Class A plexin expression in axotomized rubrospinal and facial motoneurons

Neuroscience 144 (2007) 1266 –1277

CLASS A PLEXIN EXPRESSION IN AXOTOMIZED RUBROSPINAL AND FACIAL MOTONEURONS E. D. SPINELLI, L. T. McPHAIL,1 L. W. OSCHIPOK,1 J. TEH AND W. TETZLAFF*

phorins are the most frequently studied following axonal injury. The Sema3 receptor complex consists of two subunits: the neuropilin-1/2 (Nrp-1/2), the ligand binding portion (He and Tessier-Lavigne, 1997; Kolodkin et al., 1997; Nakamura et al., 1998) and the signal transducing component, the class A plexins (Plxn-A1, A2, A3, A4) (Takahashi et al., 1999; Tamagnone et al., 1999). Class A plexins, Nrps and class 3 semaphorins interact in a 2:2:2 ratio (Antipenko et al., 2003) hinting at a diversity of semaphorin-receptor combinations. Furthermore, the class 3 semaphorin receptor complex has been shown to include the adhesion factors L1 cell adhesion molecule (Castellani et al., 2002) and neuronal cell adhesion molecule (NrCAM) (Julien et al., 2005) as well as the receptors for vascular endothelial growth factors (Soker et al., 1998; Fuh et al., 2000). Plexins form the crucial link between ligand binding and activation of intracellular signaling pathways including the modulation of the actin and microtubule cytoskeleton (Fan et al., 1993; Fritsche et al., 1999), loss of integrinmediated substrate adhesion (Mikule et al., 2002) and possibly changes of protein translation through the mitogen-activated protein kinase signaling pathway (Campbell and Holt, 2003; Guirland et al., 2004). In the injured rodent spinal cord, semaphorins may act as a barrier to regeneration, as mRNA transcripts for almost all class 3 semaphorins (Sema3A, 3B, 3C, 3E and 3F, as well as Sema3A protein) are expressed in fibroblasts that invade the spinal cord injury site (Pasterkamp et al., 1999, 2001; De Winter et al., 2002; Lindholm et al., 2004). In addition, Sema3B mRNA and Sema4D protein are expressed in Schwann cells and oligodendrocytes (respectively) at the site of injury (Moreau-Fauvarque et al., 2003; De Winter et al., 2002). Nrp-1, Nrp-2 mRNA and protein expression as well as Plxn-A1 mRNA expression are all either maintained or increased in many CNS neurons following injury (De Winter et al., 2002) suggesting that injured CNS neurons remain responsive to secreted class 3 semaphorins present at the injury site. In the regenerating peripheral nervous system (PNS) of adult rodents Sema3A, 3B, 3C, 3E and 3F mRNA expression is increased in endoneural fibroblasts distal to the site of a sciatic nerve crush (Scarlato et al., 2003; Ara et al., 2004) a compartment typically avoided by the regenerating axons that grow along the basal lamina tubes of the Schwann cells. However, in both facial and sciatic motoneurons, only Nrp-1 mRNA has been studied and its expression does not change after axotomy (Pasterkamp et al., 1998). Despite comprehensive data on semaphorin and Nrp expression following axonal injury, little is known about the expression of plexins in injured CNS or PNS motoneurons.

International Collaboration on Repair Discoveries, 6270 University Boulevard, University of British Columbia, Vancouver, British Columbia, Canada V6T 1Z4

Abstract—The semaphorin family of guidance molecules plays a role in many aspects of neural development, and more recently semaphorins have been implicated to contribute to the failure of injured CNS neurons to regenerate. While semaphorin expression patterns after neural injury are partially understood, little is known about the expression of their signal transducing transmembrane receptors, the plexins. Therefore, in this study, we compared the expression patterns of all class A plexins (Plxn-A1, A2, A3, A4) in mouse CNS (rubrospinal) and peripheral nervous system (PNS)-projecting (facial) motoneurons for up to two weeks following axonal injury. Using in situ hybridization, immunohistochemistry, and Western blot analysis, in rubrospinal neurons, Plxn-A1 mRNA and protein and Plxn-A4 expression did not change as a result of injury while Plxn-A2 mRNA increased and Plxn-A3 mRNA was undetectable. In facial motoneurons, Plxn-A1, -A3 and -A4 mRNA expression increased, Plxn-A2 mRNA decreased while Plxn-A1 protein expression did not change following injury. We demonstrate that with the exception of the absence of Plxn-A3 mRNA in rubrospinal neurons, both injured rubrospinal (CNS) and facial (PNS) neurons maintain expression of all plexin A family members tested. Hence, there are distinct expression patterns of the individual plexin-A family members suggesting that regenerating rubrospinal and facial motoneurons have a differential ability to transduce semaphorin signals. © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: plexins, semaphorins, regeneration, rubrospinal neurons, facial motoneurons, spinal cord injury.

Semaphorins play a crucial role during development by acting as cues guiding the correct patterning of the nervous system (reviewed in De Wit and Verhaagen, 2003). These findings led to the hypothesis that the re-expression/misexpression of semaphorins at the injury site may contribute to the inability of injured CNS neurons to regenerate into and past the injury site (Luo et al., 1993). Of the 20 semaphorin families identified to date (Semaphorin Nomenclature Committee, 1999), the class 3 secreted sema1

These authors contributed equally. *Corresponding author. Tel: ⫹1-604-822-4956; fax: ⫹1-604-822-2924. E-mail address: [email protected] (W. Tetzlaff). Abbreviations: ANOVA, analysis of variance; EDTA, ethylenediaminetetraacetic acid; ISH, in situ hybridization; Nrp, neuropilin; PBS, phosphate-buffered saline; PF, paraformaldehyde; Plxn, plexin; PNS, peripheral nervous system; RT, room temperature; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TBST, trisbuffered saline Tween-20.

0306-4522/07$30.00⫹0.00 © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2006.10.057

1266

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

Understanding plexin expression patterns in injured motoneurons may provide invaluable insight into the mechanisms possible in the responses of regenerating axons to semaphorins present at the injury site. To address this question, we compared the expression patterns of all class A plexins (Plxn-A1, A2, A3, A4) in mouse CNS (rubrospinal) and PNS (facial) motoneurons following axonal injury.

