L. zeae ATCC 15820.
significantly greater OD in the four strains studied. (Fig. lA-D). L. mali and L. confusus co-metabolized citrateglucose: The latter strain also presented the highest citrate consumption rates (Fig. lA). L. rhamnosus and L. zeae did not present co-metabolism of citrate-glucose (Fig. lC, D). Glucose was consumed as primary energy source by these strains. 316
Microbiol. Res. 154 (2000) 4
Selection of lactobacilli strains that produce diacetyl and acetoin from citrate To study the production of aroma compounds (diacetyl and acetoin) by citrate-fermenting lactobacilli, these microorganisms were grown in media LATP with glucose, citrate and glucose plus citrate, respectively (Table 3). L. rhamnosus ATCC 11443, L. zeae 15820,
Table 3. Screening of lactobacilli for aroma in compound production from citrate. Strain
LAPTg
LAPTc
LAPTc+g
L. rhamnosus ATCC 11443 L. zeae ATCC 15820 L. confusus ATCC 10881 L. fructivorans ATCC 15435 L. mali ATCC 27053 L. murinus ATCC 35020 L. pentosus ATCC 8041 L. plantarum ATCC 10241 L. plantarum ATCC 14917 L. plantarumATCC 10012 L. plantarum ATCC 8014 L. viridescens ATCC 12706 L. sake ATCC 15521
+ +
+
++ ++
+
+
+++
+
+
++
+
+
+ +++
LAPTg: LAPT plus 1 gil glucose, LAPTc: LAPT plus 5 gil glucose, LAPTc+g: LAPTg plus 5 gil citrate. +++, intensive production; ++, medium production; +, weak production; -, absence of production. Table 4. Dot blot of plasmid DNA and chromosomic DNA. Strain
Plasmid DNA
L. rhamnosus ATCC 11443 L. zeae ATCC 15820 L. confusus ATCC 10881 L. fructivorans ATCC 15435 L. mali ATCC 27053 L. murinus ATCC 35020 L. pentosus ATCC 8041 L. plantarum ATCC 10241 L. plantarum ATCC 14917 L. plantarum ATCC 10012 L. plantarum ATCC 8014 L. viridescens ATCC 12706 L. sake ATCC 15521
Chromosmal DNA +
++ +
+
+ +
DNA hybridization and washes were carried out at 58°C.
L. mali ATCC 27053, L. pentosus ATCC 8041 and L. plantarum ATCC 8014 produced aroma compounds from glucose. In this strain, the addition of citrate increased the synthesis of aroma compounds. L. plantarum ATCC 10012 only produced aroma compounds from glucose plus citrate. The other strains tested did not produce aroma compounds. L. fructosus ATCC 13162 was capable to produce aroma compounds on LAPT medium with 1 gil fructose and 5 gil citrate.
Citrate transport L. rhamnosus ATCC 11443 cells grown in absence of citrate (LAPTg) were unable to take it up (Fig.2C). However, when the cells were grown in presence of citrate (LAPTc or LAPTc+g) the [1,5- 14C]citrate was incorporated. The citrate transport was lower in cells
grown on LAPTc+g than on LAPTc, suggesting that glucose could negatively regulate the citrate transport system. This effect was observed in L. rhamnosus ATCC 7469 (De Figueroa et at. 1996). L. zeae ATCC15820 cells (Fig.2D) grown in LAPTc and LAPTc+g media showed a citrate transport rate ten and three times higher, respectively, than cells grown on LAPTg. The same behavior was observed by L. plantarumATCC 8014. L. confusus ATCC 10881 cells grown in LAPTg medium presented a low citrate transport level. This transport increased six to seven times when the cells were grown in presence of citrate (LAPTc+g) (Fig. 2A). The citrate transport rate of L. mali cells grown in presence (LAPTc+g) of citrate was twice higher than that of cells cultured in LAPTg (Fig.2B). However, citrate incorporation rate in this microorganism was lower than that in L. confusus ATCCI0881. Similar Microbiol. Res. 154 (2000) 4
317
3.5
1.2.---------------,
A
B
3 ~
:s-a>
2.5
e
~ If 2 CiS Q.
g'
:::..
E
~ 0.6
.s 1:: §.
u
~ 1.5
.s..
I
c::
~ 0.4 a>
!
IIa>
~
0.8
Q.
:a
0 0.2
0.5
;!
;!
0 5
0
2
3
0
4
Time(min)
6
C
--... r!
4
0
2 Time (min)
4
3
D
5
.5
a>
'0
Q.
~
u
~
4
3
.s 1::
8. 2
-....... II)
c::
l!!
Q)
1ii u
0
;!
2
3
4
Tine(mn)
2
3
4
Time (min)
Fig. 2. Citrate transport. Cell suspension of lactobacilli grown in: LAPTg C-) LAPTc CD); LAPTc+g C.6.). The radioactivity of [1,5- 14C]citrate transported was expressed as nmolfmg protein. The citrate transport of Lactobacillus fermentum ATCC 9338 was determined as negative control Ce). A: L. confusus ATCC 10881 ; B: L. mali ATCC 27053; C: L. rhamnosus ATCC 11443; D: L. zeae ATCC 15820.
results were obtained for L. sake ATCC 15521, L. plantarum ATCC 10241 and L. pentosus ATCC 8041. Homology to cUP gene of Lactococcus lactis
Plasmid and chromosomal DNAs of citrate-fermenting lactobacilli were analyzed by dot-blot hybridization with the citP gene of Lactococcus lactis biovar. diacety318
Microbiol. Res. 154 (2000) 4
lactis CRL 1127. Under stringent washing conditions (68°C), no signal of hybridization was found. When the washing conditions were lowered to 58°C no hybridization was observed with plasmid DNAs isolated from the all lactobacilli strains (Table 4). However, in these conditions the chromosomal DNAs of L. confusus ATCC 10881, L. viridescens ATCC 12706, L. rhamnosus ATCC 11443, L. plantarum ATCC8014, L. plan-
tarum 10241 and L.fructivorans ATCC15435 showed a relatively weak signal with the citP probe. These results suggest that the cUP gene from Lactobacillus does not have a considerable homology to that found in Lactococcus and Leuconostocs.
