- Email: [email protected]
Citrobacter rodentium infection inhibits colonic P-glycoprotein expression
Gene Reports 18 (2020) 100549
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
Citrobacter rodentium infection inhibits colonic P-glycoprotein expression b
a,b
b
T
b
Mitul Patel , Anoop Kumar , Dulari Jayawardena , Shubha Priyamvada , Arivarasu N. Anbazhaganb, Waddah A. Alrefaia,b, Ravinder K. Gillb, Pradeep K. Dudejaa,b, ⁎ Seema Saksenaa,b, a b
Jesse Brown VA Medical Center, United States of America Division of Gastroenterology and Hepatology, Department of Medicine, University of Illinois at Chicago, Chicago, IL, United States of America
A R T I C LE I N FO
A B S T R A C T
Keywords: C. rodentium Pgp P-glycoprotein Infectious colitis MDR1 Inflammatory bowel disease IBD
P-glycoprotein (Pgp/MDR1) serves as a biological barrier that protects intestinal epithelial cells (IECs) by transporting out xenobiotics and bacterial toxins. Decreased Pgp function and expression has been seen in mouse models of inflammatory colitis and also in patients with IBD. Pgp knockout mice spontaneously develop severe colitis, which is also seen in human patients with ulcerative colitis. However, whether Pgp is also altered in infectious colitis is not known. Citrobacter rodentium (CR), a murine pathogen has been shown to cause colonic hyperplasia and colitis in mice by attaching to IECs. The current study investigated the direct effects of Citrobacter rodentium infection on intestinal Pgp expression in mice. Mice were challenged with a single dose of C. rodentium (1 × 109 CFU) by oral gavage for 9 days and Pgp expression in the ileum and colon was measured by real time qRT-PCR and immunofluorescence studies. Our results showed that C. rodentium infection significantly decreased Pgp mRNA and protein expression in the colon, although no significant change was observed in the ileum of mice. These findings suggest that inhibition of the efflux protein, Pgp by C. rodentium can cause perturbations in the intestinal epithelial integrity, which could further lead to the pathogenesis of intestinal inflammation as observed in infectious colitis.
1. Introduction The body's primary means of defense against toxins and drugs ingested orally is the gastrointestinal tract. Perturbation of the intestinal epithelial integrity in the gastrointestinal tract contributes to mucosal inflammation as observed in inflammatory bowel diseases (IBD) (Podolsky, 1999; Schmitz et al., 1999). In this regard, P-glycoprotein (Pgp/ABCB1) has been shown to play a crucial role in the maintenance of intestinal homeostasis by transporting various drugs/xenobiotics and bacterial toxins out of the mucosa into the gut lumen (Schinkel, 1997). Pgp is a transmembrane protein, known to be highly phosphorylated and glycosylated (Cario, 2017; Ho et al., 2003), and is abundantly expressed apically on intestinal epithelial cells (IECs) localized in the small intestine and colon (Schinkel, 1997). The role of Pgp in contributing to the pathophysiology of intestinal inflammation was evident from studies in Pgp knockout mice. Similar to patients with ulcerative
colitis, Pgp KO mice have also been observed to exhibit spontaneous colitis (Panwala et al., 1998). Interestingly, MDR1 was found to be present on a chromosome 7q21.1 which has been implicated in IBD susceptibility (Annese et al., 2006). Moreover, patients with IBD such as, active UC and refractory Crohn's disease (CD), showed decreased Pgp expression in the colon and ileum (Blokzijl et al., 2007). Impaired function and reduced Pgp expression have also been observed in experimental mouse models of TCRα (T cell receptor) and IL10 knockout mice (Buyse et al., 2005), (Mizoguchi et al., 2003), as well as DSSinduced colitis (Iizasa et al., 2003). Thus, all these above studies demonstrate that Pgp is downregulated in gut inflammation, however not much is known about its regulation in infectious colitis. Since, Pgp serves an integral role in the maintenance of intestinal homeostasis, it is crucial to elucidate the direct effects of the pathogenic bacteria, Citrobacter rodentium, which is known to be the mouse equivalent of enteropathogenic E. coli (EPEC) in humans, on Pgp expression.
Abbreviations: Pgp, P-glycoprotein; MDR1, Multi-Drug Resistance gene 1; CR, Citrobacter rodentium; IBD, Inflammatory Bowel Disease; UC, Ulcerative Colitis; CD, Crohn’s Disease; TCR, T cell receptor; DSS, Dextran Sulfate Sodium; EPEC, Enteropathogenic E. coli; T3SS, Type 3 Secretory System; IECs, Intestinal Epithelial Cells; MRP2/ABCC2, Multi-Drug Resistance Protein 2; BCRP/ABCG2, Breast Cancer Resistance Protein; TNFα, Tumor Necrosis Factor alpha ⁎ Corresponding author at: University of Illinois at Chicago, Medical Research Service (600/151), Jesse Brown VA Medical Center, 820 South Damen Avenue, Chicago, IL 60612, United States of America. E-mail address: [email protected] (S. Saksena). https://doi.org/10.1016/j.genrep.2019.100549 Received 13 September 2019; Accepted 29 October 2019 Available online 31 October 2019 2452-0144/ Published by Elsevier Inc.
Gene Reports 18 (2020) 100549
M. Patel, et al.
EPEC is a food-borne non-invasive bacterium that attaches to intestinal epithelial cells (IECs) and disrupts gut barrier integrity which prominently causes diarrhea in infants (Ochoa and Contreras, 2011). Although EPEC is nontoxigenic, it is known to infect host cells with virulence factors through injection by employing a type 3 secretory system (T3SS) (Hecht, 2001; Wheatcroft et al., 2005). Similar to EPEC, C. rodentium possesses several similar effector molecules, which further substantiates C. rodentium infection of mice as a valid model to study IBD pathogenesis by pathogens known to cause infection by attaching to IECs (Collins et al., 2014). However, whether intestinal Pgp expression is altered in mice upon C. rodentium infection is not known. As Pgp is critical in maintaining the gut epithelial integrity, we hypothesized that the inhibition of Pgp expression could be one possible cause of C. rodentium induced inflammation/colitis. Therefore, this study was aimed at examining the effects of C. rodentium on intestinal Pgp expression utilizing FVBN mice. It should be noted that along with Pgp, IECs have also shown to apically express MRP2 (multidrug resistance protein 2; ABCC2) & BCRP (breast cancer resistance protein; ABCG2) which are also involved in drug disposition (Andersen et al., 2015). However, studies have shown that these transporters are not implicated in the pathogenesis of intestinal inflammation, as mice harboring deletion of MRP2 and BCRP genes do not show spontaneous colitis (Panwala et al., 1998; Chu et al., 2006; Zaher et al., 2006). Nonetheless, few studies have indeed shown that MRP2 and BCRP mRNA levels were significantly decreased in patients with UC (Englund et al., 2007; Langmann et al., 2004). Likewise, not much is known about their regulation in infectious colitis and thus we sought to investigate the effect of C. rodentium infection on MRP2 and BCRP expression in the intestines of mice. Our results showed that C. rodentium infection decreased Pgp and MRP2 in the colon of mice. However, no change was observed in BCRP mRNA expression. Given these findings, our data suggests that inhibition of Pgp may play an integral role in the pathogenesis of C. rodentium induced intestinal inflammation such as observed in infectious colitis.
