- Email: [email protected]
Cleavage and polyadenylation factor, Rna14 is an essential protein required for the maintenance of genomic integrity in fission yeast Schizosaccharomyces pombe
Biochimica et Biophysica Acta 1863 (2016) 189–197
Contents lists available at ScienceDirect
Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr
Cleavage and polyadenylation factor, Rna14 is an essential protein required for the maintenance of genomic integrity in fission yeast Schizosaccharomyces pombe Amit Sonkar, Sudhanshu Yadav 1, Shakil Ahmed ⁎ Molecular and Structural Biology Division, CSIR-Central Drug Research Institute, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow 226031, India
a r t i c l e
i n f o
Article history: Received 16 September 2015 Received in revised form 28 October 2015 Accepted 11 November 2015 Available online 12 November 2015 Keywords: S. pombe Rna14 Bub1 Checkpoint Transcription termination
a b s t r a c t Faithful segregation of chromosomes is essential for the maintenance of genome integrity. In a genetic screen to identify genes related to checkpoint function, we have characterized the role of rna14, an essential gene in the maintenance of chromosome dynamics. We demonstrate that Rna14 localizes in the nucleus and in the absence of functional Rna14, the cells exhibit chromosomal segregation defects. The mutant allele of rna14 exhibits genetic interaction with key kinetochore components and spindle checkpoint proteins. Inactivation of rna14 leads to accumulation of Bub1-GFP foci, a protein required for spindle checkpoint activation that could be due to the defects in the attachment of mitotic spindle to the chromosome. Consistently, the double mutant of rna14-11 and bub1 knockout exhibits high degree of chromosome mis-segregation. At restrictive condition, the rna14-11 mutant cells exhibit defects in cell cycle progression with high level of septation. The orthologs of Rna14 in Saccharomyces cerevisiae (sc Rna14) and human (CstF3) contain similar domain architecture and are required for 3′-end processing of pre-mRNA. We have also demonstrated that the fission yeast Rna14 is required to prevent transcriptional read-through. These findings reveal the importance of transcription termination in the maintenance of genomic stability through the regulation of kinetochore function. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The faithful segregation of chromosomes is essential for cell viability. Mitosis with abnormal chromosome segregation can lead to aneuploidy, a hallmark of cancer and several congenital diseases. Proper chromosomal segregation is achieved by the spindle assembly checkpoint (SAC) pathway which is a conserved surveillance mechanism that arrests cells in mitosis in response to defective spindle [1]. Lack of tension on kinetochore or unattached kinetochore activates the spindle checkpoint and prevents the anaphase onset, exit from mitosis and initiation of cytokinesis [2,3]. The mitotic checkpoint complex (MCC) comprises of BubR1, Bub3, Mad1, Mad2, Mps1 and Cdc20 proteins that inhibit the anaphase-promoting complex/cyclosome (APC/C), a large complex containing E3 ubiquitin ligase required for anaphase onset [4]. Kinetochore, a specialized protein structure within the centromeric region is required for the attachment of spindle microtubules to the chromosomes [5]. The integrity of the centromeric chromatin and the proteins associated with kinetochore structure play an important role in maintaining chromosome stability. Mis12 is an evolutionarily ⁎ Corresponding author. E-mail address: [email protected] (S. Ahmed). 1 Present address: Department of Immunology & Genomic Medicine, Kyoto University, Japan.
http://dx.doi.org/10.1016/j.bbamcr.2015.11.007 0167-4889/© 2015 Elsevier B.V. All rights reserved.
conserved kinetochore protein that forms a complex with Mis13 and Mis14 [6,7]. The KMN complex, containing Knl1–Mis12–Ndc80 proteins provides the core binding site within the kinetochore required for the microtubule attachment [8,9]. Mis6, another kinetochore protein form a complex with Mis15, Mis17, and Sim4 promoting the loading of CENP-A to the centromere [10–12]. Mis6 has also been reported for the loading of the mitotic spindle checkpoint protein Mad2 at the kinetochore [13]. In fission yeast, the mutation in the components of kinetochore complex leads to unequal chromosome segregation [14,15]. After transcription by RNA polymerase II, post-transcriptional modifications are required to convert nascent RNA into mature RNA. These modifications include the addition of the 5′ cap, splicing, 3′ end cleavage and polyadenylation. Precise action of these modification steps plays important roles in the stabilization of RNA, export from the nucleus, and translation stimulation [16,17]. In eukaryotic cells, a multi-subunit protein complex is responsible for 3′ end processing. This complex includes cleavage and polyadenylation factor (CPSF) and cleavage stimulating factor (CstF) which are conserved in different eukaryotes [18–20]. Four distinct factors have been identified in Saccharomyces cerevisiae that are essential for cleavage and polyadenylation. These include cleavage factor I (CF I), CF II, polyadenylation factor I (PF I) and poly A polymerase I (PAP I) [21]. CFIA subunit of CFI contains Rna14, Rna15, Pcf11 and Clp1 while PFI subunit consists of many proteins including Fip1, Pcf11, Psf1, Psf2, Yth1, etc. [22,23]. Rna15 contains an RNA recognition
190
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
module (RRM) at the N-terminus [24], followed by a hinge region and a C-terminal domain (CTD), which interacts with Pcf11 [25] while the hinge region interacts with the C-terminal region of Rna14 [26]. S. cerevisiae Rna14 contains several Half-A-TPR (HAT) repeats and is essential for 3′ end processing [27]. Cleavage and polyadenylation defects can lead to transcription beyond the normal termination region, potentially disrupting the functions of genes and downstream pathways. In this study, we have described the role of Rna14, a cleavage and polyadenylation factor during cell cycle progression. We have demonstrated that the inactivation of Rna14 in fission yeast causes chromosome segregation defects that result in high level of chromosome loss. We present evidence that a functional spindle checkpoint response is required for the cells to survive after rna14 inactivation. These findings indicate the importance of transcription termination for the maintenance of genomic stability.
2. Materials and methods 2.1. Yeast strains and media Schizosaccharomyces pombe strains used in this study are listed in Table 1. We have utilized standard genetic methods for the construction of strains [28]. For temperature shift experiments, cells were grown at 25 °C and shifted to restrictive temperature of 36 °C unless otherwise indicated. For survival assays, samples were collected, and the equal number of cells from each sample was plated on YEA plates. The plates were incubated at permissive temperature; the number of surviving colonies was counted, and graph was plotted. For serial dilution assays, 107 cells were serially diluted, spotted on YEA plates and incubated at indicated temperature for 3–4 days.
Table 2 Oligonucleotides used in study. Name
Sequence (5′–3′)
Ura4F Ura4R1 Uar4R2 Uar4R3 Tbp1/F Tbp1/R1 Tbp1/R2 Tbp1/R3 Tbp1/R4 Tbp1/R5
TCGGCTTGGATGTTAAAGGAG TGCCTTCTGACATAAAACGCC ATTGTGGTAATGTTGTAGGAGC TTCCAACACCAATGTTTATAACC TATGAGCCTGAGTTGTTTCC TTCTCCGGAAAGCTTTTTAAG TCAGCCTCTATAGTTTTCTTG CCTGAAGCTAGAAGATTTAATG AGAACTGTCGATATACGCTC CCTTCTATTAGCGCTATTAAG
2.3. RT-PCR analysis Wild type and mutant strains were grown at 25 °C and shifted at 36 °C for 4 h. RNA was isolated by hot phenol method as described earlier [30]. A total of 1.0 μg RNA was treated with DNase I (NEB) and cDNA synthesis was performed using oligo dT primer (NEB). Reverse-transcribed cDNA products were amplified by PCR using gene specific primers as listed in Table 2. 2.4. Chromosome loss assay The minichromosome Ch16 [31] was introduced into rna14-11 mutant strain using genetic cross. Cultures were grown to mid-log phase in adenine deficient media and then shifted at 36 °C for 15 h. In order to determine the frequency of chromosome loss, samples were collected at 3 h intervals and plated on YEA plates with limiting adenine. The number of red colonies appearing at each time point was counted, and the percent chromosome loss was calculated.