Discussion Lactobacilli have considerable commercial significance in the food industries; strains are widely used in dairy, feed, alcoholic beverage, pickling and silage process (Rose 1981) Some lactobacilli strains have citrate fermenting ability. Because the need for distinguishing between citrate-fermenting and non-citrate-fermenting in mixed starter strains, several researchers have developed agar media to distinguish these microorganisms (Galeslod et at. 1961; Kempler and McKay 1980). The citrate utilization ability by homo- and heterofermentative lactobacilli was determined in the Kempler and McKay and calcium citrate media (Table 1). Our results indicate that KM medium, commonly used for detecting Lactococcus and Leuconostoc citrate-fermenting strains, may contain some inhibitory compounds for the citrate utilization system for some Lactobacillus strains. The calcium citrate medium with glucose was the most adequate for selecting citrate-fermenting lactobacilli. The citrate consumption by lactobacilli in complex medium was studied. Several strains presented different mechanisms of citrate utilization (Table 2 and Fig. 1). Drinan et at. (1976) observed that in media with glucose, citrate stimulated final growth of leuconostocs, streptococci and homo fermentative lactobacilli. However, citrate did not effect their growth rate. In heterofermentative lactobacilli the growth rate was stimulated by citrate. Pediococcus halophilus (Kanbe and Uchida 1985), a homofermentative lactic acid bacterium, used citrate as sole energy source. Recently, Palles et al. (1998), reported that citrate was not used as an energy source by L. plantarum 1919 and L. casei ATCC 393 and did not affect the growth rate when co-metabolized with glucose and galactose. Our results demonstrated that L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 used citrate as sole energy source. These lactobacilli did not co-metabolize citrate with glucose (Fig.IC, D). De Figueroa et at. (1996) already observed this effect in L. rhamnosus ATCC 7469. The other strains studied presented a co-metabolism of glucose-citrate. This behavior is similar to lactococci and leuconostocs. The production of diacetyl by the starter strains determines the flavour characteristic of fermented products. Diacetyl is beneficial in many dairy products. However, its synthesis is detrimental in sausage and
vegetable fermentations. Some strains possess aroma production ability from citrate. Although, L. mali ATCC 27053 and L. pentosus ATCC 8041 presented low citrate transport rate, they were capable to produce aroma compounds from citrate. In lactococci and leuconostocs, citrate metabolism requires the action of a citrate permease protein that transports citrate inside the cell. Magni et al. (1994) reported that the transcription of the cUP gene of Lactococcus lactis CRL 264 did not depend on the presence of citrate. Recently, this laboratory has reported that the citrate transport system of Lactococcus lactis CRL 264 is induced by acid stress (Garcia-Quintans et al. 1998). In Leuconostoc mesenteroides CitP is constitutively expressed (Marty-Teysset et al. 1996). Our citrate transport experiments suggest that the citrate-fermenting strains studied, presented a citrate transport system inducible by citrate. The levels of induction were different in the strains studied. The ability to transport citrate in the genera Lactococcus and Leuconostoc is linked to plasmid DNA (Kempler and McKay 1981; Gasson and Davies 1984; Sesma et al. 1990; David et al. 1990). The citrate permease genes of these genera were sequenced, and found to be highly homologous (David et al. 1990; Vaughan et al. 1995; Bandell et al. 1998). We demonstrated that the lactobacilli strains studied do not have a plasmid citP equivalent to that of Lactococcus and Leuconostocs. The chromosomic location of citrate utilization genes in lactobacilli gives a stable character for this phenotype, an advantageous feature in food industries. So far, little information has been available about mechanisms of citrate transport in the genus Lactobacillus. Therefore more biochemical and genetic information will be necessary to control the citrate fermentation by these microorganisms.
Acknowledgements This work was suppported by grants from Consejo de Investigaciones de 1a Universidad Naciona1 de Tucuman (CIUNT) and PEl 257/98 from CONICET (Argentina).
References Bandell, M., Lhotte, M. E., Marty-Teysset, c., Veyrat, A., Prevost, H., Dartois, v., Divies, c., Konings, W. N., Lo1kema, J. S. (1998): Mechanism of the citrate transporters in carbohydrate and citrate cometabolism in Lactococcus and Leuconostoc species. Appl. Environ. Microbiol. 64, 1594-1600. Cogan, T. M. (1981): Constitutive nature of enzymes of citrate metabolism in Streptococcus lactis subsp. diacetylactis. 1. Dairy Res. 48,489-495. Microbial. Res. 154 (2000) 4
319