Table 1 Mouse primers. P-gp F: GTGGGGGACAGAAACAGAGA P-gp R: GAACGGTAGACAAGCGATGAG MRP2 F: GTG TGG ATT CCC TTG GGC TTT MRP2 R: CAC AAC GAA CAC CTG CTT GG BCRP F: AAA TGC TGT TCA GGT TAT GTG GT BCRP R: TTC CGA CCT TAG AAT CTG CTA CT GAPDH F: TGTGTCCGTCGTGGATCTGA GAPDH R: CCTGCTTCACCACCTCTTGAT
MRP2 and BCRP mRNA were normalized to GAPDH. The sequence of the mouse primers specific for Pgp, MRP2, BCRP and GAPDH, are included in Table 1. 2.3. Immunofluorescence staining Control and C. rodentium treated mice samples of the proximal colon were frozen and cut into small sections (~5 μm). Then, at room temperature they were placed in 4% paraformaldehyde in PBS for a duration of 10 min. Prior to incubation, fixed sections were washed in PBS, 0.3% Nonidet P-40 for 5 min was used for permeabilization, followed by 5% normal goat serum (NGS) for 2 h for blocking of the sections. Tissues were then incubated at room temperature with the primary antibodies, P-gp (Santacruz) and villin (Abcam) (1:100) in PBS composed of 1% NGS for a duration of 2 h. After the primary washings, sections were incubated for a duration of 1 h with the secondary antibodies, Alexa Fluor 594 and 647 conjugated goat anti-rabbit IgGs (1:100, Invitrogen) in 1% NGS. After the secondary washes of the sections, slow-fade diamond antifade with DAPI reagent (Invitrogen) was used to position the sections under coverslips. Analysis of the sections was performed using an Olympus BX fluorescent microscope equipped with 20× objective for imaging. 2.4. Statistical analysis
2. Materials & methods
Results are expressed as means ± SEM, in which a student's t-test was used. p < 0.05 or less was considered statistically significant.
2.1. C. rodentium infection in mice and tissue collection 4-6 weeks old male FVB/N mice were procured from Jackson laboratories (Bar Harbor, Maine). Mice were orally administered drinking water and standard rodent pellets. These studies were approved by the Animal Care Committee of the University of Illinois at Chicago and Jesse Brown Veteran Affairs Medical Center. Prior to C. rodentium infection, mice were treated with antibiotics (streptomycin, 5 g/l) in drinking water for 24 h followed by providing only drinking water for 24 h. Mice were then administered a single dose by oral gavage of 200 μl 1× PBS (control/vehicle group) or 200 μl of C. rodentium bacteria culture (~1 × 109 CFU bacteria/mouse) resuspended in 1× PBS (C. rodentium group). On the 9th day after C. rodentium infection, mice were euthanized. Ileum and colon were surgically removed and their mucosa was isolated for RNA extraction. Ileal and colonic regions (~2 cm) were promptly snap-frozen in optimal cutting temperature (OCT) embedding medium (Tissue-Tek OCT compound, Sakura) in order to perform immunofluorescence studies.
3. Results 3.1. C. rodentium infection decreases colonic Pgp expression in mice 3.1.1. Pgp mRNA expression Several studies have shown that Pgp expression is decreased in inflammatory colitis (Cario, 2017; Ho et al., 2003; Andersen et al., 2015). However, whether Pgp is also modulated in infectious colitis is not known. We examined the effect of the murine pathogen, C. rodentium (mouse counterpart of enteropathogenic E. coli (EPEC)) on intestinal Pgp expression. Our data showed that C. rodentium infection in mice significantly decreased proximal and distal colonic Pgp mRNA levels (Fig. 1A and B). However, Pgp mRNA levels remained unchanged in the ileum (Fig. 1C). 3.1.2. Pgp protein expression In parallel to decreased Pgp mRNA expression in response to C. rodentium infection (9 days), our immunofluorescence studies also exhibited a significant decrease in Pgp immunostaining. As shown in Fig. 2, Pgp expression appeared mostly on the apical membranes (green) co-localized with the marker villin (red) in mouse colon. However, Pgp expression was significantly reduced in response to C. rodentium infection on the apical membrane. These findings suggest that decreased Pgp expression results in the dysregulation of intestinal homeostasis that could play a key role in colonic inflammation caused by C. rodentium in mice.
2.2. RNA extraction and Real Time PCR RNA extraction was performed in control and C. rodentium treated mice. Ileal and colonic mucosal samples were used utilizing RNeasy mini kit (Qiagen) as previously described (Saksena et al., 2011). The Mx3000p machine (Agilent) was used in tandem with real time PCR reagents such as SYBR Green one-step real-time master mix, in order to determine cDNA formation and PCR amplification. Pgp, MRP2, BCRP and GAPDH (internal control) amplification was investigated using gene-specific primers (Saksena et al., 2011). Relative levels of Pgp, 2
Gene Reports 18 (2020) 100549
M. Patel, et al.
Fig. 1. C. rodentium decreases Pgp mRNA expression: The relative mRNA expression of Pgp in the samples extracted from the proximal colon (A) distal colon (B) and ileum (C). Real-time PCR was utilized with gene-specific primers in order to calculate mRNA expression, with GAPDH serving as an internal control. Values are represented in arbitrary units as means ± SEM of 4–5 separate mice. *p < 0.05 vs. control, **p < 0.001 vs. control.
harmful to its epithelial integrity. These foreign compounds can potentially lead to imbalances in the microbiota composition of the intestine, alter the host cell's immune responses, dysregulate and impair regeneration of gut barrier tissue, all of which can ultimately contribute to mucosal inflammation as seen in IBD (Podolsky, 1999; Schmitz et al., 1999). In order to prevent the effects of these environmental toxins, including xenobiotics, and preserve intestinal homeostasis, the GI barrier utilizes various mechanisms and tools, such as efflux transporters. In this regard, ABC transporters, P-glycoprotein (Pgp/MDR1/ABCB1), MRP2 (multidrug resistance protein 2/ABCC2) and BCRP (breast cancer resistance protein/ABCG2) located on the apical membrane, play an integral role of maintaining mucosal homeostasis and protecting IECs from the effects of xenobiotics and toxins (Andersen et al., 2015). Although a plethora of studies have been thoroughly conducted regarding Pgp in the gastrointestinal system (Cario, 2017; Ho et al., 2003), few studies have been done on ABCC2 and ABCG2 (Haimeur et al., 2004). There is substantial evidence that altered Pgp expression and function is associated with chronic intestinal inflammation as observed in IBD (Panwala et al., 1998; Annese et al., 2006; Blokzijl et al., 2007; Iizasa et al., 2003).