EXPERIMENTAL PROCEDURES Animals Male CD-1 mice (6 – 8 weeks old) were used in this study. All experiments were performed in accordance with the guidelines on the ethical use of animals set forth by the Canadian Council for Animal Care and were approved by the University of British Columbia Animal Care Committee. Animals were kept in a 12-h light/dark cycle and provided food and water ad libitum. For all surgical procedures, animals were anesthetized with a mixture of ketamine (135 mg/kg, Bimeda-MTC, Animal Health Inc., Cambridge, ON, Canada), and xylazine (6.5 mg/kg, Bayer Inc., Toronto, ON, Canada). Mice were killed with a lethal injection of chloral hydrate (900 mg/kg) at 3, 7 or 14 days post-surgery. Care was taken to minimize the number of animals used and their suffering.

Facial nerve axotomy The facial nerve resection procedure was performed as previously described (Tetzlaff et al., 1991; McPhail et al., 2004). The left facial nerve was exposed and a 2–3 mm section of nerve was removed from all branches, 3 mm distal from the stylomastoid foramen, to prevent reconnection of growing axons to the distal nerve stump. The contralateral facial nerve was left intact as a control. The wound was closed with wound clips (Michel, Fine Science Tools, North Vancouver, BC, Canada) and the animals were returned to the housing unit.

Rubrospinal tract lesion The spinal cord injury procedure used was performed as previously described (Tetzlaff et al., 1991; Fernandes et al., 1999). The spinal vertebrae were exposed at the third cervical level and partly removed. After opening of the dura, the dorsolateral funiculus of the spinal cord was cut with a pair of fine iris scissors. The wound was subsequently closed with wound clips and the animals were returned to their housing unit.

Immunohistochemistry Animals were perfused transcardially with 0.1 M phosphate-buffered saline (PBS, pH 7.4) followed by an equal volume of 0.1 M phosphate buffered (pH 7.4) paraformaldehyde (4% PF in 1⫻ phosphate buffer) and the brains removed. All samples were post-fixed overnight in 4% PF followed by cryoprotection in increasing sucrose gradients (14%, 18% and 22% sucrose in pH 7.4 0.1 M PBS). Each tissue sample was rapidly frozen in dry-ice cooled isopentane. Fourteen micrometer coronal sections were collected at ⫺20 °C, mounted onto Superfrost Plus Slides (Fisher Scientific, Pittsburgh, PA, USA) and stored at ⫺80 °C. Sections containing the red nucleus or facial nucleus were analyzed for protein expression with antibodies against Plexin-A1 (1:200, kindly provided by Dr. Yanagi, Laboratory of Molecular Biochemistry, School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo, Japan) (Mitsui et al., 2002) or an anti-Nrp-2 antibody (1:200, Zymed Laboratories Inc., South San Francisco, CA, USA). Both antibodies have been raised against an amino terminal, extracellular epitope of the protein of interest. All antibodies used in histochemical analysis

1267

were diluted in 0.01 M PBS and all washes were performed three times for 5 min in 0.01 M PBS. After rehydration in 0.01 M PBS, sections were incubated overnight with primary antibody at 4 °C. After washing, sections were blocked for 20 min at room temp. with 10% normal donkey serum (Jackson Immunoresearch Laboratories Inc., West Grove, PA, USA) and then incubated with a cyanin-3 conjugated donkey anti-goat secondary (1:200, Jackson Immunoresearch Laboratories Inc.) for 2 h at room temperature (RT) and subsequently washed. To identify motor neurons, sections were counterstained with the Nissl stain Neurotrace (1:200, 500/525 nm; Molecular Probes, Eugene, OR, USA) for 5 min at RT. Fluorescent images of Plxn-A1 or Nrp-2 along with Neurotrace immunoreactivity were captured using Northern Eclipse image analysis software (Empix Imaging Inc., Mississauga, ON, Canada) using a digital camera (Q-Imaging Systems, Burnaby, BC, Canada) mounted on a Zeiss Axioplan2 microscope (Carl Zeiss Canada Ltd., Toronto, ON, Canada).

Western blotting For protein isolation, a total of 10 facial nuclei were micro-dissected and pooled from fresh-frozen mouse brains. Total protein was extracted using radio immunoprecipitation assay (RIPA) lysis buffer (150 mM NaCl, 50 mM Tris pH 7.4, 5 mM EDTA, 1% tert-octylphenoxy poly(oxyethylene)ethanol (IgePalCA630), 1% sodium deoxycholate, 0.1% sodium-dodecyl-sulfate, 1 ␮g/ul each of aprotinin, phenylmethylsulfonylfluoride, leupeptin, pepstatinA; pH 7.4). Pooled nuclei were homogenized and stored on ice for 30 min, centrifuged at 11,500 r.p.m. for 5 min at 4 °C and the supernatant collected. Protein concentration of supernatant was quantified by bicinchoninic assay (BCA, Pierce, Rockford, IL, USA, as per manufacturer’s instructions) and samples immediately aliquoted and stored at ⫺80 °C. For sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), total protein was mixed 1:2 with Laemmli buffer (Bio-Rad Laboratories, Hercules, CA, USA), boiled for 5 min and each lane loaded with 40 ␮g of protein sample. Proteins were resolved SDS-PAGE (4% stacking gel, 7.5% resolving gel) for 2 h and electrophoretically transferred onto polyvinylidene fluoride (Immobilon-P, Millipore, Billerica, MA, USA) membranes overnight. After transfer, membranes were dipped in 100% methanol and allowed to dry at room temp for a minimum of 3 h. For immunodetection, membranes were initially blocked in 5% milk powder with tris-buffered saline containing 0.1% Tween-20 (TBST, pH 8.0) for 2 h at RT, followed by incubation with primary antibody diluted in 0.5% milk powder with TBST (1:3000 for Plexin-A1) overnight at 4 °C. After washing, membranes were incubated with horseradish peroxidase– conjugated donkey antigoat antibody diluted in 5% milk powder with TBST (1:30,000; Jackson Immunoresearch Laboratories Inc.) incubated for 1 h at RT and subsequently exposed to electrogenerated chemiluminescence reagent for 1 min (electrochemoluminescence, ECL, Amersham Biosciences, Pharmacia Biotech, UK; as per manufacturer’s instructions). The membranes were then exposed to autoradiographic film (Kodak Biomax, Eastman Kodak Company, Rochester, NY, USA) to visualize the protein. All membranes were washed six times for 5 min (TBST, pH 8.0) between each step. To determine equal loading of samples, membranes were stripped, blocked and re-probed with an anti-actin antibody (1:1000, ICN Biomedicals, Costa Mesa, CA, USA), followed by a horseradish peroxidase– conjugated donkey anti-rabbit secondary antibody (1: 10,000, Jackson Immunoresearch Laboratories Inc.) and protein bands visualized by chemiluminescence as described above.