David, S., van der Rest, M. E., Driessen, A. 1. M., Simmons, G., de Vos, W. M. (1990): Nucleotide sequence and expression in Escherichia coli of the Lactococcus lactis citrate permease gene. 1. Bacteriol. 172,5789-5794. De Figueroa, R. M., Benito de Cardenas, I., Sesma, F., Alvarez, F., Pesce de Ruiz Holgado, A., Oliver, G. (1996): Inducible transport of citrate in Lactobacillus rhamnosus ATCC 7469. 1. Appl. Bacteriol. 81, 348-354. Drinan D. F., Tobin, S., Cogan, T M. (1976): Citric acid metabolism in hetero- and homofermentative lactic acid bacteria. Appl. Environ. Microbiol. 31,481-486. Galeslod, T E., Hassing, F., Stadhouuders, 1. (1961): Agar medium for the isolation and enumeration of aroma bacteria in starters. Neth Milk Dairy 1. 15, 127-129. Gracia-Quintans, N., Magni, c., de Mendoza, D., Lopez, P. (1998): The citrate transport system of Lactococcus lactis subsp. lactis biovar. diacetylactis is induced by acid stress. Appl. Environ. Microbiol. 64, 850-857. Gasson, M. 1., Davies, F. L. (1984): The genetics of dairy lactic acid bacteria. Advances in the microbiology and biochemistry of cheese and fermented milks. Elsevier Applied Science Publishers. Ltd., London. pp. 99-126. Hickey, M. w., Hillier, A. 1., Jago, G. R. (1983): Metabolism of pyruvate and citrate in lactobacilli. Aust. 1. BioI. Sci. 36, 487-496. Hill, E. c., Wenzel, F. w., Barreto, A. (1954): Colorimetric method for detection of microbiological spoilage in citrus juice. Food Technol. 8, 168 -171. Kanbe, Ch. Uchida, K. (1987) : Citrate metabolism by Pediococcus halophilus. Appl. Environ. Microbiol. 53, 1257-1262. Kempler, G. M., McKay, L. L. (1980): Improved medium for detection of citrate-fermenting Streptococcus lactis subsp. diacetylactis. Appl. Environ. Microbiol. 30, 926-927. Kempler, G. M., McKay, L. L. (1981): Biochemistry and genetics of citrate utilization in Streptococcus lactis subsp. diacetylactis. 1. Dairy Sci. 64, 1527-1539. Lowry, O. H., Rosebrough, W. 1., Farr, A. L., Randall, R. 1. (1951) : Protein measurements with the folin phenol reagent. 1. BioI. Chern. 193,265-275. Magni, c., L6pez de Felipe, F., Sesma, F., L6pez, P., de Mendoza, D. (1994): Citrate transport in Lactococcus lactis biovar. diacetylactis: expression of the plasmid-borne citrate permease P. FEMS Microbiol. Lett. 118,75-82. Marty-Teysset, c., Lolkema, 1. S., Schmitt, P., Divies, c., Konings, W. N. (1996): The citrate metabolic pathway in Leuconostoc mesenteroides: Expression, amino acid synthesis, and a-ketocarboxylate transport. 1. Bacteriol. 178, 6209-6215.
320
Microbial. Res. 154 (2000) 4
Mellerick, D., Cogan, T M. (1981): Induction of some enzymes of citrate metabolism in Leuconostoc lactis and other heterofermentative lactic acid bacteria. J. Dairy Res. 48, 497-502. Medina de Figueroa, R., Cerutti de Guglielmone, G., Benito de Cardenas, I., Oliver, G. (1998): Flavour compound production and citrate metabolism in Lactobacillus rhamnosus ATCC 7469. Milchwissenschaft 53, 617-619. Muriana, P, Klaenhammer, T R. (1991): Cloning, phenotypic expression, and DNA sequence of the gene for Lactocin F, an antimicrobial peptide produced by Lactobacillus spp. 1. Bacteriol.I73,1779-1788. Palles, T, Beresford, T, Condon, S., Cogan, T M. (1998): Citrate metabolism in Lactobacillus casei and Lactobacillus plantarum. 1. Appl. Microbiol. 85,147-154. Pospiech, A., Newman, B. (1995): A versatile quick-prep of genomic DNA from Grampositive bacteria. Trends Genet. 11,217-218. Raibaud, P., Galpin, 1. v., Ducluzeau, R., Mocquot, G., Oliver, G. (1973): Le genere Lactobacillus dans Ie tube digestif du rat. I. Caracteres des souches homofermentaires isolees des rats Holo- et gnotoxeniques. Ann. Microbiol. (Institut Pasteur) 124 A, 83-109. Rose, A. H., (1981). The microbial production of food and drink. Sci. Am. 245, 127-138. Sesma, F., Gardiol, D., de Ruiz Holgado, A. P., de Mendoza, D. (1990): Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar. diacetylactis and expression in Escherichia coli. Appl. Environ. Microbiol. 56, 2099-2103. Smith, M. R. Mik6czi P., de Ree, E., Bunch, A. w., de Bont 1. A. M. (1992): The stability of the lactose and citrate plasmids in Lactococcus lactis subsp. lactis biovar. diacetylactis. FEMS Microbiol. Lett. 96,7-12. Vaughan, E. E., Silke, D., Harrington, A., Daly, C., Fitzgerald, G., de Vos, W. (1995): Characterization of plasmidencoded citrate permease (citP) genes from Leuconostoc species reveals high sequence conservation with the Lactococcus lactis citP gene. Appl. Environ Microbiol. 61, 3172-3176. Validation of the publication of new names and new combinations previously effectively published outside the IJSB. (1994): Int. 1. Syst. Bacteriol. 44, 370-371. Verhue, W. M. Tjan, F. S. B. (1990): Study of the citrate metabolism of Lactococcus lac tis subsp. lactis biovar. diacetylactis by means of I3C-nuclear magnetic resonance. Appl. Environ. Microbiol. 57, 3371-3377.
Citrate utilization by homo- and heterofermentative lactobacilli R. Medina de Figueroaa.b, F. Alvareza, A. Pesce de Ruiz Holgadoa,b, G. a b
Olive~,
F. Sesmaa
Centro de Referencia para Lactobacilos (CERELA), Chacabuco 145,4000 Tucuman, Argentina Instituto de Microbiologia, Facultad de Bioquimica, Quimica y Farmacia, Universidad Nacional de Tucuman, Argentina
Accepted: August 3 I, 1999
Abstract Citrate utilization by several homo- and heterofermentative lactobacilli was determined in Kempler and McKay and in calcium citrate media. The last medium with glucose permitted best to distinguish citrate-fermenting lactobacilli. Lactobacillus rhamnosus ATCC 11443, Lactobacillus zeae ATCC 15820 and Lactobacillus plantarum ATCC 8014 used citrate as sole energy source, whereas in the other strains, glucose and citrate were cometabolized. Some lactobacilli strains produced aroma compounds from citrate. Citrate transport experiments suggested that all strains studied presented a citrate transport system inducible by citrate. The levels of induction were variable between several strains. Dot blot experiment showed that lactobacilli do not present an equivalent plasmid coding for citrate permease.