3.1.3. C. rodentium decreases colonic MRP2 but not BCRP mRNA expression MRP2 and BCRP are efflux transporters that are typically co-expressed apically with Pgp on the intestinal epithelial cells and also share similar function (Andersen et al., 2015). To deduce whether the effects of C. rodentium are specific to Pgp, we next measured the mRNA expression of MRP2 and BCRP in the colon. MRP2 mRNA expression was significantly decreased in the colon of mice infected with C. rodentium compared to control mice (Fig. 3A). However, no significant change was observed in BCRP mRNA expression in response to C. rodentium infection (Fig. 3B). These findings suggest that the decrease in MRP2 mRNA expression along with Pgp by C. rodentium could result in impaired efflux function that might further exacerbate the extent of colonic damage/inflammation in mice due to accumulation of xenobiotics and bacterial toxins. 4. Discussion The gastrointestinal (GI) barrier epithelium persistently encounters several noxious, environmental toxins, such as xenobiotics, that can be
Fig. 2. C. rodentium decreases Pgp immunostaining: Immunostaining of Pgp (green) and villin (red) from frozen proximal colonic mucosal sections and representative images from 3 separate mice from each group. 3
Gene Reports 18 (2020) 100549
M. Patel, et al.
Fig. 3. C. rodentium decreases MRP2 but not BCRP mRNA expression in the colon: The relative mRNA expression of MRP2 (A) and BCRP (B) was measured in control and C. rodentium treated mice in the colon, using GAPDH as an internal control. Real-time PCR using gene-specific primers was utilized to calculate the mRNA expression. Values are represented in arbitrary units as means ± SEM of 4–5 separate mice. **p < 0.001 vs. control.
protein expression in the colon but remained unchanged in the ileum. One explanation could be the fact that C. rodentium infection in mice mainly affects the colon as compared to the ileum. In addition, MRP2 mRNA levels were also decreased in the colon of C. rodentium infected mice. However, BCRP mRNA levels were not affected upon C. rodentium infection in mice. Earlier studies have demonstrated that in certain cases of active inflammation, BCRP mRNA levels remained unchanged, but protein levels were significantly decreased suggesting the involvement of a post-transcriptional process (Deuring et al., 2012). Further studies are needed to examine whether C. rodentium affects BCRP protein levels via a post-transcriptional mechanism rather than a transcriptional process. It is well known that enteric bacteria are able to modulate Pgp expression in intestinal epithelial cells, for example, Salmonella infection has been shown to decrease Pgp expression in a dose dependent manner indicating that modulating Pgp expression is one of the mechanisms by which enteric pathogens modulate the host defense mechanisms (Yang et al., 2018). In addition, studies from our lab have shown that the probiotic bacteria Lactobacillus acidophilus, increased Pgp expression and activity via transcriptional mechanisms (Saksena et al., 2011). These studies indicate that microbes orchestrate host defense mechanisms in response to infection and intestinal inflammation. In conclusion, taking our findings into account, we speculate that loss of efflux function of Pgp and MRP2 caused by C. rodentium infection can result in the accumulation of harmful xenobiotics and toxins in the intestinal epithelial cells that may further contribute to disturbances in gut homeostasis. This may lead to the development of persistent inflammation as observed in infectious colitis. Further, C. rodentium may serve as a preliminary model in understanding the regulation of Pgp, a compelling, novel therapeutic target for intervention to treat gastrointestinal disorders in the future.
In patients with IBD (Blokzijl et al., 2007; Englund et al., 2007; Gutmann et al., 2008) and experimental mouse models of colitis (Iizasa et al., 2003; Buyse et al., 2005; Mizoguchi et al., 2003), downregulation of Pgp expression has been linked with acute intestinal inflammation. Moreover, Pgp/mdr1a KO mice housed in normal environmental conditions, develop spontaneous colitis, which is initiated by the bacterial flora that resembles IBD in humans (Panwala et al., 1998; Nones et al., 2009). Also, studies on genetic polymorphisms of Pgp/MDR1 in humans have implicated its association with the pathogenesis of IBD (Cario, 2017). Low levels of MRP2 and BCRP mRNA were found in the colon of active ulcerative colitis patients when compared with colons from the control groups (Englund et al., 2007; Langmann et al., 2004). Studies have shown that the pro-inflammatory cytokines also play a role in negatively regulating Pgp mRNA expression in the inflamed tissue. For example, increased tumor necrosis factor alpha (TNFα) levels inhibited Pgp gene transcription in IECs in active IBD, thereby resulting in the loss of Pgp function to efflux out xenobiotics and toxins (Belliard et al., 2004). Other prominent IBD cytokines, like IL-1β or IL6 (Fernandez et al., 2004), have also been shown to alter Pgp expression and function. Interestingly, rifaximin, a potentially beneficial antibiotic that has been shown to induce remission in Crohn's disease (CD) (Sartor, 2016), was found to attenuate TNFα-induced inhibition of Pgp via the nuclear receptor PXR (Mencarelli et al., 2010). Although, MRP2 and BCRP mRNA levels were shown to be decreased in intestinal inflammation, they do not seem to be important in the pathogenesis of intestinal inflammation. In contrast to the Pgp KO mouse model, MRP2 KO and BCRP KO mice were found to display no signs of intestinal inflammation under standard housing conditions (Jonker et al., 2002; Kruh et al., 2007). The above-mentioned studies emphasize on the fact that Pgp, MRP2 and BCRP are down-regulated in inflammatory conditions, however not much is known about their modulation in infectious colitis. Therefore, it was considered of interest to examine the direct effect of the murine pathogen, C. rodentium infection on Pgp, MRP2 and BCRP expression in the mice intestine. Binding of C. rodentium to intestinal epithelial cells occurs by a specific attachment mechanism, which is followed by some aberrations at the brush border membrane linked with pedestal formation by an effacement mechanism to cause an intestinal lesion (Knutton et al., 1989). A type III secretion system provides the essential proteins needed for this lesion, and these proteins are known to play an important role in host cell cytoskeleton structural rearrangements and signal transduction (Elliott et al., 1998; Schauer and Falkow, 1993). These lesions that are created at the surface of IECs are almost identical to those caused by enteropathogenic Escherichia coli (EPEC) infection, which is a leading cause of persistent diarrhea in infants living in developing countries (Levine, 1987). C. rodentium infection is associated with intestinal crypt hyperplasia and dilation, proliferating IECs with thickened mucosal linings, and an altered surface of the apical membrane of enterocytes. C. rodentium infection in mouse models make it a credible and reliable model to study the pathophysiology of human intestinal disorders, including infectious diarrhea, IBD, dysbiosis, and tumorigenesis (Collins et al., 2014). Our current studies demonstrate that C. rodentium infection significantly decreased Pgp mRNA and
Acknowledgments These studies were supported by the Department of Veterans Affairs, Veterans Heath Administration, Office of Research and Development, Biomedical Laboratory Research and Development: BX002867 (SS). These studies were partially supported by BX002011 (PKD), BX000152 (WAA), VA Senior Research Career Scientist Award (PKD), and Research Career Scientist Award (WAA) and NIDDK grants, R01 DK 98170 (RG), R01 DK 54016 (PKD), DK 81858 (PKD) & DK92441 (PKD). Declaration of competing interest No conflicts of interest, financial or otherwise, are declared by the author(s). References Andersen, V., Svenningsen, K., Knudsen, L.A., Hansen, A.K., Holmskov, U., Stensballe, A., et al., 2015. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology. World J. Gastroenterol. 21 (41), 11862–11876. Annese, V., Valvano, M.R., Palmieri, O., Latiano, A., Bossa, F., Andriulli, A., 2006.