2.2. Construction of rna14 knockout 2.5. Indirect immunofluorescence studies and microscopy The kanMX selectable cassette flanked by 80 base pair upstream and downstream sequences of rna14 was amplified using oligonucleotides listed in Table 2. One-step gene disruption via homologous recombination was performed in a diploid strain as reported earlier [29]. Heterozygous diploid transformants containing rna14 deletion were selected on plates containing 100 μg/ml of G418. Deletion was confirmed with primer pairs spanning the recombination site using wild type rna14 gene as a negative control. Heterozygous diploids were sporulated, and tetrad dissection was performed to check the viability and essentiality of the gene.
Table 1 Strains list. Strain
Genotype
Source
SP6 SH14 SH74 SH73 SH78 NW1580 NW1419 SH270
h− leu1-32 h− leu1-32 rna14-11 ade6-210 h+ leu1-32 ura4D18 rna14-11 ade6-210 h− ura4D18 Chr16 [ade6-216] ade6-210 h+ ura4D18 rna14-11 Chr16 [ade6-216] ade6-210 h− leu1-32 mis12-537 h− leu1-32 ura4DS/E mad2::ura4 ade6-210 h leu1-32 rna14-11 mis12-537 Chr16[ade6-216] ade6-210 h− leu1-32 ura4D18 rna14-11 mad2::ura4 ade6-210 h− leu1-32 rna14-Flag-kanR h− leu1-32 bub1::kanR h leu1-32 ura4D18 rna14-11 bub1::kanR h+/h− leu1−/leu1− ura4D18/ura4D18 rna14+/rna14::kanR ade6-210/216 h− leu1-32 ura4D18 bub1-GFP-ura4+ h leu1-32 ura4D18 rna14-11 bub1-GFP-ura4+
Lab stock This study This study Nancy Walworth This study Nancy Walworth Nancy Walworth This study
SH104 SH202 SH495 SH513 SH528 SH644 SH693
This study This study This study This study This study YGRC This study
Exponentially growing cells were processed for immunofluorescence studies as described earlier [32]. Cells harboring a copy of Rna14-FLAG at its genomic locus were incubated with FLAG antibody (Sigma) for overnight at 4 °C. After washing, the cells were further incubated at room temperature for 4 h with secondary antibody coupled to Texas Red (Invitrogen). DAPI (4′,6-diamidino-2-phenylindole) was used to stain the nuclei; images were captured using a fluorescence microscope and processed using Adobe Photoshop. For nuclear analysis, mid-log phase culture was shifted at 36 °C; samples were collected and fixed with 70% ethanol. Nuclei were stained with DAPI and visualized using a fluorescence microscope. Approximately 200 cells from each sample were analyzed, and the percentage of cells containing aberrant nuclei was counted. For septation index, cells were synchronized in early S phase by treating with 12 mM hydroxyurea (HU) and released at 36 °C, samples were collected at 30 min intervals, fixed with 70% ethanol and stained with calcoflour. At each time point at least 200 cells were examined by microscopy, and the cells containing the septum were counted. 3. Results 3.1. Fission yeast Rna14 has conserved domain architecture Fission yeast Rna14 is a subunit of mRNA cleavage and polyadenylation specificity factor complex and its ortholog in budding yeast has been shown to be required for endonucleotic cleavage and polyadenylation of pre-mRNA. A search using InterPro protein sequence analysis and classification software at EMBL-EBI website identified three tetratricopeptide-like helical domains containing nine HAT (Half a TPR) repeats in fission yeast Rna14 (Fig. 1). Tetratricopeptide repeat
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
191
Fig. 1. Domain architecture of Rna14. Domain architecture of S. pombe Rna14 has the same motif arrangement as S. cerevisiae Rna14 (accession number P25298) and human CstF3 (accession number Q12996). Rna14 was investigated using InterPro protein sequence analysis and classification software at EMBL-EBI website.
(TPR) motif comprises of 3–16 tandem repeats of 34 amino acids that form a helix-turn-helix arrangement with adjacent TPR motif in a parallel fashion leading to a coiled-coil or helical bundle structure [33]. HAT repeats are structurally and sequentially similar to TPR and contain three aromatic residues with conserved spacing but lack the highly conserved alanine and glycine residue found in TPR [34]. The ortholog of Rna14 in budding yeast contains three small tetratricopeptide-like helical domains and 8 HAT repeats while the human ortholog CstF3 contains 10 HAT repeats but lacks TPR domain (Fig. 1). Proteins containing HAT repeats appear to be components of multiprotein complexes that are required for RNA processing [34]. Additionally, these proteins also contain a C-terminus domain (Fig. 1) that is mostly present in the eukaryotic suppressor of fork (suf) like proteins and play an important role in the regulation of poly(A) site utilization [35].
3.2. Rna14 is an essential protein and localizes to the nucleus In order to explore the role of fission yeast Rna14, the open reading frame of rna14 gene was deleted with kanR marker in a diploid strain as described elsewhere [29]. The heterozygous diploids were allowed to sporulate; asci were dissected and allowed to germinate on YEA medium at 25 °C. Only two viable spores grew from each ascus (Fig. 2A). Further observations revealed that all viable segregants were unable to grow on YEA plates containing G418, suggesting that rna14 is essential for the cells, as has been reported in a genome-wide deletion screen [36]. To determine the localization of Rna14, exponentially growing cells expressing FLAG tag Rna14 were fixed and processed for indirect immunoflouresence studies as described in the Materials and methods. Images obtained by fluorescence microscopy clearly show
Fig. 2. Fission yeast rna14 is an essential nuclear protein. A, the heterozygous diploids were dissected onto YEA plate. Colonies resulting from the tetrads dissection were photographed after 4 days of growth at 25 °C. The genotype of the segregants was determined by replica plating. B, cells with an integrated allele of FLAG-tagged Rna14 were grown to mid-log phase, fixed with paraformaldehyde, and immunofluorescence assays were performed using anti-FLAG antibody as described in the Materials and methods. C, indicated strains were grown till mid-log phase at 25 °C, shifted at 36 °C for 6 h, fixed with 70% ethanol and stained with DAPI to visualize nuclei. Arrows indicate defective chromosome segregation or cut phenotype.
192
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
the nuclear localization of Rna14-FLAG (Fig. 2B) which is consistent with the observation reported in S. cerevisiae [37]. 3.3. Rna14 is required for proper chromosome segregation Further to characterize the function of Rna14, we used temperature sensitive rna14-11 mutant strain which was isolated in a genetic screen to identify the genes related to checkpoint function [38,39]. The morphology of rna14-11 mutant cells was observed after shifting them to non-permissive temperature (36 °C). As presented in Fig. 2C, about 18% of the rna14-11 mutant cells exhibited chromosome segregation defects when shifted to the non-permissive temperature for 6 h. In contrast, the wild type cells did not exhibit such segregation defects under the same growth conditions (Fig. 2C, left panel). In order to examine the role of Rna14 in chromosome stability, a nonessential mini-chromosome (Ch16), a derivative of chromosome III was incorporated in rna14-11 mutant cells by genetic manipulation. The trans-complementation of ade6-216 gene present on the minichromosome and ade6-210 gene present on the yeast genome make the strain phenotypically ade+ and white in color. The loss of the mini-chromosome was monitored by growing the cells at restrictive temperature for 6 h (about two generations) and then scoring the number of red colonies produced on plates containing limited concentration of adenine. About 2–3% of rna14-11 mutant cells exhibited chromosome loss as compared to wild-type cells that showed only 0.2% of chromosome loss under the same growth conditions (Fig. 3A and B). The survival of rna14-11 mutant cells was only 30% after 6 h growth at restrictive temperature (Fig. 3C), indicating that the actual chromosome loss could
have been much more. On further incubating the cells at restrictive temperature (12 h), the survival of rna14-11 mutant cells was only 10% (Fig. 3C) and the chromosome loss was about 20% (Fig. 3B), suggesting a correlation between the chromosome segregation defect with the loss of viability.