Key words: Lactobacillus - citrate transport and fermentation - flavour compounds
Introduction Citrate is present in milk and fermentable plant materials, and is also used as an additive for the production of fennented sausages. Some of the products of citrate metabolism, particularly diacetyl and acetoin, are important in detennining the flavour of fennented dairy products, while CO2 production is responsible for eye fonnation in some cheeses. However, in fermented food the production of succinic, formic and acetic acids from citrate by lactobacilli may become detrimental because of the pungent and penetrating odour of formic acid, the strong and characteristic odour of acetic acid and the salty and bitter flavour of succinic acid. Corresponding author: R. Medina de Figueroa e-mail: [email protected] 0944-5013/00/154/04-313
$12.00/0
Considering that citrate metabolites could be beneficial or detrimental for fermented food, it is important to control the citrate fermentation by lactic acid bacteria. Biochemical studies of citrate metabolism in several lactic acid bacteria have previously been published (Cogan 1981; Kempler and McKay 1981; Mellerick and Cogan 1981 ; Hickey et al. 1983; Verhue and Tj an 1990; Palles et al. 1998; Medina de Figueroa et al. 1998). The presence of a specific transport system is essential for the metabolism of citrate. In Lactococcus and Leuconostoc, it has been demonstrated that citrate transport requires the action of a citrate permease, whose gene is plasmid encoded (Kempler and McKay 1981; Gasson and Davies 1984; Sesma et al. 1990 ; David et al. 1990). Marty-Teysset et at. (1996) reported that, in resting cells of Leuconostoc mesenteroides grown in the presence or absence of citrate, the citrate transporter, CitP, and citrate lyase are constitutively expressed. In the genus Lactococcus, consumption of citrate and expression of its gene does not depend on the presence of citrate in the growth medium (Smith et al. 1992; Magni et al. 1994). Our laboratory has reported an inducible, glucose-regulated citrate transport system in Lactobacillus rhamnosus ATCC 7469 (De Figueroa et al. 1996). The aim of this work is to determine the ability and mechanism to utilize citrate by different lactobacilli species.
Materials and methods Bacterial cultures. The lactobacilli strains were obtained from the American Type Culture Collection and are listed in Table 1. Selection of citrate-fermenting lactobacilli in differential media. Kempler and McKay medium (KM) (Kempler and McKay 1980) and calcium citrate meMicrobiol. Res. 154 (2000) 4
313
Table 1. Screening of citrate fermenting lactobacilli strains.
Strain
Kempler and McKay
L. alimentarius ATCC 29643 a L. buchneri ATCC 4005 a L. rhamnosus ATCC 11443b L. zeae ATCC 15820b L. confusus ATCC 1088 p.e L. curvatus ATCC 25601 a Ljermentum ATCC 9338 a L.fructivorans ATCC 15435 a L.fructosus ATCC 13162a L. helveticus ATCC 15009b L. mali ATCC 27053 a L. murinus ATCC 35020b L. paracasei susp. paracasei ATCC 25598 b L. paracasei susp. tolerans ATCC 25599b L. pentosus ATCC 8041 a L. plantarum ATCC 10241 b L. plantarum ATCC 14917b L. plantarum ATCC 10012b L. plantarum ATCC 8014b L. viridescens ATCC U706 a.d L. sake ATCC 15521 a
+
Calcium citrate Lactose
Glucose
+ +
+ + + + +
+
+ +
+ + + +
+
+ + + + + +
Kempler and McKay medium: + blue colonies; - white colonies. Calcium citrate medium: + zones of clearing around colonies; colonies without zones of clearing. a: Temperature of incubation 30 ac. b: Temperature of incubation 37 ac. c: new name Weisella confusa (Int. 1. Syst. Bacteriol., 1994, vol. 44 pp. 370-371). d: new name Weisella viridescens (Int. 1. Syst. Bacteriol., 1994, vol. 44 pp. 370-371). dium supplemented with 15 gil lactose (CCL) or 3 gil glucose (CCG) (Galeslod et al. 1961) were used for the screening of citrate-fermenting lactobacilli. The temperature of incubation is indicated in Table 1. Growth and citrate utilization in complex media LAPT. The complex medium LAPT pH 6.5 (Raibaud et al. 1973), containing 15 gil peptone, 10 gil tryptone, 10 gil yeast extract and 1 ml of Tween 80, was employed as basal culture medium. Cells were propagated in LAPTg 1% (LAPT plus 10 gil glucose). Citrate utilization was studied in LAPTc (LAPT plus 5 gil sodium citrate), LAPTg (LAPT plus 1 gil glucose) and LAPTc+g (LAPTc plus 1 gil glucose). The basal culture medium was sterilized at 121°C for 15 min. After autoclaving, sterile solutions of glucose and sodium citrate were added to give the required concentrations of sugar and citrate. The media were inoculated at 2 % with a cell suspension from an over night culture in LAPTg 1%. After inoculation the absorbance was measured at 540 nm. Citrate transport assays. The assays were carried out as described previously by Sesma et af. (1990) with [l,5_ 14C]citrate (82.20 mCi/mmol). Lactobacilli strains 314
Microbiol. Res. 154 (2000) 4