4
Gene Reports 18 (2020) 100549
M. Patel, et al.
1290–1298. Kruh, G.D., Belinsky, M.G., Gallo, J.M., Lee, K., 2007. Physiological and pharmacological functions of Mrp2, Mrp3 and Mrp4 as determined from recent studies on gene-disrupted mice. Cancer Metastasis Rev. 26 (1), 5–14. Langmann, T., Moehle, C., Mauerer, R., Scharl, M., Liebisch, G., Zahn, A., et al., 2004. Loss of detoxification in inflammatory bowel disease: dysregulation of pregnane X receptor target genes. Gastroenterology 127 (1), 26–40. Levine, M.M., 1987. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155 (3), 377–389. Mencarelli, A., Migliorati, M., Barbanti, M., Cipriani, S., Palladino, G., Distrutti, E., et al., 2010. Pregnane-X-receptor mediates the anti-inflammatory activities of rifaximin on detoxification pathways in intestinal epithelial cells. Biochem. Pharmacol. 80 (11), 1700–1707. Mizoguchi, E., Xavier, R.J., Reinecker, H.C., Uchino, H., Bhan, A.K., Podolsky, D.K., et al., 2003. Colonic epithelial functional phenotype varies with type and phase of experimental colitis. Gastroenterology 125 (1), 148–161. Nones, K., Knoch, B., Dommels, Y.E., Paturi, G., Butts, C., McNabb, W.C., et al., 2009. Multidrug resistance gene deficient (mdr1a−/−) mice have an altered caecal microbiota that precedes the onset of intestinal inflammation. J. Appl. Microbiol. 107 (2), 557–566. Ochoa, T.J., Contreras, C.A., 2011. Enteropathogenic escherichia coli infection in children. Curr. Opin. Infect. Dis. 24 (5), 478–483. Panwala, C.M., Jones, J.C., Viney, J.L., 1998. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdr1a, spontaneously develop colitis. J. Immunol. 161 (10), 5733–5744. Podolsky, D.K., 1999. Mucosal immunity and inflammation. V. Innate mechanisms of mucosal defense and repair: the best offense is a good defense. Am. J. Phys. 277 (3), G495–G499. Saksena, S., Goyal, S., Raheja, G., Singh, V., Akhtar, M., Nazir, T.M., et al., 2011. Upregulation of P-glycoprotein by probiotics in intestinal epithelial cells and in the dextran sulfate sodium model of colitis in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 300 (6), G1115–G1123. Sartor, R.B., 2016. Review article: the potential mechanisms of action of rifaximin in the management of inflammatory bowel diseases. Aliment. Pharmacol. Ther. 43 (Suppl. 1), 27–36. Schauer, D.B., Falkow, S., 1993. Attaching and effacing locus of a Citrobacter freundii biotype that causes transmissible murine colonic hyperplasia. Infect. Immun. 61 (6), 2486–2492. Schinkel, A.H., 1997. The physiological function of drug-transporting P-glycoproteins. Semin. Cancer Biol. 8 (3), 161–170. Schmitz, H., Barmeyer, C., Fromm, M., Runkel, N., Foss, H.D., Bentzel, C.J., et al., 1999. Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 116 (2), 301–309. Wheatcroft, J., Wakelin, D., Smith, A., Mahoney, C.R., Mawe, G., Spiller, R., 2005. Enterochromaffin cell hyperplasia and decreased serotonin transporter in a mouse model of postinfectious bowel dysfunction. Neurogastroenterol. Motil. 17 (6), 863–870. Yang, C.J., Chang, W.W., Lin, S.T., Chen, M.C., Lee, C.H., 2018. Salmonella overcomes drug resistance in tumor through p-glycoprotein downregulation. Int. J. Med. Sci. 15 (6), 574. Zaher, H., Khan, A.A., Palandra, J., Brayman, T.G., Yu, L., Ware, J.A., 2006. Breast cancer resistance protein (Bcrp/abcg2) is a major determinant of sulfasalazine absorption and elimination in the mouse. Mol. Pharm. 3 (1), 55–61.
Multidrug resistance 1 gene in inflammatory bowel disease: a meta-analysis. World J. Gastroenterol. 12 (23), 3636–3644. Belliard, A.M., Lacour, B., Farinotti, R., Leroy, C., 2004. Effect of tumor necrosis factoralpha and interferon-gamma on intestinal P-glycoprotein expression, activity, and localization in Caco-2 cells. J. Pharm. Sci. 93 (6), 1524–1536. Blokzijl, H., Vander Borght, S., Bok, L.I., Libbrecht, L., Geuken, M., van den Heuvel, F.A., et al., 2007. Decreased P-glycoprotein (P-gp/MDR1) expression in inflamed human intestinal epithelium is independent of PXR protein levels. Inflamm. Bowel Dis. 13 (6), 710–720. Buyse, M., Radeva, G., Bado, A., Farinotti, R., 2005. Intestinal inflammation induces adaptation of P-glycoprotein expression and activity. Biochem. Pharmacol. 69 (12), 1745–1754. Cario, E., 2017. P-glycoprotein multidrug transporter in inflammatory bowel diseases: more questions than answers. World J. Gastroenterol. 23 (9), 1513–1520. Chu, X.Y., Strauss, J.R., Mariano, M.A., Li, J., Newton, D.J., Cai, X., et al., 2006. Characterization of mice lacking the multidrug resistance protein MRP2 (ABCC2). J. Pharmacol. Exp. Ther. 317 (2), 579–589. Collins, J.W., Keeney, K.M., Crepin, V.F., Rathinam, V.A., Fitzgerald, K.A., Finlay, B.B., et al., 2014. Citrobacter rodentium: infection, inflammation and the microbiota. Nat. Rev. Microbiol. 12 (9), 612–623. Deuring, J.J., de Haar, C., Koelewijn, C.L., Kuipers, E.J., Peppelenbosch, M.P., van der Woude, C.J., 2012. Absence of ABCG2-mediated mucosal detoxification in patients with active inflammatory bowel disease is due to impeded protein folding. Biochem. J. 441 (1), 87–93. Elliott, S.J., Wainwright, L.A., McDaniel, T.K., Jarvis, K.G., Deng, Y.K., Lai, L.C., et al., 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28 (1), 1–4. Englund, G., Jacobson, A., Rorsman, F., Artursson, P., Kindmark, A., Ronnblom, A., 2007. Efflux transporters in ulcerative colitis: decreased expression of BCRP (ABCG2) and Pgp (ABCB1). Inflamm. Bowel Dis. 13 (3), 291–297. Fernandez, C., Buyse, M., German-Fattal, M., Gimenez, F., 2004. Influence of the proinflammatory cytokines on P-glycoprotein expression and functionality. J. Pharm. Pharm. Sci. 7 (3), 359–371. Gutmann, H., Hruz, P., Zimmermann, C., Straumann, A., Terracciano, L., Hammann, F., et al., 2008. Breast cancer resistance protein and P-glycoprotein expression in patients with newly diagnosed and therapy-refractory ulcerative colitis compared with healthy controls. Digestion 78 (2–3), 154–162. Haimeur, A., Conseil, G., Deeley, R.G., Cole, S.P., 2004. The MRP-related and BCRP/ ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation. Curr. Drug Metab. 5 (1), 21–53. Hecht, G., 2001. Microbes and microbial toxins: paradigms for microbial-mucosal interactions. VII. Enteropathogenic Escherichia coli: physiological alterations from an extracellular position. Am. J. Physiol. Gastrointest. Liver Physiol. 281 (1), G1–G7. Ho, G.T., Moodie, F.M., Satsangi, J., 2003. Multidrug resistance 1 gene (P-glycoprotein 170): an important determinant in gastrointestinal disease? Gut 52 (5), 759–766. Iizasa, H., Genda, N., Kitano, T., Tomita, M., Nishihara, K., Hayashi, M., et al., 2003. Altered expression and function of P-glycoprotein in dextran sodium sulfate-induced colitis in mice. J. Pharm. Sci. 92 (3), 569–576. Jonker, J.W., Buitelaar, M., Wagenaar, E., Van Der Valk, M.A., Scheffer, G.L., Scheper, R.J., et al., 2002. The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria. Proc. Natl. Acad. Sci. U. S. A. 99 (24), 15649–15654. Knutton, S., Baldwin, T., Williams, P.H., McNeish, A.S., 1989. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 57 (4),
5
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
Citrobacter rodentium infection inhibits colonic P-glycoprotein expression b
a,b
b
T
b
Mitul Patel , Anoop Kumar , Dulari Jayawardena , Shubha Priyamvada , Arivarasu N. Anbazhaganb, Waddah A. Alrefaia,b, Ravinder K. Gillb, Pradeep K. Dudejaa,b, ⁎ Seema Saksenaa,b, a b
Jesse Brown VA Medical Center, United States of America Division of Gastroenterology and Hepatology, Department of Medicine, University of Illinois at Chicago, Chicago, IL, United States of America
A R T I C LE I N FO
A B S T R A C T
Keywords: C. rodentium Pgp P-glycoprotein Infectious colitis MDR1 Inflammatory bowel disease IBD
P-glycoprotein (Pgp/MDR1) serves as a biological barrier that protects intestinal epithelial cells (IECs) by transporting out xenobiotics and bacterial toxins. Decreased Pgp function and expression has been seen in mouse models of inflammatory colitis and also in patients with IBD. Pgp knockout mice spontaneously develop severe colitis, which is also seen in human patients with ulcerative colitis. However, whether Pgp is also altered in infectious colitis is not known. Citrobacter rodentium (CR), a murine pathogen has been shown to cause colonic hyperplasia and colitis in mice by attaching to IECs. The current study investigated the direct effects of Citrobacter rodentium infection on intestinal Pgp expression in mice. Mice were challenged with a single dose of C. rodentium (1 × 109 CFU) by oral gavage for 9 days and Pgp expression in the ileum and colon was measured by real time qRT-PCR and immunofluorescence studies. Our results showed that C. rodentium infection significantly decreased Pgp mRNA and protein expression in the colon, although no significant change was observed in the ileum of mice. These findings suggest that inhibition of the efflux protein, Pgp by C. rodentium can cause perturbations in the intestinal epithelial integrity, which could further lead to the pathogenesis of intestinal inflammation as observed in infectious colitis.