ISH Two 50-mer oligonucleotide probes were used for each gene of interest to decrease developing time. All probes were created using the web-based primer design program Primer3 (Rozen and Ska-

1268

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

letsky, 2000) and their specificity was determined with the standard nucleotide BLAST database search. The oligonucleotide probes used were as follows: For Plexin-A1, nucleotides complementary to bases 588-635 and 5074-5123 (5=-CGGTTGGCTGCATAGTCCAGCAGTAGAAGCTTGTTGACGTTGTCTGTG-3= and 5=-CTGCTGAGGGACTTAGTGAAGGTAGAGGAGTTGGAGATGTTGTAGGCCGA-3= respectively; GenBank accession number D86948); for Plexin-A2 nucleotides complementary to bases 1838-1888 and 3662-3711 (5=-AAACCACACTGTAGCCATTGTAAACATAGGAGGCCACAGAGGTCAGGCGGT-3= and 5=-ACTAGTGATACTCCACTCTGGCTCAATACGTTGGACCCGTGGGTCATCTA-3= respectively; GenBank accession number D86949); for Plexin-A3, nucleotides complementary to bases 831-880 and 4642-4791 (5=-GTGTCCAGCTGCAACGTTAAGAAGTACACGAAGGAGGCACTGACAAAGCC-3=and 5=-GTACACAGTATCCAACAGCTTGTCTTTGGCCTGGGTGATGCTATCACAGT-3= respectively; GenBank accession number NM_08883); for Plexin-A4, nucleotides complementary to bases 1040-1089 and 2645-2694 (5=-TCATCATGACGGTACTTCAGAGCAAGC TAGAGTATGCCACTGACGTGCTG-3= and 5=-GTCCGGCTGACGGTCCATCCCAACAACATCTCTGTCTCTCAGTACAACGT-3= respectively; GenBank accession number NM_175750) and finally, for Plexin-B1, nucleotides complementary to bases 1811-1860 and 5549-5598 (5=-TGGTCAGTAGAGCAGGACTCTGTTGGTCTCCAAAGTAGCAGAAATATGAC-3= and 5=CTCCATCTGGGACCTTGTAATGTTGCAGTGTATTCAGACGCCTCCACAGA-3= respectively, GenBank accession number NM_ 172775). Probes were 3= end-labeled by mixing 80 ␮g of probe with 32 P-ATP, deoxy terminal transferase (BioRad), dithiothreitol, Cleland’s reagent, diethylpyrocarbonate water and 5⫻ reaction buffer. Sections were subsequently hybridized with 106 cpm of the respective probe in 100 ␮l of hybridization mixture for 12 h at 44 °C. Slides were then dipped in Kodak NTB-2 emulsion and exposed for 4 weeks at 4 °C for both Plexin-A1 and A2, A3 and A4 probes. Given the same exposure times for facial and rubrospinal experiments relative comparisons of the signals strength are made. Slides were counterstained with Neurotrace (1:200, 500/ 525 nm; Molecular Probes) to visualize motoneurons as follows: slides were first rehydrated in distilled H2O for 1 h at room temp., washed in 0.01 M PBS (3⫻15 min), incubated with Neurotrace (1:200, 500/525 nm; Molecular Probes) and finally washed in distilled H2O for 1 h at RT. Slides were dehydrated in ethanol, coverslipped and stored at ⫺20 °C. Silver grains were visualized with darkfield illumination and digital images captured as described above. To ensure specificity of the anti-sense probes used in this study, individual ISH were performed using sense probes to all corresponding class-A plexin antisense probes. Results yielded little non-specific signal and an absence of ISH signal in neuronal cell bodies, supportive of the specificity of the plexin-A antisense probes utilized in this study (data not shown).

Quantification of in situ signals Plxn-A1, -A2, -A3 and -A4 mRNA signal in injured vs. contralateral uninjured rubrospinal and facial nuclei were analyzed by measuring the area of the neuron soma occupied by silver grains. Only neurons with a clearly visible nucleus were measured to ensure each neuron was analyzed only once. On average, approximately 90 neurons were counted per rubrospinal nucleus and 120 neurons in each facial nucleus. Neuronal profiles visualized with Neurotrace were digitally traced for each section using Sigma Scan Pro 5.0 image analysis software (SPSS Inc., Chicago, IL, USA). Injured and contralateral uninjured darkfield images containing silver grains where then overlaid onto their matching circled images. Prior to combining the images, injured and contralateral uninjured darkfield images were thresholded using the same intensity to control for subtle differences when capturing images. In addition, for each section, an area lacking neurons or glia was analyzed and the value sub-

tracted from the average signal per section to account for background ISH. Three to four animals were analyzed per time point. For each animal, three or four sections, at least 50 ␮m apart, were included in the measurements (n⫽3 or 4). The areas for axotomized vs. contralateral uninjured sections for each time point were compared and plotted using Sigma Plot 2001 (SPSS Inc.). Statistical analysis of ISH signal differences between axotomized vs. contralateral uninjured was performed using a Student’s paired t-test.

Quantification of immunohistochemical signals Plxn-A1 protein expression was determined by quantification of the amount of Plxn-A1 protein immunoreactivity present in injured facial and rubrospinal nuclei over the various time points tested in a method similar to that previously described (McPhail et al., 2004). Briefly, the average Plxn-A1 immunoreactivity per injured nucleus was obtained by thresholding the intensity of the injured nuclei to that of the contralateral uninjured sections to account for any difference in immunoreactivity between sections. The density of Neurotrace immunoreactivity was similarly obtained. Subsequently, for each section, the total density of Plxn-A1 immunoreactivity per nuclei was divided by that of the total density of Neurotrace immunoreactivity per nuclei to obtain an average density of Plxn-A1 immunoreactivity for both facial and rubrospinal nuclei. Four sections at least 50 ␮m apart for each of three separate animals were analyzed (n⫽3). The average density of Plxn-A1 immunoreactivity per section was summed and all the time points compared for statistical significance using analysis of variance (ANOVA).