3.4. Rna14 exhibits genetic interaction with kinetochore protein Mis12 Defective kinetochore function can lead to chromosome segregation defects resulting in “chromosome loss” phenotype. To examine whether Rna14 influences kinetochore function, double mutants of rna14-11 with strains containing a temperature-sensitive mutations allele of mis12 and mis6 [14,15] were constructed. The rna14-11 and mis12-537 double mutant was unable to form colonies at 30 °C as compared to rna14-11 single mutant which was able to grow partly at this temperature (Fig. 4A), indicating that mutation in mis12 gene in rna14-11 background results in a lower restrictive temperature as compared to mis12537 or rna14-11 single mutant. Further, to examine the defects in rna1411 mis12-537 double mutant, we observed the cut phenotype after shifting the cells at restrictive temperature. About 30% rna14-11 mis12-537 double mutant cells exhibit the cut phenotype after shifting at restrictive temperature for 6 h which was significantly higher than rna14-11 (18%) and mis12-537 (5%) single mutants (Fig. 4B and C). Further, the cut phenotype observed in rna14-11 mis12-537 double mutant was 34% after shifting the cells to restrictive temperature for 9 h as compared to 20% and 15% in rna14-11 and mis12-537 single mutant respectively (Fig. 4C).
Fig. 3. Rna14 is required for proper chromosome segregation. Strains were grown in rich YEA media containing adenine till mid-log phase at 25 °C and then shifted at 36 °C for 6 h. Equal numbers of cells were plated on plates with limiting concentration of adenine and incubated at 25 °C for 4 days before taking the photographs. B, indicated strains were grown as describe in the Materials and methods. At each time point, the numbers of red and white colonies were counted and percentage of ade− (red) colonies (as an indicator of chromosome loss) was plotted. Experiment was performed in triplicate and average values are shown with standard deviation. C, in order to assess the cell survival, the total number of colonies appearing at each time point was counted and the percentage was plotted. Values shown are the average of three independent experiments with standard deviation.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
193
Fig. 4. Rna14 exhibits genetic interactions with Mis12. A, indicated strains were grown at 25 °C to mid-log phase. Ten fold serial dilutions were spotted on rich media plates and incubated at the indicated temperatures for 3–4 days before taking the photographs. B, indicated strains were grown at 25 °C till mid-log phase, shifted at 36 °C. The samples were collected at 3 h time interval, and cells were fixed with 70% ethanol and stained with DAPI to visualize nuclei. Arrows indicate the cut phenotype in the samples collected after 6 h shift. C, the number of cells having aberrant mitosis at each time point was counted and the percentage of cut phenotype was plotted. Values shown are the average of three independent experiments.
Fig. 5. Inactivation of spindle checkpoint aggravates the defects in rna14-11 mutant cells. A, indicated strains were grown at 25 °C, serially diluted and spotted on YEA plates. The plates were incubated at indicated temperature for 3–4 days before taking the photographs. B, cells were processed as in Fig. 4B and stained with DAPI. Arrows indicate the cells having cut phenotype. C, at each time point, the number of cells having cut phenotype was counted and the percentage was plotted. Values shown are the average of three independent experiments.
194
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
Fig. 6. Inactivation of Rna14 affects the spindle assembly checkpoint. A, the wild type, rna14-11, bub1Δ, rna14-11 bub1Δ strains were grown at 25 °C. Ten fold serial dilutions were spotted on rich media plates containing different doses of TBZ. The plates were incubated at 25 °C for 4 days before taking the photographs. B, cells carrying Bub1-GFP were grown to mid-log phase before shifting at 36 °C for 6 h, fixed with paraformaldehyde, and immunofluorescence assays were performed using anti-GFP antibody as described in the Materials and methods. C, after shifting the cells at 36 °C, the percentage of cells having Bub1-GFP foci in wild type and rna14-11 mutant background was calculated and plotted. At least 200 cells were counted and standard deviation was calculated based on the results obtained in different microscopic field.
3.5. Abrogation of spindle checkpoint aggravates the defects in rna14-11 mutant cells To examine the influence of Rna14 on progression through mitosis, we studied the genetic interaction with spindle checkpoint proteins. The double mutant of rna14-11 with bub1Δ and mad2Δ resulted in a reduction in the restrictive temperature relative to that observed with the rna14-11 single mutant (Fig. 5A) suggesting that in the absence of spindle checkpoint the rna14-11 mutant cells lose their viability more rapidly. Additionally the double mutant of rna14-11 with bub1Δ exhibited about 29% cut phenotype after shifting the cells to restrictive temperature for 6 h. In comparison, rna14-11 and bub1Δ single mutant cells exhibited 18% and 3.5% cut phenotype respectively under the same growth conditions (Fig. 5B and C). Upon longer incubation at 36 °C (9 h) the cut phenotype in the rna14-11 single mutant increased to 20% while in rna14-11 bub1Δ double mutant it remained constant (about 28%) which could be due to the separation of the daughter cells giving rise one normal looking cells.
3.6. Spindle checkpoint was partially perturbed in rna14-11 mutant cells The genetic interaction between rna14-11 and bub1Δ cells prompted us to assess the effect of rna14-11 mutant in response to microtubule destabilizing agent thiabendazole (TBZ). The cells harboring rna14-11 mutation were mildly sensitive to thiabendazole while the sensitivity of bub1Δ cells was more as compared to rna14-11 single mutant (Fig. 6A). Interestingly the thiabendazole sensitivity of rna14-11 bub1Δ double mutant was more as compared to either of the single mutants (Fig. 6A), suggesting that these two
proteins participate in different pathways to promote survival in response to the microtubule destabilizing agent. In addition we observed a four-fold increase in the number of cells containing Bub1GFP foci in rna14-11 mutant as compared to wild type cells after shifting the cells at restrictive temperature for 6 h (Fig. 6B and C), suggesting that in rna14-11 mutant cells the chromosomal attachment to the mitotic spindle might be defective. These results also correlate well with the chromosomal segregation defects observed in rna14-11 bub1Δ double mutant (Fig. 5B and C).