1. Introduction The body's primary means of defense against toxins and drugs ingested orally is the gastrointestinal tract. Perturbation of the intestinal epithelial integrity in the gastrointestinal tract contributes to mucosal inflammation as observed in inflammatory bowel diseases (IBD) (Podolsky, 1999; Schmitz et al., 1999). In this regard, P-glycoprotein (Pgp/ABCB1) has been shown to play a crucial role in the maintenance of intestinal homeostasis by transporting various drugs/xenobiotics and bacterial toxins out of the mucosa into the gut lumen (Schinkel, 1997). Pgp is a transmembrane protein, known to be highly phosphorylated and glycosylated (Cario, 2017; Ho et al., 2003), and is abundantly expressed apically on intestinal epithelial cells (IECs) localized in the small intestine and colon (Schinkel, 1997). The role of Pgp in contributing to the pathophysiology of intestinal inflammation was evident from studies in Pgp knockout mice. Similar to patients with ulcerative
colitis, Pgp KO mice have also been observed to exhibit spontaneous colitis (Panwala et al., 1998). Interestingly, MDR1 was found to be present on a chromosome 7q21.1 which has been implicated in IBD susceptibility (Annese et al., 2006). Moreover, patients with IBD such as, active UC and refractory Crohn's disease (CD), showed decreased Pgp expression in the colon and ileum (Blokzijl et al., 2007). Impaired function and reduced Pgp expression have also been observed in experimental mouse models of TCRα (T cell receptor) and IL10 knockout mice (Buyse et al., 2005), (Mizoguchi et al., 2003), as well as DSSinduced colitis (Iizasa et al., 2003). Thus, all these above studies demonstrate that Pgp is downregulated in gut inflammation, however not much is known about its regulation in infectious colitis. Since, Pgp serves an integral role in the maintenance of intestinal homeostasis, it is crucial to elucidate the direct effects of the pathogenic bacteria, Citrobacter rodentium, which is known to be the mouse equivalent of enteropathogenic E. coli (EPEC) in humans, on Pgp expression.
Abbreviations: Pgp, P-glycoprotein; MDR1, Multi-Drug Resistance gene 1; CR, Citrobacter rodentium; IBD, Inflammatory Bowel Disease; UC, Ulcerative Colitis; CD, Crohn’s Disease; TCR, T cell receptor; DSS, Dextran Sulfate Sodium; EPEC, Enteropathogenic E. coli; T3SS, Type 3 Secretory System; IECs, Intestinal Epithelial Cells; MRP2/ABCC2, Multi-Drug Resistance Protein 2; BCRP/ABCG2, Breast Cancer Resistance Protein; TNFα, Tumor Necrosis Factor alpha ⁎ Corresponding author at: University of Illinois at Chicago, Medical Research Service (600/151), Jesse Brown VA Medical Center, 820 South Damen Avenue, Chicago, IL 60612, United States of America. E-mail address: [email protected] (S. Saksena). https://doi.org/10.1016/j.genrep.2019.100549 Received 13 September 2019; Accepted 29 October 2019 Available online 31 October 2019 2452-0144/ Published by Elsevier Inc.
Gene Reports 18 (2020) 100549
M. Patel, et al.
EPEC is a food-borne non-invasive bacterium that attaches to intestinal epithelial cells (IECs) and disrupts gut barrier integrity which prominently causes diarrhea in infants (Ochoa and Contreras, 2011). Although EPEC is nontoxigenic, it is known to infect host cells with virulence factors through injection by employing a type 3 secretory system (T3SS) (Hecht, 2001; Wheatcroft et al., 2005). Similar to EPEC, C. rodentium possesses several similar effector molecules, which further substantiates C. rodentium infection of mice as a valid model to study IBD pathogenesis by pathogens known to cause infection by attaching to IECs (Collins et al., 2014). However, whether intestinal Pgp expression is altered in mice upon C. rodentium infection is not known. As Pgp is critical in maintaining the gut epithelial integrity, we hypothesized that the inhibition of Pgp expression could be one possible cause of C. rodentium induced inflammation/colitis. Therefore, this study was aimed at examining the effects of C. rodentium on intestinal Pgp expression utilizing FVBN mice. It should be noted that along with Pgp, IECs have also shown to apically express MRP2 (multidrug resistance protein 2; ABCC2) & BCRP (breast cancer resistance protein; ABCG2) which are also involved in drug disposition (Andersen et al., 2015). However, studies have shown that these transporters are not implicated in the pathogenesis of intestinal inflammation, as mice harboring deletion of MRP2 and BCRP genes do not show spontaneous colitis (Panwala et al., 1998; Chu et al., 2006; Zaher et al., 2006). Nonetheless, few studies have indeed shown that MRP2 and BCRP mRNA levels were significantly decreased in patients with UC (Englund et al., 2007; Langmann et al., 2004). Likewise, not much is known about their regulation in infectious colitis and thus we sought to investigate the effect of C. rodentium infection on MRP2 and BCRP expression in the intestines of mice. Our results showed that C. rodentium infection decreased Pgp and MRP2 in the colon of mice. However, no change was observed in BCRP mRNA expression. Given these findings, our data suggests that inhibition of Pgp may play an integral role in the pathogenesis of C. rodentium induced intestinal inflammation such as observed in infectious colitis.