were grown on LAPTg, LAPTc, LAPTc+g. All cultures, in log phase of growth, were washed and res upended in 50 mM sodium phosphate buffer pH 5.5, containing 10 mM glucose at a protein concentration of 0.1-0.5 mg/m!. The scintillation counter cocktail was Aquasol-2 (Dupont). The strain Lactobacillus fermentum ATCC 9338 was used as negative control of citrate transport, since this microorganism does not utilize citrate (Table 1). Genetic manipulations. Plasmid DNA from lactobacilli were isolated from 5 ml cultures as described previously by Muriana and Klaenhammer (1991) with 20 mglml of lysozyme. Chromosomal DNA was isolated by the method of Pospiech and Newman (1995). Dot blot hybridization and detection were performed by using the NEBlot™ Phototope™ kit (Biolabs, New England). DNA hybridization and stringent washing were carried out at 68°C and 58 °C, respectively. The probe was obtained by PCR of citP gene (citrate permease P) of Lactococcus lactis biovar diacetylactis CRL 1127, using the primers CitP 1 (5' AGACATATGATGAATCACCCG) and CitP2 (5'CTTGGATCCAAGGTTTCCTCG), according to the nucleotide sequence of
the citP gene of Lactococcus lac tis CRL 264 (P. Lopez, unpublished data). The probe was labeled using Biotin-16 dUTP in the PCR mixture. The reaction mixture contained 2.5 )11 of 10 x Taq DNA polymerase buffer, 0.5 U Taq DNA polymerase (PROMEGA), 0.5 U Pfu DNA polymerase, 2 mM MgCl 2, 20 ng of genomic DNA, 200 )1M dATP, dCTP and dGTP, 190 )1M dTTP, and 0.25 )1M of each primer (CitP 1 and CitP2) in a final volume of 25 )11. DNA amplification was preformed in a DNA thermal cycler (Perkin Elmer 480) for 35 cycles consisting of a denaturation step for 5 min at 94°C, an annealing step for 1 min at 55 °C, and an elongation step for 2 min at 72 0c. Analytical methods. Citrate was determined by an enzymatic method (Boehringer, Mannheim, Germany). Glucose was estimated with a glucose oxidase-peroxidase system (Wiener, Rosario, Argentina). Protein concentration was estimated by the method of Lowry et al. (1951) with bovine serum albumin as standard. Diacetyl, acetoin and 2,3 butanediol were determined by the method of Hill et al. (1954)
Results Screening of citrate-fermenting lactobacilli in differential media Table 1 shows the citrate utilization ability of 23 lactobacilli strains on Kempler and McKay and calcium citrate media supplemented with glucose or lactose. L. con/usus ATCC 10881, L. mali ATCC 27053, L. pentosus ATCC 8041, L. plantarum ATCC 10241, L. plantarum ATCC 14917 and L. plantarum ATCC 8014 grew as blue colonies on Kempler and McKay medium. L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 showed zones of clearing around colonies on CCL. The CCG medium permitted to detect 12 additional citrate-fermenting strains compared with KM medium (Table l). L. alimentarius ATCC 29643, L. buchneri ATCC 4005, L. curvatus
ATCC 25601, L. /ermentum ATCC 9338, L. helveticus ATCC 15009, L. paracasei subsp, paracasei ATCC 25598 andL. paracasei subsp. tolerans ATCC 25599 did not utilize citrate in both media studied. L. pentosus ATCC 8041 presented a particular behavior since this strain was citrate positive only in KM medium L. con/usus ATCC 10881 and L. mali ATCC 27053 utilized citrate on KM and CCG, but were negative on CCL. Growth and citrate utilization in complex medium The effect of citrate on the growth rate and its utilization by lactobacilli were determined in complex LAPT media, supplemented with citrate (LAPTc), glucose in limiting concentration (LAPTg) and glucose plus citrate (LAPTc+g) (Table 2). The citrate-fermenting strains selected for this study were L. rhamnosus ATCC 11443, L. zeae ATCC 15820, L. sake ATCC 15521 (negative on KM medium), L. con/usus ATCC 10881, L. mali ATCC 27053, L. plantarum ATCC 10241, L. plantarum ATCC 8014 and L. pentosus ATCC 8041 (positive on KM medium). The growth rate of L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 increased when citrate was added to LAPT medium. This result suggests that these strains could use citrate as sole energy source (Table 2). The growth rates of L. con/usus, L. mali, L. plantarum ATCC 10241, L. sake and L. pentosus in LAPT and LAPTc media were similar, indicating that these microorganisms did not utilize citrate as sole energy source. Citrate had no effect on the growth rate in media with glucose (LAPTc+g), except for L. rhamnosus ATCC 11443 (Table 2). The citrate utilization during the growth was studied in L. rhamnosus ATCC 11443, L. zeae ATCC 15820, L. con/usus ATCC 10881 and L. mali ATCC 27053. The 00 was increased on LAPTc compared with LAPT media in L. rhamnosus and L. zeae (Fig. Ie, D). The addition of glucose to LAPT or LAPTc resulted in
Table 2. Growth rate of lactobacilli strains in complex medium. Growth rate (h- 1) Microorganisms
LAPT
LAPTc
LAPTg
LAPTc+g
L. L. L. L. L. L. L. L.
0.19 0.17 0.13 0.12 0.18 0.17 0.18 0.21
0.26 0.18 0.28 0.14 0.20 0.25 0.21 0.21
0.35 0.36 0.43 0.36 0.47 0.32 0.38 0.30
0.45 0.37 0.44 0.38 0.35 0.36 0.39 0.33
rhamnosus ATCC 11443 confusus ATCC 10881 zeae ATCC 15820 mali ATCC 27053 plantarum ATCC 10241 plantarum ATCC 8014 sake ATCC 15521 pentosus ATCC 8041
Microbiol. Res. 154 (2000) 4
315
6 A
6B
10
5
- B---o...
5
~ G
"-
~
'E' t:: 0
it
!l
(Q
\
0.1
~ d 0
B:
4
0- -
~
9
3
2
0.01
. 2
0
§
d
.=
't- _
4
- -. "6
"-
7 8 9 Time (h)
- - -- 0 10 12 24
-111- III ;:: -Q -
-x ,
-o--~
'>\
\
3 I
f cc
I
0
,:,
2
0.1 I
2
4
-., -., 6
,
7 8 9 Time (h)
2
~
E'
81/1 CD
.-..
'0
.=
(Q
2
\
1
~.,
• -., 6
4
\
\
7 8 9 Time (h)
10 12 24
0
6
10
e-
5
-0, ~~
,
D
4
1
'E' t:: 0
3
;j!) ~
d 0
B:
a-!