3.7. Cell cycle progression was defective in rna14-11 mutant cells In order to monitor the cell cycle progression, wild type and rna1411 mutant strains were arrested in early S phase by HU treatment and FACS analysis was performed after releasing the cells at restrictive temperature as described earlier [40]. The wild type cells exhibited a normal cell cycle progression with 2C DNA peak appearing 1 h after the shift (Fig. 7A, left panel). In contrast, the 2C DNA content peak in rna14-11 mutant cells appeared only after 2 h of release at 36 °C (Fig. 7A, right panel) suggesting the mitotic delay in the mutant strain. Interestingly this 2C DNA content peak persists in rna14-11 mutant cells even after 4 h of release at 36 °C (Fig. 7A, right panel). The septation data also revealed normal cell cycle progression in wild type cells after release from HU arrest. In contrast, the appearance of septated cells was slightly delayed in rna14-11 mutant and reaches maximum septation only 180 min after the release which remains constant even after 4 h of release (Fig. 7B). The presence of septated cells with 2C DNA content in rna14-11 mutant strain are consistent with the high percentage of cut phenotype in rna14-11 mutant at restrictive temperature.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
195
3.8. Rna14 is required for the normal 3′-end processing of pre-mRNA Sequence and structure based prediction of Rna14 indicates its role in 3′-end processing of pre-mRNA. To investigate the role of Rna14 in transcription termination, the downstream regions of tbp1+ and uar4+ genes were examined for transcriptional read-through by RTPCR. The steady state tbp1+ transcript extending up to 433 base pair from the stop codon was observed in wild type cells grown at restrictive temperature for 4 h (Fig. 8A, upper panel). In contrast, the tbp1+ transcript was extended up to 685 base pairs from the stop codon in rna14-11 mutant cells grown under the same conditions (Fig. 8A, lower panel) suggesting the involvement of Rna14 during transcription termination. Furthermore, the ura4+ transcript extending up to 391 base pairs from the stop codon was observed in rna14-11 mutant cells (Fig. 8B, lower panel) as compared to the wild type cells that were unable to extend beyond 234 base pairs from the stop codon at restrictive temperature (Fig. 8B, upper panel). Similar defects in read-through of ura4+ transcript have also been reported in pfs2-11 mutant cells that is known to require for the 3′-end processing of pre-mRNA [41]. These data suggest that the Rna14 is required to prevent transcriptional read-through. 4. Discussion In this study, we have demonstrated that inactivation of Rna14 in S. pombe causes chromosome segregation defects that results in high level of chromosome loss. The genetic interaction of Rna14 with kinetochore components and spindle checkpoint protein Bub1 and Mad2 suggests a direct or indirect role of Rna14 in promoting the kinetochore attachment to the mitotic spindle. The accumulation of Bub1-GFP foci upon inactivation of Rna14 could be due to the result of unattached kinetochore as has previously been observed in pfs2 mutant background [41]. In addition rna14-11 mutant cells exhibit mild sensitivity towards thiabendazole (Fig. 6A), and this sensitivity was further exaggerated in the bub1 deletion background suggesting that these proteins participate in distinct pathways to promote survival in response to microtubule destabilizing agent. Consistently, the chromosomal segregation defects and the loss of viability in rna14-11 bub1Δ double mutant were higher than the single mutants at restrictive temperature. These observations suggest that a functional spindle checkpoint response is required for the cells to survive after rna14 inactivation. The persistence of 2C DNA content peak in rna14-11 mutant cells at restrictive temperature with high level of septation (Fig. 7) indicates defect in cell cycle progression that leads to mitotic abnormalities. Fission yeast Rna14 contains similar domain architecture as S. cerevisiae Rna14 and human CstF3. These orthologs contain 8–10 HAT (Half a TPR) repeats and have been reported to require for 3′-end processing of pre-mRNA [18,19,27]. We presented evidence that fission yeast Rna14 is also required for normal transcriptional termination. The inability of rna14-11 mutant to execute mitosis faithfully can be explained in two ways. One possibility is the rna14-11 mutant may have some direct effect on the structure and function of the kinetochore where the mitotic spindle associates and hence affect the chromosome segregation. However, the possibility of impaired expression of the genes required for the proper chromosome segregation in rna14-11 mutant cannot be ruled out. An earlier study has reported the activation of spindle checkpoint in S. cerevisiae due to the mutation in the components of splicing factors [42]. Additionally, the role of RNA processing machinery in chromosome segregation [41], transcription-dependent hyper-recombination [43] and more recently in DNA damage response Fig. 7. Inactivation of Rna14 results defects in cell cycle progression. A, wild type and rna14-11 cells were synchronized in early S phase by treating with 12 mM HU for 4 h at 25 °C, washed and shifted at 36 °C. The cells were harvested at hourly intervals and processed for flow cytometry. B, the cells were synchronized at early S phase and shifted at 36 °C. The samples were collected at 30 min time interval, fixed and stained with calcoflour. The number of cells having septa was counted and percentage septation was plotted.
196
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
Fig. 8. Rna14-11 is required for transcription termination. Wild type and rna14-11 mutant cells were grown at permissive temperature till mid-log phase then shifted at 36 °C for 4 h. RNA was isolated and RT-PCR analysis of downstream region of tbp1+ (A) and uar4+ (B) genes was performed using forward primer located upstream to stop codon and reverse primers located downstream to stop codon as depicted in the schematic diagram (upper panel). The position of stop codon has been marked. Lane C, the negative control in which no reverse transcriptase was added to the RT-PCR reaction. Lane M, size markers.
[44] have also been well reported. Altogether our finding shows a novel role of Rna14 in segregation of chromosome during cell division and also emphasizes the importance of transcription termination in the maintenance of genomic stability through the regulation of kinetochore function in fission yeast S. pombe. Conflict of interest We have no conflict of interest in any part of this article. Acknowledgment We thank Dr. Nancy Walworth and YGRC for providing the strains. We are grateful to Dr. Amir Nazir for fluorescence microscopy. We thank Dr. JV Pratap, Dr. R Ravishankar and Dr. Sabyasachi Sanyal for critical reading of this manuscript and helpful discussion. We also thank Sophisticated Analytical Instrument Facility (SAIF) of CDRI for FACS analysis. This study was supported by a grant from the Department of Science and Technology, India (GAP0124) and Council of Scientific and Industrial Research (BSC0103 and BSC0121), New Delhi, India. The CDRI communication number for this manuscript is 9116. References [1] A. Amon, The spindle checkpoint, Curr. Opin. Genet. Dev. 1 (1999) 69–75. [2] D.J. Lew, D.J. Burke, The spindle assembly and spindle position checkpoints, Annu. Rev. Genet. 37 (2003) 251–282. [3] B.A. Pinsky, S. Biggins, The spindle checkpoint: tension versus attachment, Trends Cell Biol. 15 (2005) 486–493. [4] P. Lara-Gonzalez, F.G. Westhorpe, S.S. Taylor, The spindle assembly checkpoint, Curr. Biol. 22 (2012) R966–R980. [5] D.W. Cleveland, Y. Mao, K.F. Sullivan, Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling, Cell 112 (2003) 407–421. [6] T. Hayashi, Y. Fujita, O. Iwasaki, Y. Adachi, K. Takahashi, M. Yanagida, Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres, Cell 118 (2004) 715–729. [7] C. Obuse, O. Iwasaki, T. Kiyomitsu, G. Goshima, Y. Toyoda, M. Yanagida, A conserved Mis12 centromere complex is linked to heterochromatic HP1 and outer kinetochore protein Zwint-1, Nat. Cell Biol. 6 (2004) 1135–1141. [8] D. Burke, P. Stukenberg, Linking kinetochore microtubule binding to the spindle checkpoint, Dev. Cell 14 (2008) 474–479. [9] E. Foley, T. Kapoor, Microtubule attachment and spindle assembly checkpoint signaling at the kinetochore, Nat. Rev. Mol. Cell Biol. 14 (2013) 25–37. [10] A.L. Pidoux, W. Richardson, R. Allshire, Sim4: a novel fission yeast kinetochore protein required for centromeric silencing and chromosome segregation, J. Cell Biol. 161 (2003) 295–307.