RESULTS Plexin-A1, -A2, -A3 and -A4 mRNA expression in axotomized rubrospinal neurons Mouse rubrospinal neurons were used as a model for non-regenerating CNS neurons and axotomized by a cut of the dorsolateral funiculus in the cervical C3/4 spinal cord. mRNA expression for class-A plexins was determined by radioactive ISH using DNA oligonucleotide probes. For each time point, the average area of the neuron soma occupied by ISH signal in both the injured and un-injured (contralateral) neurons was analyzed. Plxn-A1 mRNA expression was readily detectable and not significantly different between injured and un-injured rubrospinal neurons at any of the time points examined (Fig. 1A–C and G). In contrast, Plxn-A2 mRNA expression was barely above background signals in uninjured contralateral rubrospinal neurons. After axotomy a subpopulation of rubrospinal neurons, located in the magnocellular portion of red nucleus, expressed elevated levels of Plxn-A2 mRNA (arrows, Fig. 1D). While this increase in Plxn-A2 mRNA expression did not reach significance 3 days after injury (Fig. 1H), at 7 days after spinal cord injury, Plxn-A2 mRNA expression in injured neurons was almost double that of un-injured contralateral rubrospinal neurons (P⬍0.05) (Fig. 1E and H). By 14 days post-injury, mRNA expression was not different between injured and un-injured motoneurons (Fig. 1F and H). Plxn-A3 mRNA signal was not detected in either contralateral or axotomized rubrospinal neurons at 7 or 14 days and a counterstained picture of the red nucleus at 14 days is provided (arrows, Fig. 2A). Plxn-A4 mRNA was

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

1269

Fig. 1. Plxn-A1 and Plxn-A2 mRNA expression in axotomized and contralateral uninjured rubrospinal neurons. Darkfield micrographs of ISH for Plxn-A1 (A–C) and Plxn-A2 (D–F) mRNA. Plxn-A1 mRNA expression appeared not to change following injury at 3 (A), 7 (B) or 14 (C) days. Quantification of the area of Plxn-A1 mRNA ISH signal occupied in each neuron indicated no statistical difference between axotomized and contralateral un-injured neurons at any of the time points analyzed (G). An increase in Plxn-A2 ISH signal was observed in the caudal portion of the injured red nucleus at 3 and 7 (arrows, D and E) days after spinal cord injury, however mRNA expression returns to control levels by 14 days post-injury (F). Quantification of mRNA expression at all three time points determined a statistical increase in Plxn-A2 mRNA expression 7 days after injury (H). * Denotes a statistical significance (t-test, P⬍0.05). Scale bar⫽100 ␮m.

1270

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

readily detectable and did not differ between axotomized and contralateral rubrospinal neurons at 7days post-injury (Fig. 2C and E). However, by 14 days, Plxn-A4 mRNA expression was found to be significantly reduced in axotomized rubrospinal neurons (P⬍0.05) (Fig. 2D and E). Plexin-A1, -A2, -A3 and -A4 mRNA expression in axotomized facial motoneurons Mouse facial motoneurons were used as a model for regenerating PNS neurons. Mouse facial neurons were unilaterally axotomized at the stylomastoid foramen as previously described (Tetzlaff et al., 1991; McPhail et al., 2004) and analyzed as above. Similar to rubrospinal neurons Plxn-A1 was readily detectable in facial motoneurons. After axotomy Plxn-A1 mRNA expression did not change by 3 days following injury (Fig. 3A and G). At 7 days post-axotomy, Plxn-A1 mRNA expression was increased in most motoneurons (Fig. 3B) and quantification of the ISH signal reached significance (P⬍0.05) (Fig. 3G). Interestingly, at 14 days after injury, Plxn-A1 mRNA expression was slightly reduced in axotomized compared with contralateral facial motoneurons (P⬍0.05). Expression of Plxn-A2 mRNA was found at low levels and did not differ between axotomized and contralateral facial motoneurons at 3 (Fig. 3D and H) or 7 (Fig. 3E and H) days after injury. By 14 days post-injury, Plxn-A2 mRNA significantly decreased (P⬍0.05) in the axotomized motoneurons (Fig. 3F and H). Plxn-A3 mRNA signal was hardly detectable in contralateral facial motoneurons and increased markedly at both 7 (P⬍0.01) and 14 (P⬍0.05) days post-axotomy (Fig. 4A–C and F). Plxn-A4 mRNA expression was lower in contralateral facial motoneurons and increased 7 days after axotomy (P⬍0.05) (Fig. 4D and G). By 14 days post-injury this increase in Plxn-A4 mRNA expression no longer reached significance (Fig. 4E and G). Plexin-A1 protein expression in axotomized rubrospinal and facial motoneurons Plxn-A1 protein expression was determined in rubrospinal and facial motoneurons using an anti-Plxn-A1 antibody (Mitsui et al., 2002). Quantification of Plxn-A1 immunoreactivity revealed that protein expression in injured rubrospinal neurons did not differ over any of the time points observed (Fig. 5A–C and G). Although both Plxn-A1 mRNA and Plxn-A1 immunoreactivity show a trend toward decreased expression in injured rubrospinal neurons, by 14 days after injury, these changes in expression did not reach significance. The transient increase in Plxn-A1 mRNA at 7 days postinjury in facial motoneurons was not reflected by an increase Fig. 2. Plxn-A3 and Plxn-A4 mRNA expression in axotomized and contralateral uninjured rubrospinal neurons. Plxn-A3 mRNA expression in rubrospinal neurons (red) is virtually absent 14 (A) days after spinal cord injury. Fine red grains show Plxn-A3 mRNA signal, while larger red signals are artifacts of the ISH process and are not representative of ISH signal. Note the absence of mRNA colocalization with injured and uninjured rubrospinal neuronal cell bodies identified by green fluorescent Nissl-substance (arrows, A). Plxn-A4 mRNA expression did not differ between axotomized and contralateral uninjured rubrospinal

neurons 7 days after spinal cord injury (B) although by 14-days (C), expression decreased slightly. Quantification of the area of Plxn-A4 mRNA ISH signal occupied in each neuron (D) indicated a statistical difference reduction in injured neurons at 14 days. * Denotes a statistical significance (t-test, P⬍0.05). Scale bar⫽100 ␮m. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

1271

Fig. 3. Plxn-A1 and Plxn-A2 mRNA expression in axotomized vs. contralateral uninjured facial motoneurons. Darkfield images of Plxn-A1 mRNA in axotomized compared with contralateral uninjured facial motoneurons at 3, 7 and 14 days after injury (A–C). Quantification of the area of Plxn-A1 mRNA ISH signal occupied in each neuron indicated a statistical increase in injured facial motoneurons, 7 days after resection injury (G). By 14 days post-injury there was a significant reduction in Plxn-A1 mRNA in injured compared with uninjured neurons. Darkfield images of Plxn-A2 mRNA expression show little difference between axotomized and contralateral uninjured facial motoneurons at 3 (D) and 7 (E) days after injury. Fourteen days after injury, however, Plxn-A2 mRNA signal appears lower in axotomized motoneurons (F). Quantification of the area of Plxn-A2 mRNA ISH signal occupied in each neuron indicated a statistical reduction in uninjured facial motoneurons, 14 days after resection injury (H). * Denotes a statistical significance (t-test P⬍0.05). Scale bar⫽100 ␮m.

in Plxn-A1 immunoreactivity on day 7 (Fig. 5E). Statistical analysis resulted in no difference in expression of Plxn-A2 protein expression over the time points observed (Fig. 5H). Similarly, Western blot analysis of Plxn-A1 protein expression 14 days after facial nerve injury revealed no detectable change in amount of protein present in injured compared with contralateral facial nuclei, supporting our immunohistochemical findings (Fig. 6). Expression of Plxn-A1 in total whole mouse brain protein extract is shown as comparison due to its reported high expression in adult mouse brain tissue (Kameyama et al., 1996).