E'
§
CD ...... (Q
2
0.1
.=
I
I
- t_ ..
0
B:
it
\
~ x
Et::
~
.. -
- 181::: -0- '%.
iii
c:i
0.01
C
4 S:
Q
\
5
\
3 \
0.1
~
"-
"-
"-
\
6
0
d
\
"-
~
~
10
0.01
-t
.-.. (Q
CD
til
0
1.0
I I
-
E'
4
1
'E' t::
\
\ I I \ I I I
x
0 10 12 24
- "--t0.01
0
2
4
I
-. 6
\
"-
"-
7 8 9 Time (h)
\ I II
1
0 10 12 24
Fig. 1. Growth and citrate and glucose utilization by lactobacilli in complex medium. Solid lines, growth in LAPT Ce); LAPTg (_); LAPTc (D ); LAPTc+g (.... ). Dotted lines, citrate utilization in LAPTc medium (X), in LAPTc+g medium (0); glucose utilization in LAPTc+g medium (.) . A: L. confusus ATCC 10881; B: L. mali ATCC 27053; C: L. rhamnosus ATCC11443; D: L. zeae ATCC 15820.
significantly greater OD in the four strains studied. (Fig. lA-D). L. mali and L. confusus co-metabolized citrateglucose: The latter strain also presented the highest citrate consumption rates (Fig. lA). L. rhamnosus and L. zeae did not present co-metabolism of citrate-glucose (Fig. lC, D). Glucose was consumed as primary energy source by these strains. 316
Microbiol. Res. 154 (2000) 4
Selection of lactobacilli strains that produce diacetyl and acetoin from citrate To study the production of aroma compounds (diacetyl and acetoin) by citrate-fermenting lactobacilli, these microorganisms were grown in media LATP with glucose, citrate and glucose plus citrate, respectively (Table 3). L. rhamnosus ATCC 11443, L. zeae 15820,
Table 3. Screening of lactobacilli for aroma in compound production from citrate. Strain
LAPTg
LAPTc
LAPTc+g
L. rhamnosus ATCC 11443 L. zeae ATCC 15820 L. confusus ATCC 10881 L. fructivorans ATCC 15435 L. mali ATCC 27053 L. murinus ATCC 35020 L. pentosus ATCC 8041 L. plantarum ATCC 10241 L. plantarum ATCC 14917 L. plantarumATCC 10012 L. plantarum ATCC 8014 L. viridescens ATCC 12706 L. sake ATCC 15521
+ +
+
++ ++
+
+
+++
+
+
++
+
+
+ +++
LAPTg: LAPT plus 1 gil glucose, LAPTc: LAPT plus 5 gil glucose, LAPTc+g: LAPTg plus 5 gil citrate. +++, intensive production; ++, medium production; +, weak production; -, absence of production. Table 4. Dot blot of plasmid DNA and chromosomic DNA. Strain
Plasmid DNA
L. rhamnosus ATCC 11443 L. zeae ATCC 15820 L. confusus ATCC 10881 L. fructivorans ATCC 15435 L. mali ATCC 27053 L. murinus ATCC 35020 L. pentosus ATCC 8041 L. plantarum ATCC 10241 L. plantarum ATCC 14917 L. plantarum ATCC 10012 L. plantarum ATCC 8014 L. viridescens ATCC 12706 L. sake ATCC 15521
Chromosmal DNA +
++ +
+
+ +
DNA hybridization and washes were carried out at 58°C.
L. mali ATCC 27053, L. pentosus ATCC 8041 and L. plantarum ATCC 8014 produced aroma compounds from glucose. In this strain, the addition of citrate increased the synthesis of aroma compounds. L. plantarum ATCC 10012 only produced aroma compounds from glucose plus citrate. The other strains tested did not produce aroma compounds. L. fructosus ATCC 13162 was capable to produce aroma compounds on LAPT medium with 1 gil fructose and 5 gil citrate.
Citrate transport L. rhamnosus ATCC 11443 cells grown in absence of citrate (LAPTg) were unable to take it up (Fig.2C). However, when the cells were grown in presence of citrate (LAPTc or LAPTc+g) the [1,5- 14C]citrate was incorporated. The citrate transport was lower in cells
grown on LAPTc+g than on LAPTc, suggesting that glucose could negatively regulate the citrate transport system. This effect was observed in L. rhamnosus ATCC 7469 (De Figueroa et at. 1996). L. zeae ATCC15820 cells (Fig.2D) grown in LAPTc and LAPTc+g media showed a citrate transport rate ten and three times higher, respectively, than cells grown on LAPTg. The same behavior was observed by L. plantarumATCC 8014. L. confusus ATCC 10881 cells grown in LAPTg medium presented a low citrate transport level. This transport increased six to seven times when the cells were grown in presence of citrate (LAPTc+g) (Fig. 2A). The citrate transport rate of L. mali cells grown in presence (LAPTc+g) of citrate was twice higher than that of cells cultured in LAPTg (Fig.2B). However, citrate incorporation rate in this microorganism was lower than that in L. confusus ATCCI0881. Similar Microbiol. Res. 154 (2000) 4
317
3.5
1.2.---------------,
A
B
3 ~
:s-a>
2.5
e
~ If 2 CiS Q.
g'
:::..
E
~ 0.6
.s 1:: §.
u
~ 1.5
.s..
I
c::
~ 0.4 a>
!
IIa>
~
0.8
Q.
:a
0 0.2
0.5
;!
;!
0 5
0
2
3
0
4
Time(min)
6
C
--... r!
4
0
2 Time (min)
4
3
D
5
.5
a>
'0
Q.
~
u
~
4
3
.s 1::
8. 2
-....... II)
c::
l!!
Q)
1ii u
0
;!