[11] K. Takahashi, E.S. Chen, M. Yanagida, Requirement of Mis6 centromere connector for localizing a CENP-A-like protein in fission yeast, Science 288 (2000) 2215–2219. [12] E.S. Chen, S. Saitoh, M. Yanagida, K. Takahashi, A cell cycle-regulated GATA factor promotes centromeric localization of CENP-A in fission yeast, Mol. Cell 11 (2003) 175–187. [13] S. Saitoh, K. Ishii, Y. Kobayashi, K. Takahashi, Spindle checkpoint signaling requires the mis6 kinetochore subcomplex, which interacts with mad2 and mitotic spindles, Mol. Biol. Cell 16 (2005) 3666–3677. [14] S. Saitoh, K. Takahashi, M. Yanagida, Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation, Cell 90 (1997) 131–143. [15] G. Goshima, S. Saitoh, M. Yanagida, Proper metaphase spindle length is determined by centromere proteins Mis12 and Mis6 required for faithful chromosome segregation, Genes Dev. 13 (1999) 1664–1677. [16] M. Gu, C.D. Lima, Processing the message: structural insights into capping and decapping mRNA, Curr. Opin. Struct. Biol. 15 (2005) 99–106. [17] R. Luna, S. Jimeno, M. Marin, P. Huertas, M. Garcia-Rubio, A. Aquilera, Interdependence between transcription and mRNP processing and export, and its impact on genetic stability, Mol. Cell 18 (2005) 711–722. [18] K. Murthy, J. Manley, The 160 kDa subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA3′-end formation, Genes Dev. 9 (1995) 2672–2683. [19] C.C. MacDonald, J. Wilusz, T. Shenk, The 64-kiloDalton subunit of the CstF polyadenylation factor binds to pre-mRNAs downstream of the cleavage site and influences cleavage site location, Mol. Cell. Biol. 14 (1994) 6647–6654. [20] N. Proudfoot, J. O'Sullivan, Polyadenylation: a tail of two complexes, Curr. Biol. 12 (2002) R855–R857. [21] J. Chen, C. Moore, Separation of factors required for cleavage and polyadenylation of yeast pre-mRNA, Mol. Cell. Biol. 12 (1992) 3470–3481. [22] M. Kessler, J. Zhao, C. Moore, Purification of the Saccharomyces cerevisiae cleavage/ polyadenylation factor I. Separation into two components that are required for both cleavage and polyadenylation of mRNA 3′ ends, J. Biol. Chem. 27 (1996) 27167–27175. [23] S. Millevoi, S. Vagner, Molecular mechanisms of eukaryotic pre-mRNA 3′ end processing regulation, Nucleic Acids Res. 38 (2010) 2757–2774. [24] C. Pancevac, D. Goldstone, A. Ramos, I. Taylor, Structure of the Rna15 RRM–RNA complex reveals the molecular basis of GU specificity in transcriptional 3′-end processing factors, Nucleic Acids Res. 38 (2010) 3119–3132. [25] X. Qu, J. Perez-Canadillas, S. Agrawal, J. de Baecke, H. Cheng, G. Varani, C. Moore, The C-terminal domains of vertebrate CstF-64 and its yeast orthologue Rna15 form a new structure critical for mRNA 3′-end processing, J. Biol. Chem. 283 (2007) 2101–2115. [26] M. Moreno-Morcillo, L. Minvielle-Sebastia, S. Fribourg, C.D. Mackereth, Locked tether formation by cooperative folding of Rna14p monkeytail and Rna15p hinge domains in the yeast CFIA complex, Structure 19 (2011) 534–545. [27] L. Minvielle-Sebastia, P.J. Preker, W. Keller, RNA14 and RNA15 proteins as components of a yeast pre-mRNA 3′-end processing factor, Science 266 (1994) 1702–1705. [28] S. Moreno, A. Klar, P. Nurse, Molecular genetic analysis of fission yeast Schizosaccharomyces pombe, Methods Enzymol. 194 (1991) 93–823. [29] J. Bahler, J.Q. Wu, M.S. Longtine, N.G. Shah, A. McKenzie, Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe, Yeast 14 (1998) 943–951. [30] S. Ahmed, C. Palermo, S. Wan, N. Walworth, A novel protein with similarities to Rb binding protein 2 compensate for the loss of Chk1 function and affects histone modification in fission yeast, Mol. Cell. Biol. 24 (2004) 3660–3666.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197 [31] O. Niwa, T. Matsumoto, M. Yanagida, Construction of a minichromosome by deletion and its mitotic and meiotic behaviour in fission yeast, Mol. Gen. Genet. 203 (1986) 397–405. [32] R. Ranjan, N. Ahamad, S. Ahmed, Fission yeast Drp1 is an essential protein required for recovery from DNA damage and chromosome segregation, DNA Repair 24 (2014) 98–106. [33] L.D. D'Andrea, L. Regan, TPR proteins: the versatile helix, Trends Biochem. Sci. 28 (2003) 655–662. [34] P.J. Preker, W. Keller, The HAT helix a repetitive motif implicated in RNA processing, Trends Biochem. Sci. 23 (1998) 15–16. [35] A. Audibert, M. Simonelig, Autoregulation at the level of mRNA 3′ end formation of the suppressor of forked gene of Drosophila melanogaster is conserved in Drosophila virilis, Proc. Natl Acad. Sci. USA 95 (1998) 14302–14307. [36] D.U. Kim, J. Hayles, D. Kim, V. Wood, H. Park, M. Won, H. Yoo, T. Duhig, M. Nam, G. Palmer, S. Han, L. Jeffery, S. Baek, H. Lee, Y. Shim, et al., Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe, Nat. Biotechnol. 12 (2010) 1308–1323. [37] N. Bonneaud, L. Minvielle-Sebastia, C. Cullin, F. Lacroute, Cellular localization of RNA14p and RNA15p, two yeast proteins involved in mRNA stability, J. Cell Sci. 107 (1994) 913–921. [38] S.K. Verma, R. Ranjan, V. Kumar, M.I. Siddiqi, S. Ahmed, Wat1/pop3, a conserved WD repeat containing protein acts synergistically with checkpoint kinase Chk1
[39]
[40] [41]
[42]
[43]
[44]
197
to maintain genome ploidy in fission yeast S. pombe, PLoS One 9 (2) (2014), e89587. S. Yadav, S. Verma, S. Ahmed, DNA topoisomerase 2 mutant activates DNA damage checkpoint protein kinase Chk1 in fission yeast S. pombe, Genet. Res. 93 (2011) 275–283. S. Khan, S. Ahmed, Role of swi7H4 mutant allele of DNA polymerase α in the DNA damage checkpoint response, PLoS One 10 (2015), e0124063. S. Wang, K. Asakawa, T. Win, T. Toda, C. Norbury, Inactivation of the pre-mRNA cleavage and polyadenylation factor Pfs2 in fission yeast causes lethal cell cycle defects, Mol. Cell. Biol. 25 (2005) 2288–2296. O. Dahan, M. Kupiec, Mutations in genes of Saccharomyces cerevisiae encoding premRNA splicing factors cause cell cycle arrest through activation of the spindle checkpoint, Nucleic Acids Res. 30 (2002) 4361–4370. R. Luna, S. Jimeno, M. Marin, P. Huertas, M. Garcia-Rubio, A. Aguilera, Interdependence between transcription and mRNP processing and export, and its impact on genetic stability, Mol. Cell 18 (2005) 711–722. H. Gaillard, A. Aguilera, Cleavage factor I links transcription termination to DNA damage response and genome integrity maintenance in Saccharomyces cerevisiae, PLoS Genet. 10 (3) (2014), e1004203.