DISCUSSION In the present study we compared the mRNA expression patterns of all plexin A family members (Plexin-A1, A2, A3, A4) in axotomized rubrospinal (CNS) and facial (PNS) motoneurons. In axotomized rubrospinal neurons 7 days after spinal cord injury, mRNA expression of Plxn-A1, A2 and A4 mRNA is maintained or increased, while Plxn-A3 mRNA expression was not detected in either axotomized or contralateral uninjured neurons over any time points analyzed (Fig. 7A). By 14 days after spinal cord injury, the

1272

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

Fig. 4. Plxn-A3 and Plxn-A4 mRNA expression in axotomized and contralateral uninjured facial motoneurons. Darkfield images show a dramatic increase in Plxn-A3 mRNA expression in axotomized compared with contralateral uninjured facial motoneurons at 3 (A) and 7 (B) days post-injury, low and high magnification respectively, and an even greater increase 14 days (C) following injury. Quantification of the area of Plxn-A3 mRNA ISH signal occupied in each neuron indicated a statistical increase in uninjured facial motoneurons at both 7 and 14 days post-injury (F). Darkfield images of Plxn-A4 mRNA expression show increased signal in axotomized vs. contralateral uninjured facial motoneurons at 7 (D) and 14 (E) days after injury. However, quantification of the area of Plxn-A4 mRNA ISH signal occupied in each neuron indicated a statistical increase only at 7 days post-injury (G). * Denotes a statistical significance (t-test, P⬍0.05). Scale bar⫽100 ␮m.

difference in Plxn-A2 mRNA was undetectable while Plxn-A4 mRNA expression had decreased in injured compared with contralateral uninjured rubrospinal neurons. In facial motoneurons 7 days after resection injury, mRNA expression of Plxn-A1, A3 and A4 was increased, while Plxn-A2 mRNA expression was maintained (Fig. 7B). However, by 14 days after resection injury, both Plxn-A1 and A2 mRNA expression was decreased, while Plxn-A3 mRNA continued to be higher and Plxn-A4 mRNA expression was similar in injured compared with contralateral uninjured facial motoneurons. In addition, Plxn-A1 protein expression appeared to be maintained in both axotomized and uninjured rubrospinal and facial motoneurons in sup-

port of our ISH results. These data demonstrate that mRNA expression of individual plexin A family members is differentially regulated after axotomy and that regulation of plexin A expression differs in axotomized rubrospinal versus facial motoneurons. These observations suggest that regenerating rubrospinal and facial neurons are capable of transducing different yet overlapping sets of semaphorin signals. Implications of plexins in rubrospinal neurons After a thoracic spinal cord injury in the rat, fibroblasts invade the injury site and express mRNAs of secreted semaphorins including Sema3A, 3B, 3C, 3E and 3F, as well as Sema3A

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

1273

Fig. 5. Plxn-A1 immunohistochemistry in rubrospinal and facial motoneurons. Plxn-A1 protein expression did not appear to change following injury in both rubrospinal (A–C) and facial motoneurons (D–F) at any of the time points analyzed. Quantitative analysis (ANOVA) of the neuronal area occupied by Plxn-A1 florescence as a function of Neurotrace area in motoneurons revealed no significant change in either the rubrospinal (G) or facial (H) motoneurons following injury. Scale bar⫽100 ␮m.

protein (Pasterkamp et al., 1999, 2001; De Winter et al., 2002; Lindholm et al., 2004). Furthermore, regenerating descending fibers are unable to enter the rostral border of this semaphorin-positive scar site after dorsal column lesion in rats (De Winter et al., 2002). The presence of semaphorin signals in the scar site begins as early as 6 days and lasts at least up to 2 months post-spinal cord transection (Pasterkamp et al., 2001). Semaphorins have been reported to be expressed by other cell types present at the injury site, including invading Schwann cells, which ex-

press Sema3B mRNA (De Winter et al., 2002). Moreover, the transmembrane Sema4D protein was found on oligodendrocytes and myelin (Moreau-Fauvarque et al., 2003). Injured rubrospinal neurons continue to express components of the semaphorin receptor complex, including Plxn-A1 and Nrp-2 mRNA, but not Nrp-1 mRNA, for at least 56 days after a thoracic spinal cord lesion in rats (De Winter et al., 2002). Our work together with that of De Winter and colleagues (2002) suggests that the semaphorin receptor

1274

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

Fig. 6. Western blot for Plxn-A1 and actin (loading control) protein in axotomized (14 days post-injury) and contralateral uninjured facial nuclei from 10 pooled mice. Amount of Plxn-A1 protein remained unchanged in facial motoneurons following injury. Expression of Plxn-A1 in total whole mouse brain protein extract is shown as a positive control.

complex present in injured rubrospinal neurons consists of Nrp-2 and a combination of Plxn-A1, -A2 or -A4 receptors. As plexins can function as homo- or heterodimers (Rohm et al., 2000) as do Nrps (Giger et al., 1998), this suggests that following injury, rubrospinal neurons are only able to form receptor complexes with Nrp-2 homodimers possibly limiting their interaction with semaphorins present at the spinal cord injury site (Table 1, Fig. 7). This may have implications regarding the binding dynamics of semaphorins in injured rubrospinal axon growth cones at the spinal cord injury site. The absence of Nrp-1 mRNA in rubrospinal neurons (De Winter et al., 2002) is of particular interest as in vitro work has shown that Sema3A signals are transduced by a receptor complex composed of Nrp-1 homodimers (Chen et al., 1997; Feiner et al., 1997; Takahashi et al., 1998; Giger et al., 1998, 2000). Therefore, although signals from other semaphorins at the spinal cord injury site would be transduced, injured rubrospinal neurons may not be able to respond to Sema3A. The absence of Plxn-A3 mRNA in rubrospinal neurons on the other hand, is surprising in light of Sema3F signaling, as previous work has pointed to the importance of a Nrp-2:Plxn-A3 complex as the Sema3F receptor (Cheng et al., 2001; Bagri et al., 2003; Yaron et al., 2005). The absence of Plxn-A3 mRNA may be a feature of all CNS neurons, as Plxn-A3 mRNA is largely absent from all layers of the sensory motor cortex in mice (Murakami et al., 2001; Suto et al., 2003). Despite continued Plxn-A4 expression, sympathetic ganglia lacking Plxn-A3 lose their Sema3F-induced repulsion indicating that Sema3F:Plxn-A4 is not sufficient (Cheng et al., 2001). The expression of regeneration associated genes (RAGs) such as GAP-43 and T␣1-tubulin peaks at 7 days postinjury in rubrospinal neurons after cervical injury (Tetzlaff et al., 1991; Fernandes et al., 1999), suggesting a maximal regenerative capacity at this time. In the present study, we show that during this time of high regenerative capacity, axotomized rubrospinal neurons do not express Plxn-A3, but maintain or increase Plxn-A1 mRNA and protein, Plxn-A2 and Plxn-A4 expression. Therefore, rubrospinal neurons are likely non-responsive to Sema3F although the