Table 1 Mouse primers. P-gp F: GTGGGGGACAGAAACAGAGA P-gp R: GAACGGTAGACAAGCGATGAG MRP2 F: GTG TGG ATT CCC TTG GGC TTT MRP2 R: CAC AAC GAA CAC CTG CTT GG BCRP F: AAA TGC TGT TCA GGT TAT GTG GT BCRP R: TTC CGA CCT TAG AAT CTG CTA CT GAPDH F: TGTGTCCGTCGTGGATCTGA GAPDH R: CCTGCTTCACCACCTCTTGAT
MRP2 and BCRP mRNA were normalized to GAPDH. The sequence of the mouse primers specific for Pgp, MRP2, BCRP and GAPDH, are included in Table 1. 2.3. Immunofluorescence staining Control and C. rodentium treated mice samples of the proximal colon were frozen and cut into small sections (~5 μm). Then, at room temperature they were placed in 4% paraformaldehyde in PBS for a duration of 10 min. Prior to incubation, fixed sections were washed in PBS, 0.3% Nonidet P-40 for 5 min was used for permeabilization, followed by 5% normal goat serum (NGS) for 2 h for blocking of the sections. Tissues were then incubated at room temperature with the primary antibodies, P-gp (Santacruz) and villin (Abcam) (1:100) in PBS composed of 1% NGS for a duration of 2 h. After the primary washings, sections were incubated for a duration of 1 h with the secondary antibodies, Alexa Fluor 594 and 647 conjugated goat anti-rabbit IgGs (1:100, Invitrogen) in 1% NGS. After the secondary washes of the sections, slow-fade diamond antifade with DAPI reagent (Invitrogen) was used to position the sections under coverslips. Analysis of the sections was performed using an Olympus BX fluorescent microscope equipped with 20× objective for imaging. 2.4. Statistical analysis
2. Materials & methods
Results are expressed as means ± SEM, in which a student's t-test was used. p < 0.05 or less was considered statistically significant.
2.1. C. rodentium infection in mice and tissue collection 4-6 weeks old male FVB/N mice were procured from Jackson laboratories (Bar Harbor, Maine). Mice were orally administered drinking water and standard rodent pellets. These studies were approved by the Animal Care Committee of the University of Illinois at Chicago and Jesse Brown Veteran Affairs Medical Center. Prior to C. rodentium infection, mice were treated with antibiotics (streptomycin, 5 g/l) in drinking water for 24 h followed by providing only drinking water for 24 h. Mice were then administered a single dose by oral gavage of 200 μl 1× PBS (control/vehicle group) or 200 μl of C. rodentium bacteria culture (~1 × 109 CFU bacteria/mouse) resuspended in 1× PBS (C. rodentium group). On the 9th day after C. rodentium infection, mice were euthanized. Ileum and colon were surgically removed and their mucosa was isolated for RNA extraction. Ileal and colonic regions (~2 cm) were promptly snap-frozen in optimal cutting temperature (OCT) embedding medium (Tissue-Tek OCT compound, Sakura) in order to perform immunofluorescence studies.
3. Results 3.1. C. rodentium infection decreases colonic Pgp expression in mice 3.1.1. Pgp mRNA expression Several studies have shown that Pgp expression is decreased in inflammatory colitis (Cario, 2017; Ho et al., 2003; Andersen et al., 2015). However, whether Pgp is also modulated in infectious colitis is not known. We examined the effect of the murine pathogen, C. rodentium (mouse counterpart of enteropathogenic E. coli (EPEC)) on intestinal Pgp expression. Our data showed that C. rodentium infection in mice significantly decreased proximal and distal colonic Pgp mRNA levels (Fig. 1A and B). However, Pgp mRNA levels remained unchanged in the ileum (Fig. 1C). 3.1.2. Pgp protein expression In parallel to decreased Pgp mRNA expression in response to C. rodentium infection (9 days), our immunofluorescence studies also exhibited a significant decrease in Pgp immunostaining. As shown in Fig. 2, Pgp expression appeared mostly on the apical membranes (green) co-localized with the marker villin (red) in mouse colon. However, Pgp expression was significantly reduced in response to C. rodentium infection on the apical membrane. These findings suggest that decreased Pgp expression results in the dysregulation of intestinal homeostasis that could play a key role in colonic inflammation caused by C. rodentium in mice.
2.2. RNA extraction and Real Time PCR RNA extraction was performed in control and C. rodentium treated mice. Ileal and colonic mucosal samples were used utilizing RNeasy mini kit (Qiagen) as previously described (Saksena et al., 2011). The Mx3000p machine (Agilent) was used in tandem with real time PCR reagents such as SYBR Green one-step real-time master mix, in order to determine cDNA formation and PCR amplification. Pgp, MRP2, BCRP and GAPDH (internal control) amplification was investigated using gene-specific primers (Saksena et al., 2011). Relative levels of Pgp, 2
Gene Reports 18 (2020) 100549
M. Patel, et al.
Fig. 1. C. rodentium decreases Pgp mRNA expression: The relative mRNA expression of Pgp in the samples extracted from the proximal colon (A) distal colon (B) and ileum (C). Real-time PCR was utilized with gene-specific primers in order to calculate mRNA expression, with GAPDH serving as an internal control. Values are represented in arbitrary units as means ± SEM of 4–5 separate mice. *p < 0.05 vs. control, **p < 0.001 vs. control.
harmful to its epithelial integrity. These foreign compounds can potentially lead to imbalances in the microbiota composition of the intestine, alter the host cell's immune responses, dysregulate and impair regeneration of gut barrier tissue, all of which can ultimately contribute to mucosal inflammation as seen in IBD (Podolsky, 1999; Schmitz et al., 1999). In order to prevent the effects of these environmental toxins, including xenobiotics, and preserve intestinal homeostasis, the GI barrier utilizes various mechanisms and tools, such as efflux transporters. In this regard, ABC transporters, P-glycoprotein (Pgp/MDR1/ABCB1), MRP2 (multidrug resistance protein 2/ABCC2) and BCRP (breast cancer resistance protein/ABCG2) located on the apical membrane, play an integral role of maintaining mucosal homeostasis and protecting IECs from the effects of xenobiotics and toxins (Andersen et al., 2015). Although a plethora of studies have been thoroughly conducted regarding Pgp in the gastrointestinal system (Cario, 2017; Ho et al., 2003), few studies have been done on ABCC2 and ABCG2 (Haimeur et al., 2004). There is substantial evidence that altered Pgp expression and function is associated with chronic intestinal inflammation as observed in IBD (Panwala et al., 1998; Annese et al., 2006; Blokzijl et al., 2007; Iizasa et al., 2003).
3.1.3. C. rodentium decreases colonic MRP2 but not BCRP mRNA expression MRP2 and BCRP are efflux transporters that are typically co-expressed apically with Pgp on the intestinal epithelial cells and also share similar function (Andersen et al., 2015). To deduce whether the effects of C. rodentium are specific to Pgp, we next measured the mRNA expression of MRP2 and BCRP in the colon. MRP2 mRNA expression was significantly decreased in the colon of mice infected with C. rodentium compared to control mice (Fig. 3A). However, no significant change was observed in BCRP mRNA expression in response to C. rodentium infection (Fig. 3B). These findings suggest that the decrease in MRP2 mRNA expression along with Pgp by C. rodentium could result in impaired efflux function that might further exacerbate the extent of colonic damage/inflammation in mice due to accumulation of xenobiotics and bacterial toxins. 4. Discussion The gastrointestinal (GI) barrier epithelium persistently encounters several noxious, environmental toxins, such as xenobiotics, that can be
Fig. 2. C. rodentium decreases Pgp immunostaining: Immunostaining of Pgp (green) and villin (red) from frozen proximal colonic mucosal sections and representative images from 3 separate mice from each group. 3
Gene Reports 18 (2020) 100549
M. Patel, et al.
Fig. 3. C. rodentium decreases MRP2 but not BCRP mRNA expression in the colon: The relative mRNA expression of MRP2 (A) and BCRP (B) was measured in control and C. rodentium treated mice in the colon, using GAPDH as an internal control. Real-time PCR using gene-specific primers was utilized to calculate the mRNA expression. Values are represented in arbitrary units as means ± SEM of 4–5 separate mice. **p < 0.001 vs. control.