Contents lists available at ScienceDirect
Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr
Cleavage and polyadenylation factor, Rna14 is an essential protein required for the maintenance of genomic integrity in fission yeast Schizosaccharomyces pombe Amit Sonkar, Sudhanshu Yadav 1, Shakil Ahmed ⁎ Molecular and Structural Biology Division, CSIR-Central Drug Research Institute, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow 226031, India
a r t i c l e
i n f o
Article history: Received 16 September 2015 Received in revised form 28 October 2015 Accepted 11 November 2015 Available online 12 November 2015 Keywords: S. pombe Rna14 Bub1 Checkpoint Transcription termination
a b s t r a c t Faithful segregation of chromosomes is essential for the maintenance of genome integrity. In a genetic screen to identify genes related to checkpoint function, we have characterized the role of rna14, an essential gene in the maintenance of chromosome dynamics. We demonstrate that Rna14 localizes in the nucleus and in the absence of functional Rna14, the cells exhibit chromosomal segregation defects. The mutant allele of rna14 exhibits genetic interaction with key kinetochore components and spindle checkpoint proteins. Inactivation of rna14 leads to accumulation of Bub1-GFP foci, a protein required for spindle checkpoint activation that could be due to the defects in the attachment of mitotic spindle to the chromosome. Consistently, the double mutant of rna14-11 and bub1 knockout exhibits high degree of chromosome mis-segregation. At restrictive condition, the rna14-11 mutant cells exhibit defects in cell cycle progression with high level of septation. The orthologs of Rna14 in Saccharomyces cerevisiae (sc Rna14) and human (CstF3) contain similar domain architecture and are required for 3′-end processing of pre-mRNA. We have also demonstrated that the fission yeast Rna14 is required to prevent transcriptional read-through. These findings reveal the importance of transcription termination in the maintenance of genomic stability through the regulation of kinetochore function. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The faithful segregation of chromosomes is essential for cell viability. Mitosis with abnormal chromosome segregation can lead to aneuploidy, a hallmark of cancer and several congenital diseases. Proper chromosomal segregation is achieved by the spindle assembly checkpoint (SAC) pathway which is a conserved surveillance mechanism that arrests cells in mitosis in response to defective spindle [1]. Lack of tension on kinetochore or unattached kinetochore activates the spindle checkpoint and prevents the anaphase onset, exit from mitosis and initiation of cytokinesis [2,3]. The mitotic checkpoint complex (MCC) comprises of BubR1, Bub3, Mad1, Mad2, Mps1 and Cdc20 proteins that inhibit the anaphase-promoting complex/cyclosome (APC/C), a large complex containing E3 ubiquitin ligase required for anaphase onset [4]. Kinetochore, a specialized protein structure within the centromeric region is required for the attachment of spindle microtubules to the chromosomes [5]. The integrity of the centromeric chromatin and the proteins associated with kinetochore structure play an important role in maintaining chromosome stability. Mis12 is an evolutionarily ⁎ Corresponding author. E-mail address: [email protected] (S. Ahmed). 1 Present address: Department of Immunology & Genomic Medicine, Kyoto University, Japan.
http://dx.doi.org/10.1016/j.bbamcr.2015.11.007 0167-4889/© 2015 Elsevier B.V. All rights reserved.
conserved kinetochore protein that forms a complex with Mis13 and Mis14 [6,7]. The KMN complex, containing Knl1–Mis12–Ndc80 proteins provides the core binding site within the kinetochore required for the microtubule attachment [8,9]. Mis6, another kinetochore protein form a complex with Mis15, Mis17, and Sim4 promoting the loading of CENP-A to the centromere [10–12]. Mis6 has also been reported for the loading of the mitotic spindle checkpoint protein Mad2 at the kinetochore [13]. In fission yeast, the mutation in the components of kinetochore complex leads to unequal chromosome segregation [14,15]. After transcription by RNA polymerase II, post-transcriptional modifications are required to convert nascent RNA into mature RNA. These modifications include the addition of the 5′ cap, splicing, 3′ end cleavage and polyadenylation. Precise action of these modification steps plays important roles in the stabilization of RNA, export from the nucleus, and translation stimulation [16,17]. In eukaryotic cells, a multi-subunit protein complex is responsible for 3′ end processing. This complex includes cleavage and polyadenylation factor (CPSF) and cleavage stimulating factor (CstF) which are conserved in different eukaryotes [18–20]. Four distinct factors have been identified in Saccharomyces cerevisiae that are essential for cleavage and polyadenylation. These include cleavage factor I (CF I), CF II, polyadenylation factor I (PF I) and poly A polymerase I (PAP I) [21]. CFIA subunit of CFI contains Rna14, Rna15, Pcf11 and Clp1 while PFI subunit consists of many proteins including Fip1, Pcf11, Psf1, Psf2, Yth1, etc. [22,23]. Rna15 contains an RNA recognition
190
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
module (RRM) at the N-terminus [24], followed by a hinge region and a C-terminal domain (CTD), which interacts with Pcf11 [25] while the hinge region interacts with the C-terminal region of Rna14 [26]. S. cerevisiae Rna14 contains several Half-A-TPR (HAT) repeats and is essential for 3′ end processing [27]. Cleavage and polyadenylation defects can lead to transcription beyond the normal termination region, potentially disrupting the functions of genes and downstream pathways. In this study, we have described the role of Rna14, a cleavage and polyadenylation factor during cell cycle progression. We have demonstrated that the inactivation of Rna14 in fission yeast causes chromosome segregation defects that result in high level of chromosome loss. We present evidence that a functional spindle checkpoint response is required for the cells to survive after rna14 inactivation. These findings indicate the importance of transcription termination for the maintenance of genomic stability.
2. Materials and methods 2.1. Yeast strains and media Schizosaccharomyces pombe strains used in this study are listed in Table 1. We have utilized standard genetic methods for the construction of strains [28]. For temperature shift experiments, cells were grown at 25 °C and shifted to restrictive temperature of 36 °C unless otherwise indicated. For survival assays, samples were collected, and the equal number of cells from each sample was plated on YEA plates. The plates were incubated at permissive temperature; the number of surviving colonies was counted, and graph was plotted. For serial dilution assays, 107 cells were serially diluted, spotted on YEA plates and incubated at indicated temperature for 3–4 days.
Table 2 Oligonucleotides used in study. Name
Sequence (5′–3′)
Ura4F Ura4R1 Uar4R2 Uar4R3 Tbp1/F Tbp1/R1 Tbp1/R2 Tbp1/R3 Tbp1/R4 Tbp1/R5
TCGGCTTGGATGTTAAAGGAG TGCCTTCTGACATAAAACGCC ATTGTGGTAATGTTGTAGGAGC TTCCAACACCAATGTTTATAACC TATGAGCCTGAGTTGTTTCC TTCTCCGGAAAGCTTTTTAAG TCAGCCTCTATAGTTTTCTTG CCTGAAGCTAGAAGATTTAATG AGAACTGTCGATATACGCTC CCTTCTATTAGCGCTATTAAG
2.3. RT-PCR analysis Wild type and mutant strains were grown at 25 °C and shifted at 36 °C for 4 h. RNA was isolated by hot phenol method as described earlier [30]. A total of 1.0 μg RNA was treated with DNase I (NEB) and cDNA synthesis was performed using oligo dT primer (NEB). Reverse-transcribed cDNA products were amplified by PCR using gene specific primers as listed in Table 2. 2.4. Chromosome loss assay The minichromosome Ch16 [31] was introduced into rna14-11 mutant strain using genetic cross. Cultures were grown to mid-log phase in adenine deficient media and then shifted at 36 °C for 15 h. In order to determine the frequency of chromosome loss, samples were collected at 3 h intervals and plated on YEA plates with limiting adenine. The number of red colonies appearing at each time point was counted, and the percent chromosome loss was calculated.
2.2. Construction of rna14 knockout 2.5. Indirect immunofluorescence studies and microscopy The kanMX selectable cassette flanked by 80 base pair upstream and downstream sequences of rna14 was amplified using oligonucleotides listed in Table 2. One-step gene disruption via homologous recombination was performed in a diploid strain as reported earlier [29]. Heterozygous diploid transformants containing rna14 deletion were selected on plates containing 100 μg/ml of G418. Deletion was confirmed with primer pairs spanning the recombination site using wild type rna14 gene as a negative control. Heterozygous diploids were sporulated, and tetrad dissection was performed to check the viability and essentiality of the gene.