exact binding properties of Sema3F need to be fully elucidated. Like Sema3F, Sema3C is also present at the spinal cord injury site (De Winter et al., 2002). Sema3C is thought to signal through a receptor complex formed with Nrp-1: Nrp-2 heterodimers (Chen et al., 1997), but also appears to bind to neuronal populations expressing only Nrp-2 (Giger et al., 1998), preferring Nrp-2 compared with Nrp-1 in vitro (Bagri and Tessier-Lavigne, 2002). This suggests that Sema3C would interact with the complement of receptors expressed on rubrospinal neurons. Similarly, Sema3B and Sema3D appear to signal through both Nrps, although the exact plexins involved and the necessity of both Nrps are as yet unknown (Takahashi et al., 1998; Wolman et al., 2004). Thus these latter 2 semaphorins remain potential guidance molecules for rubrospinal axons. Therefore, we speculate that following injury, rubrospinal neurons retain the ability to respond to Sema3B, 3C, 3D and 3E, but

Fig. 7. Possible secreted class 3 semaphorin interactions with receptor complexes at the spinal cord injury site (A) and the distal stump of the transected facial nerve (B), 7 days after injury. In the injured spinal cord (A), rubrospinal axon growth cones expressing Nrp-2 and PlxnA1, -A2 and -A4, would remain responsive to Sema3B, 3C and 3E expressed at the injury site. In the distal stump/neuroma of the transected facial nerve (B), facial axon growth cones would continue to express both Nrps and Plxn-A1⬃A4 and remain responsive to Sema3A⬃3F molecules expressed at the injury site. BDL, below detection levels. [1] De Winter et al. (2002); [2] Scarlato et al. (2003); [3] Pasterkamp et al. (1998); [4] our findings corroborate those of De Winter et al. (2002).

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

1275

Table 1. Known class 3 receptor complexes Semaphorin Neuropilin Plexin

Sema3A Nrp-1:Nrp-1 Plxn-A1/A2/ A3/A4

Sema3B Nrp-1:Nrp-2

Sema3C Nrp-1:Nrp-2 Plxn-A1/A2

Sema3D Nrp-1

Sema3E Nrp-1 Plxn-D1

Sema3F Nrp-2:Nrp-2 Plxn-A1/A2/A3

Sema3A signaling is mediated through a receptor complex composed of Nrp-1 homodimers and any combination of class A plexins hetero- or homodimers in vitro. Sema3C binds with a Nrp-1:Nrp-2 heterodimer and Plxn-A1 and Plxn-A2 hetero- or homodimers, while Sema3F interacts with Nrp-2 homodimers and Plxn-A1, -A2 or -A3 hetero- or homodimers. Although some interaction between Sema3B, 3C and 3E with neuropilins has been shown, the interaction with plexins is largely unknown. Sema3E has also been shown to interact with Plxn-D1. Adapted from Yazdani and Terman (2006).

unlikely Sema3A and 3F, present at the spinal cord injury site. Further analysis of the properties of different neuropilin:plexin complexes in semaphorin signaling is clearly necessary. Implications of plexin expression in facial motoneurons As with the injured CNS, semaphorins are expressed in fibroblasts in the injured PNS, although their function appears to be slightly different. Whereas the expression of semaphorins in the spinal cord injury site may act as a barrier to regenerating axons, in the injured PNS, semaphorin expression has been hypothesized to limit any spurious growth, thereby allowing correct guidance of axons to target tissue (Scarlato et al., 2003). Recent work has shown that Sema3A, 3B, 3C, 3E and 3F but not Sema3D mRNA expression is increased distal to the site of sciatic nerve crush in adult mouse and rat (Scarlato et al., 2003; Ara et al., 2004). The source of Sema3A and 3F mRNA in the distal nerve stump appears to be fibroblasts located in the epineurial, perineurial and endoneurial sheaths surrounding the axons (Scarlato et al., 2003) a compartment typically avoided by the regenerating axons that grow along the basal lamina tubes of the Schwann cells. Injured facial motoneurons continue to express Nrp-1 (Pasterkamp et al., 1998) and Nrp-2 protein (data not shown). This suggests that the semaphorin receptor complex in axotomized facial motoneurons would be composed of both Nrps (Nrp-1 and Nrp-2) and three plexins (Plxn-A1, A3, A4) which all increase in expression after injury. Unlike the increase in Plxn-A1 mRNA, Plxn-A1 protein expression did not change in injured facial motoneurons. This may be in part, due to increased transport of Plxn-A1 protein to growth cones as is suggested by in vitro studies showing the localization of Plexin-A1 protein to neurite growth cones (Murakami et al., 2001) as well as the coclustering of Plxn-A1 and Nrp-1 on growth cones in response to a Sema3A source (Takahashi et al., 1999; Fournier et al., 2000). Plxn-A2 mRNA expression is initially maintained but then is reduced in injured facial motoneurons at 14 days post-injury. Interestingly, Plxn-A4 has been shown to act as a receptor for both Sema3F (Table 1) and the class 6 semaphorins: Semab6A and 6B (Toyofuku et al., 2004; Suto et al., 2005). In light of our results, Sema6A and 6B expression at the injury site will have to be analyzed to explore whether class 6 semaphorins play a role in nerve injury. Therefore, at 7 days post-injury, a period of high

regeneration potential in axotomized facial motoneurons (Tetzlaff et al., 1991), facial motoneurons express Plxn-A1, A3 and A4 mRNA and Plxn-A1 protein, suggesting their responsiveness to Sema3A, 3B, 3C, 3E and 3F. Semaphorin expression at the facial nerve injury site has yet to be analyzed, but is likely analogous to the injured sciatic nerve. A lack of information regarding independent roles of plexins in semaphorin signaling permits at this time only speculation of why Plxn-A2 expression differs from that of other plexins. The preferential interaction of Sema3C with a Nrp-2:Plxn-A2 or the Nrp-1:Plxn-A2 receptor complex (Rohm et al., 2000) suggests that regenerating facial motoneuron axons may have a reduced interaction with Sema3C. Sema3C has previously been shown to be expressed in fibroblasts of the distal nerve stump (Ara et al., 2004). Taken together this suggests that axonal binding to Sema3C may be more affected than the other semaphorins after axotomy. Recent work has also shown that Sema3E can interact directly with Plxn-D1 in the absence of Nrps (Gu et al., 2005). Further work will have to focus on Plxn-D1 expression in injured facial motoneurons as it has been shown to be expressed in the cranial ganglia (Van Der Zwaag et al., 2002).