2
3
4
Tine(mn)
2
3
4
Time (min)
Fig. 2. Citrate transport. Cell suspension of lactobacilli grown in: LAPTg C-) LAPTc CD); LAPTc+g C.6.). The radioactivity of [1,5- 14C]citrate transported was expressed as nmolfmg protein. The citrate transport of Lactobacillus fermentum ATCC 9338 was determined as negative control Ce). A: L. confusus ATCC 10881 ; B: L. mali ATCC 27053; C: L. rhamnosus ATCC 11443; D: L. zeae ATCC 15820.
results were obtained for L. sake ATCC 15521, L. plantarum ATCC 10241 and L. pentosus ATCC 8041. Homology to cUP gene of Lactococcus lactis
Plasmid and chromosomal DNAs of citrate-fermenting lactobacilli were analyzed by dot-blot hybridization with the citP gene of Lactococcus lactis biovar. diacety318
Microbiol. Res. 154 (2000) 4
lactis CRL 1127. Under stringent washing conditions (68°C), no signal of hybridization was found. When the washing conditions were lowered to 58°C no hybridization was observed with plasmid DNAs isolated from the all lactobacilli strains (Table 4). However, in these conditions the chromosomal DNAs of L. confusus ATCC 10881, L. viridescens ATCC 12706, L. rhamnosus ATCC 11443, L. plantarum ATCC8014, L. plan-
tarum 10241 and L.fructivorans ATCC15435 showed a relatively weak signal with the citP probe. These results suggest that the cUP gene from Lactobacillus does not have a considerable homology to that found in Lactococcus and Leuconostocs.
Discussion Lactobacilli have considerable commercial significance in the food industries; strains are widely used in dairy, feed, alcoholic beverage, pickling and silage process (Rose 1981) Some lactobacilli strains have citrate fermenting ability. Because the need for distinguishing between citrate-fermenting and non-citrate-fermenting in mixed starter strains, several researchers have developed agar media to distinguish these microorganisms (Galeslod et at. 1961; Kempler and McKay 1980). The citrate utilization ability by homo- and heterofermentative lactobacilli was determined in the Kempler and McKay and calcium citrate media (Table 1). Our results indicate that KM medium, commonly used for detecting Lactococcus and Leuconostoc citrate-fermenting strains, may contain some inhibitory compounds for the citrate utilization system for some Lactobacillus strains. The calcium citrate medium with glucose was the most adequate for selecting citrate-fermenting lactobacilli. The citrate consumption by lactobacilli in complex medium was studied. Several strains presented different mechanisms of citrate utilization (Table 2 and Fig. 1). Drinan et at. (1976) observed that in media with glucose, citrate stimulated final growth of leuconostocs, streptococci and homo fermentative lactobacilli. However, citrate did not effect their growth rate. In heterofermentative lactobacilli the growth rate was stimulated by citrate. Pediococcus halophilus (Kanbe and Uchida 1985), a homofermentative lactic acid bacterium, used citrate as sole energy source. Recently, Palles et al. (1998), reported that citrate was not used as an energy source by L. plantarum 1919 and L. casei ATCC 393 and did not affect the growth rate when co-metabolized with glucose and galactose. Our results demonstrated that L. rhamnosus ATCC 11443, L. zeae ATCC 15820 and L. plantarum ATCC 8014 used citrate as sole energy source. These lactobacilli did not co-metabolize citrate with glucose (Fig.IC, D). De Figueroa et at. (1996) already observed this effect in L. rhamnosus ATCC 7469. The other strains studied presented a co-metabolism of glucose-citrate. This behavior is similar to lactococci and leuconostocs. The production of diacetyl by the starter strains determines the flavour characteristic of fermented products. Diacetyl is beneficial in many dairy products. However, its synthesis is detrimental in sausage and
vegetable fermentations. Some strains possess aroma production ability from citrate. Although, L. mali ATCC 27053 and L. pentosus ATCC 8041 presented low citrate transport rate, they were capable to produce aroma compounds from citrate. In lactococci and leuconostocs, citrate metabolism requires the action of a citrate permease protein that transports citrate inside the cell. Magni et al. (1994) reported that the transcription of the cUP gene of Lactococcus lactis CRL 264 did not depend on the presence of citrate. Recently, this laboratory has reported that the citrate transport system of Lactococcus lactis CRL 264 is induced by acid stress (Garcia-Quintans et al. 1998). In Leuconostoc mesenteroides CitP is constitutively expressed (Marty-Teysset et al. 1996). Our citrate transport experiments suggest that the citrate-fermenting strains studied, presented a citrate transport system inducible by citrate. The levels of induction were different in the strains studied. The ability to transport citrate in the genera Lactococcus and Leuconostoc is linked to plasmid DNA (Kempler and McKay 1981; Gasson and Davies 1984; Sesma et al. 1990; David et al. 1990). The citrate permease genes of these genera were sequenced, and found to be highly homologous (David et al. 1990; Vaughan et al. 1995; Bandell et al. 1998). We demonstrated that the lactobacilli strains studied do not have a plasmid citP equivalent to that of Lactococcus and Leuconostocs. The chromosomic location of citrate utilization genes in lactobacilli gives a stable character for this phenotype, an advantageous feature in food industries. So far, little information has been available about mechanisms of citrate transport in the genus Lactobacillus. Therefore more biochemical and genetic information will be necessary to control the citrate fermentation by these microorganisms.
Acknowledgements This work was suppported by grants from Consejo de Investigaciones de 1a Universidad Naciona1 de Tucuman (CIUNT) and PEl 257/98 from CONICET (Argentina).