Table 1 Strains list. Strain
Genotype
Source
SP6 SH14 SH74 SH73 SH78 NW1580 NW1419 SH270
h− leu1-32 h− leu1-32 rna14-11 ade6-210 h+ leu1-32 ura4D18 rna14-11 ade6-210 h− ura4D18 Chr16 [ade6-216] ade6-210 h+ ura4D18 rna14-11 Chr16 [ade6-216] ade6-210 h− leu1-32 mis12-537 h− leu1-32 ura4DS/E mad2::ura4 ade6-210 h leu1-32 rna14-11 mis12-537 Chr16[ade6-216] ade6-210 h− leu1-32 ura4D18 rna14-11 mad2::ura4 ade6-210 h− leu1-32 rna14-Flag-kanR h− leu1-32 bub1::kanR h leu1-32 ura4D18 rna14-11 bub1::kanR h+/h− leu1−/leu1− ura4D18/ura4D18 rna14+/rna14::kanR ade6-210/216 h− leu1-32 ura4D18 bub1-GFP-ura4+ h leu1-32 ura4D18 rna14-11 bub1-GFP-ura4+
Lab stock This study This study Nancy Walworth This study Nancy Walworth Nancy Walworth This study
SH104 SH202 SH495 SH513 SH528 SH644 SH693
This study This study This study This study This study YGRC This study
Exponentially growing cells were processed for immunofluorescence studies as described earlier [32]. Cells harboring a copy of Rna14-FLAG at its genomic locus were incubated with FLAG antibody (Sigma) for overnight at 4 °C. After washing, the cells were further incubated at room temperature for 4 h with secondary antibody coupled to Texas Red (Invitrogen). DAPI (4′,6-diamidino-2-phenylindole) was used to stain the nuclei; images were captured using a fluorescence microscope and processed using Adobe Photoshop. For nuclear analysis, mid-log phase culture was shifted at 36 °C; samples were collected and fixed with 70% ethanol. Nuclei were stained with DAPI and visualized using a fluorescence microscope. Approximately 200 cells from each sample were analyzed, and the percentage of cells containing aberrant nuclei was counted. For septation index, cells were synchronized in early S phase by treating with 12 mM hydroxyurea (HU) and released at 36 °C, samples were collected at 30 min intervals, fixed with 70% ethanol and stained with calcoflour. At each time point at least 200 cells were examined by microscopy, and the cells containing the septum were counted. 3. Results 3.1. Fission yeast Rna14 has conserved domain architecture Fission yeast Rna14 is a subunit of mRNA cleavage and polyadenylation specificity factor complex and its ortholog in budding yeast has been shown to be required for endonucleotic cleavage and polyadenylation of pre-mRNA. A search using InterPro protein sequence analysis and classification software at EMBL-EBI website identified three tetratricopeptide-like helical domains containing nine HAT (Half a TPR) repeats in fission yeast Rna14 (Fig. 1). Tetratricopeptide repeat
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
191
Fig. 1. Domain architecture of Rna14. Domain architecture of S. pombe Rna14 has the same motif arrangement as S. cerevisiae Rna14 (accession number P25298) and human CstF3 (accession number Q12996). Rna14 was investigated using InterPro protein sequence analysis and classification software at EMBL-EBI website.
(TPR) motif comprises of 3–16 tandem repeats of 34 amino acids that form a helix-turn-helix arrangement with adjacent TPR motif in a parallel fashion leading to a coiled-coil or helical bundle structure [33]. HAT repeats are structurally and sequentially similar to TPR and contain three aromatic residues with conserved spacing but lack the highly conserved alanine and glycine residue found in TPR [34]. The ortholog of Rna14 in budding yeast contains three small tetratricopeptide-like helical domains and 8 HAT repeats while the human ortholog CstF3 contains 10 HAT repeats but lacks TPR domain (Fig. 1). Proteins containing HAT repeats appear to be components of multiprotein complexes that are required for RNA processing [34]. Additionally, these proteins also contain a C-terminus domain (Fig. 1) that is mostly present in the eukaryotic suppressor of fork (suf) like proteins and play an important role in the regulation of poly(A) site utilization [35].
3.2. Rna14 is an essential protein and localizes to the nucleus In order to explore the role of fission yeast Rna14, the open reading frame of rna14 gene was deleted with kanR marker in a diploid strain as described elsewhere [29]. The heterozygous diploids were allowed to sporulate; asci were dissected and allowed to germinate on YEA medium at 25 °C. Only two viable spores grew from each ascus (Fig. 2A). Further observations revealed that all viable segregants were unable to grow on YEA plates containing G418, suggesting that rna14 is essential for the cells, as has been reported in a genome-wide deletion screen [36]. To determine the localization of Rna14, exponentially growing cells expressing FLAG tag Rna14 were fixed and processed for indirect immunoflouresence studies as described in the Materials and methods. Images obtained by fluorescence microscopy clearly show
Fig. 2. Fission yeast rna14 is an essential nuclear protein. A, the heterozygous diploids were dissected onto YEA plate. Colonies resulting from the tetrads dissection were photographed after 4 days of growth at 25 °C. The genotype of the segregants was determined by replica plating. B, cells with an integrated allele of FLAG-tagged Rna14 were grown to mid-log phase, fixed with paraformaldehyde, and immunofluorescence assays were performed using anti-FLAG antibody as described in the Materials and methods. C, indicated strains were grown till mid-log phase at 25 °C, shifted at 36 °C for 6 h, fixed with 70% ethanol and stained with DAPI to visualize nuclei. Arrows indicate defective chromosome segregation or cut phenotype.
192
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
the nuclear localization of Rna14-FLAG (Fig. 2B) which is consistent with the observation reported in S. cerevisiae [37]. 3.3. Rna14 is required for proper chromosome segregation Further to characterize the function of Rna14, we used temperature sensitive rna14-11 mutant strain which was isolated in a genetic screen to identify the genes related to checkpoint function [38,39]. The morphology of rna14-11 mutant cells was observed after shifting them to non-permissive temperature (36 °C). As presented in Fig. 2C, about 18% of the rna14-11 mutant cells exhibited chromosome segregation defects when shifted to the non-permissive temperature for 6 h. In contrast, the wild type cells did not exhibit such segregation defects under the same growth conditions (Fig. 2C, left panel). In order to examine the role of Rna14 in chromosome stability, a nonessential mini-chromosome (Ch16), a derivative of chromosome III was incorporated in rna14-11 mutant cells by genetic manipulation. The trans-complementation of ade6-216 gene present on the minichromosome and ade6-210 gene present on the yeast genome make the strain phenotypically ade+ and white in color. The loss of the mini-chromosome was monitored by growing the cells at restrictive temperature for 6 h (about two generations) and then scoring the number of red colonies produced on plates containing limited concentration of adenine. About 2–3% of rna14-11 mutant cells exhibited chromosome loss as compared to wild-type cells that showed only 0.2% of chromosome loss under the same growth conditions (Fig. 3A and B). The survival of rna14-11 mutant cells was only 30% after 6 h growth at restrictive temperature (Fig. 3C), indicating that the actual chromosome loss could
have been much more. On further incubating the cells at restrictive temperature (12 h), the survival of rna14-11 mutant cells was only 10% (Fig. 3C) and the chromosome loss was about 20% (Fig. 3B), suggesting a correlation between the chromosome segregation defect with the loss of viability.
3.4. Rna14 exhibits genetic interaction with kinetochore protein Mis12 Defective kinetochore function can lead to chromosome segregation defects resulting in “chromosome loss” phenotype. To examine whether Rna14 influences kinetochore function, double mutants of rna14-11 with strains containing a temperature-sensitive mutations allele of mis12 and mis6 [14,15] were constructed. The rna14-11 and mis12-537 double mutant was unable to form colonies at 30 °C as compared to rna14-11 single mutant which was able to grow partly at this temperature (Fig. 4A), indicating that mutation in mis12 gene in rna14-11 background results in a lower restrictive temperature as compared to mis12537 or rna14-11 single mutant. Further, to examine the defects in rna1411 mis12-537 double mutant, we observed the cut phenotype after shifting the cells at restrictive temperature. About 30% rna14-11 mis12-537 double mutant cells exhibit the cut phenotype after shifting at restrictive temperature for 6 h which was significantly higher than rna14-11 (18%) and mis12-537 (5%) single mutants (Fig. 4B and C). Further, the cut phenotype observed in rna14-11 mis12-537 double mutant was 34% after shifting the cells to restrictive temperature for 9 h as compared to 20% and 15% in rna14-11 and mis12-537 single mutant respectively (Fig. 4C).