CONCLUSION Both injured rubrospinal (CNS) and facial (PNS) neurons maintain the expression of all plexin A family members tested in the present study, and with the exception of no detectable expression of Plxn-A3 mRNA in rubrospinal neurons, there appear to be distinct expression patterns depending on the individual plexin family member. Regenerating rubrospinal and facial axons encountering semaphorins present along their regeneration route will therefore largely retain the ability to transduce these semaphorin signals. Interestingly, our results suggest that regenerating facial motoneurons remain responsive to more semaphorin family members than rubrospinal motoneurons. This supports the concept that semaphorins may act as guidance molecules and that the spatial arrangement along the path of outgrowth may determine their function in regeneration. This spatial arrangement could inhibit regeneration along the disorganized scar fibroblasts at a spinal cord injury site or promote regeneration by preventing aberrant growth into the endoneurial space of a peripheral nerve. However, a further understanding of specific semaphorin-Nrp-plexin interaction pat-

1276

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277

terns, as well as with other molecules included in the receptor complex, is needed to fully discern the role of specific semaphorins in regeneration of injured axons. Acknowledgments—The authors thank Jie Liu for his technical assistance and Dr. S. Yanagi for the kind gift of the Plexin-A1 antibody. This work was supported with funds from a Christopher Reeves Paralysis Foundation Grant (W.T.) and by studentships from the Rick Hansen Man in Motion Foundation (E.D.S) and the Canadian Medical Research Council (L.W.O). L.T.M. was supported by the Natural Sciences and Engineering Council of Canada and the Michael Smith Foundation for Health Research. Wolfram Tetzlaff holds the Rick Hansen Man in Motion Foundation Chair in Spinal Cord Research.

REFERENCES Antipenko A, Himanen JP, van Leyen K, Nardi-dei V, Lesniak J, Barton WA, Rajashankar KR, Lu M, Hoemme C, Puschel AW, Nikolov DB (2003) Structure of the semaphorin-3A receptor binding module. Neuron 39:589 –598. Ara J, Bannerman P, Hahn A, Ramierz S, Pleasure D (2004) Modulation of sciatic nerve expression of class 3 semaphorins by nerve injury. Neurochem Res 29:1153–1159. Bagri A, Cheng HJ, Yaron A, Pleasure SJ, Tessier-Lavigne M (2003) Stereotyped pruning of long hippocampal axon branches triggered by retraction inducers of the semaphorin family. Cell 113:285–299. Bagri A, Tessier-Lavigne M (2002) Neuropilins as semaphorin receptors: in vivo functions in neuronal cell migration and axon guidance. Adv Exp Med Biol 515:13–31. Campbell DS, Holt CE (2003) Apoptotic pathway and MAPKs differentially regulate chemotropic responses of retinal growth cones. Neuron 37:939 –952. Castellani V, De Angelis E, Kenwrick S, Rougon G (2002) Cis and trans interactions of L1 with neuropilin-1 control axonal responses to semaphorin 3A. EMBO J 21:6348 – 6357. Chen H, Chedotal A, He Z, Goodman CS, Tessier-Lavigne M (1997) Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins sema E and sema IV but not sema III. Neuron 19:547–559. Cheng HJ, Bagri A, Yaron A, Stein E, Pleasure SJ, Tessier-Lavigne M (2001) Plexin-A3 mediates semaphorin signaling and regulates the development of hippocampal axonal projections. Neuron 32: 249 –263. De Winter F, Oudega M, Lankhorst AJ, Hamers FP, Blits B, Ruitenberg MJ, Pasterkamp RJ, Gispen WH, Verhaagen J (2002) Injury-induced class 3 semaphorin expression in the rat spinal cord. Exp Neurol 175:61–75. De Wit J, Verhaagen J (2003) Role of semaphorins in the adult nervous system. Prog Neurobiol 71:249 –267. Fan J, Mansfield GS, Redmond T, Gordon-Weeks PR, Raper JA (1993) The organization of F-actin and microtubules in growth cones exposed to a brain-derived collapsing factor. J Cell Biol 121:867– 878. Feiner L, Koppel AM, Kobayashi H, Raper JA (1997) Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ. Neuron 19:539 –545. Fernandes KJL, Fan DP, Tsui BJ, Cassar SL, Tetzlaff W (1999) Influence of the axotomy of cell body distance in rat rubrospinal and spinal motoneurons: Differential regulation of GAP-43, tubulins, and neurofilament-M. J Comp Neurol 414:495–510. Fournier AE, Nakamura F, Kawamoto S, Goshima Y, Kalb RG, Strittmatter SM (2000) Semaphorin3A enhances endocytosis at sites of receptor-F-actin colocalization during growth cone collapse. J Cell Biol 142:411– 422.