protein expression in the colon but remained unchanged in the ileum. One explanation could be the fact that C. rodentium infection in mice mainly affects the colon as compared to the ileum. In addition, MRP2 mRNA levels were also decreased in the colon of C. rodentium infected mice. However, BCRP mRNA levels were not affected upon C. rodentium infection in mice. Earlier studies have demonstrated that in certain cases of active inflammation, BCRP mRNA levels remained unchanged, but protein levels were significantly decreased suggesting the involvement of a post-transcriptional process (Deuring et al., 2012). Further studies are needed to examine whether C. rodentium affects BCRP protein levels via a post-transcriptional mechanism rather than a transcriptional process. It is well known that enteric bacteria are able to modulate Pgp expression in intestinal epithelial cells, for example, Salmonella infection has been shown to decrease Pgp expression in a dose dependent manner indicating that modulating Pgp expression is one of the mechanisms by which enteric pathogens modulate the host defense mechanisms (Yang et al., 2018). In addition, studies from our lab have shown that the probiotic bacteria Lactobacillus acidophilus, increased Pgp expression and activity via transcriptional mechanisms (Saksena et al., 2011). These studies indicate that microbes orchestrate host defense mechanisms in response to infection and intestinal inflammation. In conclusion, taking our findings into account, we speculate that loss of efflux function of Pgp and MRP2 caused by C. rodentium infection can result in the accumulation of harmful xenobiotics and toxins in the intestinal epithelial cells that may further contribute to disturbances in gut homeostasis. This may lead to the development of persistent inflammation as observed in infectious colitis. Further, C. rodentium may serve as a preliminary model in understanding the regulation of Pgp, a compelling, novel therapeutic target for intervention to treat gastrointestinal disorders in the future.
In patients with IBD (Blokzijl et al., 2007; Englund et al., 2007; Gutmann et al., 2008) and experimental mouse models of colitis (Iizasa et al., 2003; Buyse et al., 2005; Mizoguchi et al., 2003), downregulation of Pgp expression has been linked with acute intestinal inflammation. Moreover, Pgp/mdr1a KO mice housed in normal environmental conditions, develop spontaneous colitis, which is initiated by the bacterial flora that resembles IBD in humans (Panwala et al., 1998; Nones et al., 2009). Also, studies on genetic polymorphisms of Pgp/MDR1 in humans have implicated its association with the pathogenesis of IBD (Cario, 2017). Low levels of MRP2 and BCRP mRNA were found in the colon of active ulcerative colitis patients when compared with colons from the control groups (Englund et al., 2007; Langmann et al., 2004). Studies have shown that the pro-inflammatory cytokines also play a role in negatively regulating Pgp mRNA expression in the inflamed tissue. For example, increased tumor necrosis factor alpha (TNFα) levels inhibited Pgp gene transcription in IECs in active IBD, thereby resulting in the loss of Pgp function to efflux out xenobiotics and toxins (Belliard et al., 2004). Other prominent IBD cytokines, like IL-1β or IL6 (Fernandez et al., 2004), have also been shown to alter Pgp expression and function. Interestingly, rifaximin, a potentially beneficial antibiotic that has been shown to induce remission in Crohn's disease (CD) (Sartor, 2016), was found to attenuate TNFα-induced inhibition of Pgp via the nuclear receptor PXR (Mencarelli et al., 2010). Although, MRP2 and BCRP mRNA levels were shown to be decreased in intestinal inflammation, they do not seem to be important in the pathogenesis of intestinal inflammation. In contrast to the Pgp KO mouse model, MRP2 KO and BCRP KO mice were found to display no signs of intestinal inflammation under standard housing conditions (Jonker et al., 2002; Kruh et al., 2007). The above-mentioned studies emphasize on the fact that Pgp, MRP2 and BCRP are down-regulated in inflammatory conditions, however not much is known about their modulation in infectious colitis. Therefore, it was considered of interest to examine the direct effect of the murine pathogen, C. rodentium infection on Pgp, MRP2 and BCRP expression in the mice intestine. Binding of C. rodentium to intestinal epithelial cells occurs by a specific attachment mechanism, which is followed by some aberrations at the brush border membrane linked with pedestal formation by an effacement mechanism to cause an intestinal lesion (Knutton et al., 1989). A type III secretion system provides the essential proteins needed for this lesion, and these proteins are known to play an important role in host cell cytoskeleton structural rearrangements and signal transduction (Elliott et al., 1998; Schauer and Falkow, 1993). These lesions that are created at the surface of IECs are almost identical to those caused by enteropathogenic Escherichia coli (EPEC) infection, which is a leading cause of persistent diarrhea in infants living in developing countries (Levine, 1987). C. rodentium infection is associated with intestinal crypt hyperplasia and dilation, proliferating IECs with thickened mucosal linings, and an altered surface of the apical membrane of enterocytes. C. rodentium infection in mouse models make it a credible and reliable model to study the pathophysiology of human intestinal disorders, including infectious diarrhea, IBD, dysbiosis, and tumorigenesis (Collins et al., 2014). Our current studies demonstrate that C. rodentium infection significantly decreased Pgp mRNA and
Acknowledgments These studies were supported by the Department of Veterans Affairs, Veterans Heath Administration, Office of Research and Development, Biomedical Laboratory Research and Development: BX002867 (SS). These studies were partially supported by BX002011 (PKD), BX000152 (WAA), VA Senior Research Career Scientist Award (PKD), and Research Career Scientist Award (WAA) and NIDDK grants, R01 DK 98170 (RG), R01 DK 54016 (PKD), DK 81858 (PKD) & DK92441 (PKD). Declaration of competing interest No conflicts of interest, financial or otherwise, are declared by the author(s). References Andersen, V., Svenningsen, K., Knudsen, L.A., Hansen, A.K., Holmskov, U., Stensballe, A., et al., 2015. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology. World J. Gastroenterol. 21 (41), 11862–11876. Annese, V., Valvano, M.R., Palmieri, O., Latiano, A., Bossa, F., Andriulli, A., 2006.