References Bandell, M., Lhotte, M. E., Marty-Teysset, c., Veyrat, A., Prevost, H., Dartois, v., Divies, c., Konings, W. N., Lo1kema, J. S. (1998): Mechanism of the citrate transporters in carbohydrate and citrate cometabolism in Lactococcus and Leuconostoc species. Appl. Environ. Microbiol. 64, 1594-1600. Cogan, T. M. (1981): Constitutive nature of enzymes of citrate metabolism in Streptococcus lactis subsp. diacetylactis. 1. Dairy Res. 48,489-495. Microbial. Res. 154 (2000) 4
319
David, S., van der Rest, M. E., Driessen, A. 1. M., Simmons, G., de Vos, W. M. (1990): Nucleotide sequence and expression in Escherichia coli of the Lactococcus lactis citrate permease gene. 1. Bacteriol. 172,5789-5794. De Figueroa, R. M., Benito de Cardenas, I., Sesma, F., Alvarez, F., Pesce de Ruiz Holgado, A., Oliver, G. (1996): Inducible transport of citrate in Lactobacillus rhamnosus ATCC 7469. 1. Appl. Bacteriol. 81, 348-354. Drinan D. F., Tobin, S., Cogan, T M. (1976): Citric acid metabolism in hetero- and homofermentative lactic acid bacteria. Appl. Environ. Microbiol. 31,481-486. Galeslod, T E., Hassing, F., Stadhouuders, 1. (1961): Agar medium for the isolation and enumeration of aroma bacteria in starters. Neth Milk Dairy 1. 15, 127-129. Gracia-Quintans, N., Magni, c., de Mendoza, D., Lopez, P. (1998): The citrate transport system of Lactococcus lactis subsp. lactis biovar. diacetylactis is induced by acid stress. Appl. Environ. Microbiol. 64, 850-857. Gasson, M. 1., Davies, F. L. (1984): The genetics of dairy lactic acid bacteria. Advances in the microbiology and biochemistry of cheese and fermented milks. Elsevier Applied Science Publishers. Ltd., London. pp. 99-126. Hickey, M. w., Hillier, A. 1., Jago, G. R. (1983): Metabolism of pyruvate and citrate in lactobacilli. Aust. 1. BioI. Sci. 36, 487-496. Hill, E. c., Wenzel, F. w., Barreto, A. (1954): Colorimetric method for detection of microbiological spoilage in citrus juice. Food Technol. 8, 168 -171. Kanbe, Ch. Uchida, K. (1987) : Citrate metabolism by Pediococcus halophilus. Appl. Environ. Microbiol. 53, 1257-1262. Kempler, G. M., McKay, L. L. (1980): Improved medium for detection of citrate-fermenting Streptococcus lactis subsp. diacetylactis. Appl. Environ. Microbiol. 30, 926-927. Kempler, G. M., McKay, L. L. (1981): Biochemistry and genetics of citrate utilization in Streptococcus lactis subsp. diacetylactis. 1. Dairy Sci. 64, 1527-1539. Lowry, O. H., Rosebrough, W. 1., Farr, A. L., Randall, R. 1. (1951) : Protein measurements with the folin phenol reagent. 1. BioI. Chern. 193,265-275. Magni, c., L6pez de Felipe, F., Sesma, F., L6pez, P., de Mendoza, D. (1994): Citrate transport in Lactococcus lactis biovar. diacetylactis: expression of the plasmid-borne citrate permease P. FEMS Microbiol. Lett. 118,75-82. Marty-Teysset, c., Lolkema, 1. S., Schmitt, P., Divies, c., Konings, W. N. (1996): The citrate metabolic pathway in Leuconostoc mesenteroides: Expression, amino acid synthesis, and a-ketocarboxylate transport. 1. Bacteriol. 178, 6209-6215.
320
Microbial. Res. 154 (2000) 4
Mellerick, D., Cogan, T M. (1981): Induction of some enzymes of citrate metabolism in Leuconostoc lactis and other heterofermentative lactic acid bacteria. J. Dairy Res. 48, 497-502. Medina de Figueroa, R., Cerutti de Guglielmone, G., Benito de Cardenas, I., Oliver, G. (1998): Flavour compound production and citrate metabolism in Lactobacillus rhamnosus ATCC 7469. Milchwissenschaft 53, 617-619. Muriana, P, Klaenhammer, T R. (1991): Cloning, phenotypic expression, and DNA sequence of the gene for Lactocin F, an antimicrobial peptide produced by Lactobacillus spp. 1. Bacteriol.I73,1779-1788. Palles, T, Beresford, T, Condon, S., Cogan, T M. (1998): Citrate metabolism in Lactobacillus casei and Lactobacillus plantarum. 1. Appl. Microbiol. 85,147-154. Pospiech, A., Newman, B. (1995): A versatile quick-prep of genomic DNA from Grampositive bacteria. Trends Genet. 11,217-218. Raibaud, P., Galpin, 1. v., Ducluzeau, R., Mocquot, G., Oliver, G. (1973): Le genere Lactobacillus dans Ie tube digestif du rat. I. Caracteres des souches homofermentaires isolees des rats Holo- et gnotoxeniques. Ann. Microbiol. (Institut Pasteur) 124 A, 83-109. Rose, A. H., (1981). The microbial production of food and drink. Sci. Am. 245, 127-138. Sesma, F., Gardiol, D., de Ruiz Holgado, A. P., de Mendoza, D. (1990): Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar. diacetylactis and expression in Escherichia coli. Appl. Environ. Microbiol. 56, 2099-2103. Smith, M. R. Mik6czi P., de Ree, E., Bunch, A. w., de Bont 1. A. M. (1992): The stability of the lactose and citrate plasmids in Lactococcus lactis subsp. lactis biovar. diacetylactis. FEMS Microbiol. Lett. 96,7-12. Vaughan, E. E., Silke, D., Harrington, A., Daly, C., Fitzgerald, G., de Vos, W. (1995): Characterization of plasmidencoded citrate permease (citP) genes from Leuconostoc species reveals high sequence conservation with the Lactococcus lactis citP gene. Appl. Environ Microbiol. 61, 3172-3176. Validation of the publication of new names and new combinations previously effectively published outside the IJSB. (1994): Int. 1. Syst. Bacteriol. 44, 370-371. Verhue, W. M. Tjan, F. S. B. (1990): Study of the citrate metabolism of Lactococcus lac tis subsp. lactis biovar. diacetylactis by means of I3C-nuclear magnetic resonance. Appl. Environ. Microbiol. 57, 3371-3377.