Fritsche J, Reber BFX, Schindelholz B, Bandtlow C (1999) Differential cytoskeletal changes during growth cone collapse in response to hSema III and thrombin. Mol Cell Neurosci 14:398 – 418. Fuh H, Garcia KC, de Vos AM (2000) The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor flt-1. J Biol Chem 275:26690 –26695. Giger RJ, Urquhart ER, Gillespie SKH, Levelngood DV, Ginty DD, Kolodkin AL (1998) Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity. Neuron 21:1079 –1092. Giger RJ, Cloutier JF, Sahay A, Prinjha RK, Levengood DV, Moore SE, Pickering S, Simmons D, Rastan S, Walsh FS, Kolodking AL, Ginty DD, Geppert M (2000) Neuropilin-2 is required in vivo for selective axon guidance responses to secreted semaphorins. Neuron 25:29 – 41. Gu C, Yoshida Y, Livet J, Reimert DV, Mann F, Merte J, Henderson CE, Jessell TM, Kolodkin AL, Ginty DD (2005) Semaphorin 3E and plexin-D1 control vascular pattern independently of neuropilins. Science 307:265–268. Guirland C, Suzuki S, Kojima M, Lu B, Zheng JQ (2004) Lipid rafts mediate chemotropic guidance of nerve growth cones. Neuron 42:51– 62. He Z, Tessier-Lavigne M (1997) Neuropilin is a receptor for the axonal chemorepellent semaphorin III. Cell 90:739 –751. Julien F, Bechara A, Fiore R, Nawabi H, Zhou H, Hoyo-Becerra C, Bozon M, Rougon G, Grumet M, Puschel AW, Sanes JR, Castellani V (2005) Dual functional activity of semaphorin 3B is required for positioning and anterior commissure. Neuron 48:63–75. Kameyama T, Murakami Y, Suto F, Kawakami A, Takagi S, Hirata T, Fujisawa H (1996) Identification of a neuronal cell surface molecule, plexin, in mice. Biochem Biophys Res Commun 226: 524 –529. Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD (1997) Neuropilin is a semaphorin III receptor. Cell 90:753–762. Lindholm T, Sköld MK, Suneson A, Carlstedt T, Cullheim S, Risling M (2004) Semaphorin and neuropilin expression in motoneurons after intraspinal motoneurons axotomy. Neuroreport 15:649 – 654. Luo Y, Raible D, Raper JA (1993) Collapsin: A protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75:217–227. McPhail LT, McBride BC, McGraw J, Steeves JD, Tetzlaff W (2004) Axotomy abolishes NeuN expression in facial but not rubrospinal neurons. Exp Neurol 185:182–190. Mikule K, Gatlin JC, de la Houssaye BA, Pfenninger KH (2002) Growth cone collapse induced by semaphorin 3A requires 12/15-lipoxygenase. J Neurosci 22:4932– 4941. Mitsui M, Inatome R, Takahashi S, Goshima Y, Yamamura H, Yanagi S (2002) Involvement of Fes/Fps tyrosine kinase in semaphorin signaling. EMBO J 21:3274 –3285. Moreau-Fauvarque C, Kumanagoh A, Camand E, Jailard C, Barbin G, Boquet I, Love C, Jone YE, Kikutani H, Lubetzki C, Dusart I, Chedotal A (2003) The transmembrane semaphorin Sema4D/CD100, an inhibitor of axon growth, is expressed on oligodendrocytes and upregulated after CNS lesion. J Neurosci 23:9229–9239. Murakami Y, Suto F, Shimizu M, Shinoda T, Kaneyama T, Fujisawa H (2001) Differential expression of plexin-A subfamily members in the mouse nervous system. Dev Dyn 220:246 –258. Nakamura F, Tanaka M, Takahashi T, Kalb RG, Strittmatter SM (1998) Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse. Neuron 21:1093–1100. Pasterkamp RJ, Giger RJ, Verhaagen J (1998) Regulation of semaphorin III/collapsing-1 gene expression during peripheral nerve regeneration. Exp Neurol 153:313–327. Pasterkamp RJ, Giger RJ, Ruitenberg MJ, Holtmaat AJDG, De Wit J, De Winter F, Verhaagen J (1999) Expression of the gene encoding the chemorepellent semaphorin III is induced in the fibroblast component of the neural scar tissue formed following injuries of adult but not neonatal CNS. Mol Cell Neurosci 13:143–166.

E. D. Spinelli et al. / Neuroscience 144 (2007) 1266 –1277 Pasterkamp RJ, Anderson PN, Verhaagen J (2001) Peripheral nerve injury fails to induce growth of lesioned dorsal column axons into spinal cord scar tissue expressing the axon repellent semaphorin 3A. Eur J Neurosci 13:457– 471. Rohm B, Ottemeyer A, Lohrum M, Puschel AW (2000) Plexin/neuropilin complexes mediate repulsion by the axonal guidance signal semaphorin3A. Mech Dev 93:95–104. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365–386. Scarlato M, Ara J, Bannerman P, Scherer S, Pleasure D (2003) Induction of neuropilins-1 and -2 and their ligands, Sema3A, Sema3F, and VEGF, during Wallerian degeneration in the peripheral nervous system. Exp Neurol 183:489 – 498. Semaphorin Nomenclature Committee (1999) Unified nomenclature for the semaphorins/collapsins. Cell 97:551–552. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M (1998) Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 92:735–745. Suto F, Murakami Y, Nakamura F, Goshima Y, Fujisawa H (2003) Identification and characterization of a novel mouse plexin, plexinA4. Mech Dev 120:385–396. Suto F, Ito K, Uemura M, Shimizu M, Shinkawa Y, Sanbo M, Shinoda T, Tsuboi M, Takashima S, Yagi T, Fujisawa H (2005) Plexin-A4 mediates axon-repulsive acitivites of both secreted and transmembrane semaphorins and plays roles in nerve fiber guidance. J Neurosci 25:3628 –3637. Takahashi T, Nakamura F, Jin Z, Kalb RG, Strittmatter SM (1998) Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neuropilin-2 receptors. Nat Neurosci 1:487– 493.

1277

Takahashi T, Fournier A, Nakamura F, Wang LH, Murakami Y, Kalb RG, Fujisawa H, Strittmatter SM (1999) Plexin-neuropilin-1 complexes form functional semaphorin-3a receptors. Cell 99:59 – 69. Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, Chedotal A, Winberg ML, Goodman CS, Poo M, Tessier-Lavigne M, Comoglio PM (1999) Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99: 71–80. Tetzlaff W, Alexander SW, Miller FD, Bisby MA (1991) Response of facial and rubrospinal neurons to axotomy: Changes in mRNA expression of cytoskeletal proteins and GAP-43. J Neurosci 11: 2528 –2544. Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Yabuki M, Harada K, Hori M, Kikutani H (2004) Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling. Nat Cell Biol 6:1204 –1211. Van Der Zwaag B, Hellemons AJCGM, Leenders WPJ, Burbach JPH, Brunner HG, Padberg GW, Van Bokhoven H (2002) Plexin-D1, a novel plexin family member, is expressed in vascular endothelium and the central nervous system during mouse embryogenesis. Dev Dyn 225:336 –343. Wolman MA, Liu Y, Tawarayama H, Shoji W, Halloran MC (2004) Repulsion and attraction of axons by semaphorin3D are mediated by different neuropilins in vivo. J Neurosci 24:8428 – 8425. Yaron A, Huang PH, Cheng HJ, Tessier-Lavigne M (2005) Differential requirements for plexin-A3 and -A4 in mediating responses of sensory and sympathetic neurons to distinct class 3 semaphorins. Neuron 45:513–523. Yazdani U, Terman JR (2006) The semaphorins. Genome Biol 7: 211–215.

(Accepted 30 October 2006) (Available online 29 December 2006)