4
Gene Reports 18 (2020) 100549
M. Patel, et al.
1290–1298. Kruh, G.D., Belinsky, M.G., Gallo, J.M., Lee, K., 2007. Physiological and pharmacological functions of Mrp2, Mrp3 and Mrp4 as determined from recent studies on gene-disrupted mice. Cancer Metastasis Rev. 26 (1), 5–14. Langmann, T., Moehle, C., Mauerer, R., Scharl, M., Liebisch, G., Zahn, A., et al., 2004. Loss of detoxification in inflammatory bowel disease: dysregulation of pregnane X receptor target genes. Gastroenterology 127 (1), 26–40. Levine, M.M., 1987. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155 (3), 377–389. Mencarelli, A., Migliorati, M., Barbanti, M., Cipriani, S., Palladino, G., Distrutti, E., et al., 2010. Pregnane-X-receptor mediates the anti-inflammatory activities of rifaximin on detoxification pathways in intestinal epithelial cells. Biochem. Pharmacol. 80 (11), 1700–1707. Mizoguchi, E., Xavier, R.J., Reinecker, H.C., Uchino, H., Bhan, A.K., Podolsky, D.K., et al., 2003. Colonic epithelial functional phenotype varies with type and phase of experimental colitis. Gastroenterology 125 (1), 148–161. Nones, K., Knoch, B., Dommels, Y.E., Paturi, G., Butts, C., McNabb, W.C., et al., 2009. Multidrug resistance gene deficient (mdr1a−/−) mice have an altered caecal microbiota that precedes the onset of intestinal inflammation. J. Appl. Microbiol. 107 (2), 557–566. Ochoa, T.J., Contreras, C.A., 2011. Enteropathogenic escherichia coli infection in children. Curr. Opin. Infect. Dis. 24 (5), 478–483. Panwala, C.M., Jones, J.C., Viney, J.L., 1998. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdr1a, spontaneously develop colitis. J. Immunol. 161 (10), 5733–5744. Podolsky, D.K., 1999. Mucosal immunity and inflammation. V. Innate mechanisms of mucosal defense and repair: the best offense is a good defense. Am. J. Phys. 277 (3), G495–G499. Saksena, S., Goyal, S., Raheja, G., Singh, V., Akhtar, M., Nazir, T.M., et al., 2011. Upregulation of P-glycoprotein by probiotics in intestinal epithelial cells and in the dextran sulfate sodium model of colitis in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 300 (6), G1115–G1123. Sartor, R.B., 2016. Review article: the potential mechanisms of action of rifaximin in the management of inflammatory bowel diseases. Aliment. Pharmacol. Ther. 43 (Suppl. 1), 27–36. Schauer, D.B., Falkow, S., 1993. Attaching and effacing locus of a Citrobacter freundii biotype that causes transmissible murine colonic hyperplasia. Infect. Immun. 61 (6), 2486–2492. Schinkel, A.H., 1997. The physiological function of drug-transporting P-glycoproteins. Semin. Cancer Biol. 8 (3), 161–170. Schmitz, H., Barmeyer, C., Fromm, M., Runkel, N., Foss, H.D., Bentzel, C.J., et al., 1999. Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 116 (2), 301–309. Wheatcroft, J., Wakelin, D., Smith, A., Mahoney, C.R., Mawe, G., Spiller, R., 2005. Enterochromaffin cell hyperplasia and decreased serotonin transporter in a mouse model of postinfectious bowel dysfunction. Neurogastroenterol. Motil. 17 (6), 863–870. Yang, C.J., Chang, W.W., Lin, S.T., Chen, M.C., Lee, C.H., 2018. Salmonella overcomes drug resistance in tumor through p-glycoprotein downregulation. Int. J. Med. Sci. 15 (6), 574. Zaher, H., Khan, A.A., Palandra, J., Brayman, T.G., Yu, L., Ware, J.A., 2006. Breast cancer resistance protein (Bcrp/abcg2) is a major determinant of sulfasalazine absorption and elimination in the mouse. Mol. Pharm. 3 (1), 55–61.
Multidrug resistance 1 gene in inflammatory bowel disease: a meta-analysis. World J. Gastroenterol. 12 (23), 3636–3644. Belliard, A.M., Lacour, B., Farinotti, R., Leroy, C., 2004. Effect of tumor necrosis factoralpha and interferon-gamma on intestinal P-glycoprotein expression, activity, and localization in Caco-2 cells. J. Pharm. Sci. 93 (6), 1524–1536. Blokzijl, H., Vander Borght, S., Bok, L.I., Libbrecht, L., Geuken, M., van den Heuvel, F.A., et al., 2007. Decreased P-glycoprotein (P-gp/MDR1) expression in inflamed human intestinal epithelium is independent of PXR protein levels. Inflamm. Bowel Dis. 13 (6), 710–720. Buyse, M., Radeva, G., Bado, A., Farinotti, R., 2005. Intestinal inflammation induces adaptation of P-glycoprotein expression and activity. Biochem. Pharmacol. 69 (12), 1745–1754. Cario, E., 2017. P-glycoprotein multidrug transporter in inflammatory bowel diseases: more questions than answers. World J. Gastroenterol. 23 (9), 1513–1520. Chu, X.Y., Strauss, J.R., Mariano, M.A., Li, J., Newton, D.J., Cai, X., et al., 2006. Characterization of mice lacking the multidrug resistance protein MRP2 (ABCC2). J. Pharmacol. Exp. Ther. 317 (2), 579–589. Collins, J.W., Keeney, K.M., Crepin, V.F., Rathinam, V.A., Fitzgerald, K.A., Finlay, B.B., et al., 2014. Citrobacter rodentium: infection, inflammation and the microbiota. Nat. Rev. Microbiol. 12 (9), 612–623. Deuring, J.J., de Haar, C., Koelewijn, C.L., Kuipers, E.J., Peppelenbosch, M.P., van der Woude, C.J., 2012. Absence of ABCG2-mediated mucosal detoxification in patients with active inflammatory bowel disease is due to impeded protein folding. Biochem. J. 441 (1), 87–93. Elliott, S.J., Wainwright, L.A., McDaniel, T.K., Jarvis, K.G., Deng, Y.K., Lai, L.C., et al., 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28 (1), 1–4. Englund, G., Jacobson, A., Rorsman, F., Artursson, P., Kindmark, A., Ronnblom, A., 2007. Efflux transporters in ulcerative colitis: decreased expression of BCRP (ABCG2) and Pgp (ABCB1). Inflamm. Bowel Dis. 13 (3), 291–297. Fernandez, C., Buyse, M., German-Fattal, M., Gimenez, F., 2004. Influence of the proinflammatory cytokines on P-glycoprotein expression and functionality. J. Pharm. Pharm. Sci. 7 (3), 359–371. Gutmann, H., Hruz, P., Zimmermann, C., Straumann, A., Terracciano, L., Hammann, F., et al., 2008. Breast cancer resistance protein and P-glycoprotein expression in patients with newly diagnosed and therapy-refractory ulcerative colitis compared with healthy controls. Digestion 78 (2–3), 154–162. Haimeur, A., Conseil, G., Deeley, R.G., Cole, S.P., 2004. The MRP-related and BCRP/ ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation. Curr. Drug Metab. 5 (1), 21–53. Hecht, G., 2001. Microbes and microbial toxins: paradigms for microbial-mucosal interactions. VII. Enteropathogenic Escherichia coli: physiological alterations from an extracellular position. Am. J. Physiol. Gastrointest. Liver Physiol. 281 (1), G1–G7. Ho, G.T., Moodie, F.M., Satsangi, J., 2003. Multidrug resistance 1 gene (P-glycoprotein 170): an important determinant in gastrointestinal disease? Gut 52 (5), 759–766. Iizasa, H., Genda, N., Kitano, T., Tomita, M., Nishihara, K., Hayashi, M., et al., 2003. Altered expression and function of P-glycoprotein in dextran sodium sulfate-induced colitis in mice. J. Pharm. Sci. 92 (3), 569–576. Jonker, J.W., Buitelaar, M., Wagenaar, E., Van Der Valk, M.A., Scheffer, G.L., Scheper, R.J., et al., 2002. The breast cancer resistance protein protects against a major chlorophyll-derived dietary phototoxin and protoporphyria. Proc. Natl. Acad. Sci. U. S. A. 99 (24), 15649–15654. Knutton, S., Baldwin, T., Williams, P.H., McNeish, A.S., 1989. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 57 (4),
5