Fig. 3. Rna14 is required for proper chromosome segregation. Strains were grown in rich YEA media containing adenine till mid-log phase at 25 °C and then shifted at 36 °C for 6 h. Equal numbers of cells were plated on plates with limiting concentration of adenine and incubated at 25 °C for 4 days before taking the photographs. B, indicated strains were grown as describe in the Materials and methods. At each time point, the numbers of red and white colonies were counted and percentage of ade− (red) colonies (as an indicator of chromosome loss) was plotted. Experiment was performed in triplicate and average values are shown with standard deviation. C, in order to assess the cell survival, the total number of colonies appearing at each time point was counted and the percentage was plotted. Values shown are the average of three independent experiments with standard deviation.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
193
Fig. 4. Rna14 exhibits genetic interactions with Mis12. A, indicated strains were grown at 25 °C to mid-log phase. Ten fold serial dilutions were spotted on rich media plates and incubated at the indicated temperatures for 3–4 days before taking the photographs. B, indicated strains were grown at 25 °C till mid-log phase, shifted at 36 °C. The samples were collected at 3 h time interval, and cells were fixed with 70% ethanol and stained with DAPI to visualize nuclei. Arrows indicate the cut phenotype in the samples collected after 6 h shift. C, the number of cells having aberrant mitosis at each time point was counted and the percentage of cut phenotype was plotted. Values shown are the average of three independent experiments.
Fig. 5. Inactivation of spindle checkpoint aggravates the defects in rna14-11 mutant cells. A, indicated strains were grown at 25 °C, serially diluted and spotted on YEA plates. The plates were incubated at indicated temperature for 3–4 days before taking the photographs. B, cells were processed as in Fig. 4B and stained with DAPI. Arrows indicate the cells having cut phenotype. C, at each time point, the number of cells having cut phenotype was counted and the percentage was plotted. Values shown are the average of three independent experiments.
194
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
Fig. 6. Inactivation of Rna14 affects the spindle assembly checkpoint. A, the wild type, rna14-11, bub1Δ, rna14-11 bub1Δ strains were grown at 25 °C. Ten fold serial dilutions were spotted on rich media plates containing different doses of TBZ. The plates were incubated at 25 °C for 4 days before taking the photographs. B, cells carrying Bub1-GFP were grown to mid-log phase before shifting at 36 °C for 6 h, fixed with paraformaldehyde, and immunofluorescence assays were performed using anti-GFP antibody as described in the Materials and methods. C, after shifting the cells at 36 °C, the percentage of cells having Bub1-GFP foci in wild type and rna14-11 mutant background was calculated and plotted. At least 200 cells were counted and standard deviation was calculated based on the results obtained in different microscopic field.
3.5. Abrogation of spindle checkpoint aggravates the defects in rna14-11 mutant cells To examine the influence of Rna14 on progression through mitosis, we studied the genetic interaction with spindle checkpoint proteins. The double mutant of rna14-11 with bub1Δ and mad2Δ resulted in a reduction in the restrictive temperature relative to that observed with the rna14-11 single mutant (Fig. 5A) suggesting that in the absence of spindle checkpoint the rna14-11 mutant cells lose their viability more rapidly. Additionally the double mutant of rna14-11 with bub1Δ exhibited about 29% cut phenotype after shifting the cells to restrictive temperature for 6 h. In comparison, rna14-11 and bub1Δ single mutant cells exhibited 18% and 3.5% cut phenotype respectively under the same growth conditions (Fig. 5B and C). Upon longer incubation at 36 °C (9 h) the cut phenotype in the rna14-11 single mutant increased to 20% while in rna14-11 bub1Δ double mutant it remained constant (about 28%) which could be due to the separation of the daughter cells giving rise one normal looking cells.
3.6. Spindle checkpoint was partially perturbed in rna14-11 mutant cells The genetic interaction between rna14-11 and bub1Δ cells prompted us to assess the effect of rna14-11 mutant in response to microtubule destabilizing agent thiabendazole (TBZ). The cells harboring rna14-11 mutation were mildly sensitive to thiabendazole while the sensitivity of bub1Δ cells was more as compared to rna14-11 single mutant (Fig. 6A). Interestingly the thiabendazole sensitivity of rna14-11 bub1Δ double mutant was more as compared to either of the single mutants (Fig. 6A), suggesting that these two
proteins participate in different pathways to promote survival in response to the microtubule destabilizing agent. In addition we observed a four-fold increase in the number of cells containing Bub1GFP foci in rna14-11 mutant as compared to wild type cells after shifting the cells at restrictive temperature for 6 h (Fig. 6B and C), suggesting that in rna14-11 mutant cells the chromosomal attachment to the mitotic spindle might be defective. These results also correlate well with the chromosomal segregation defects observed in rna14-11 bub1Δ double mutant (Fig. 5B and C).
3.7. Cell cycle progression was defective in rna14-11 mutant cells In order to monitor the cell cycle progression, wild type and rna1411 mutant strains were arrested in early S phase by HU treatment and FACS analysis was performed after releasing the cells at restrictive temperature as described earlier [40]. The wild type cells exhibited a normal cell cycle progression with 2C DNA peak appearing 1 h after the shift (Fig. 7A, left panel). In contrast, the 2C DNA content peak in rna14-11 mutant cells appeared only after 2 h of release at 36 °C (Fig. 7A, right panel) suggesting the mitotic delay in the mutant strain. Interestingly this 2C DNA content peak persists in rna14-11 mutant cells even after 4 h of release at 36 °C (Fig. 7A, right panel). The septation data also revealed normal cell cycle progression in wild type cells after release from HU arrest. In contrast, the appearance of septated cells was slightly delayed in rna14-11 mutant and reaches maximum septation only 180 min after the release which remains constant even after 4 h of release (Fig. 7B). The presence of septated cells with 2C DNA content in rna14-11 mutant strain are consistent with the high percentage of cut phenotype in rna14-11 mutant at restrictive temperature.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
195
3.8. Rna14 is required for the normal 3′-end processing of pre-mRNA Sequence and structure based prediction of Rna14 indicates its role in 3′-end processing of pre-mRNA. To investigate the role of Rna14 in transcription termination, the downstream regions of tbp1+ and uar4+ genes were examined for transcriptional read-through by RTPCR. The steady state tbp1+ transcript extending up to 433 base pair from the stop codon was observed in wild type cells grown at restrictive temperature for 4 h (Fig. 8A, upper panel). In contrast, the tbp1+ transcript was extended up to 685 base pairs from the stop codon in rna14-11 mutant cells grown under the same conditions (Fig. 8A, lower panel) suggesting the involvement of Rna14 during transcription termination. Furthermore, the ura4+ transcript extending up to 391 base pairs from the stop codon was observed in rna14-11 mutant cells (Fig. 8B, lower panel) as compared to the wild type cells that were unable to extend beyond 234 base pairs from the stop codon at restrictive temperature (Fig. 8B, upper panel). Similar defects in read-through of ura4+ transcript have also been reported in pfs2-11 mutant cells that is known to require for the 3′-end processing of pre-mRNA [41]. These data suggest that the Rna14 is required to prevent transcriptional read-through. 4. Discussion In this study, we have demonstrated that inactivation of Rna14 in S. pombe causes chromosome segregation defects that results in high level of chromosome loss. The genetic interaction of Rna14 with kinetochore components and spindle checkpoint protein Bub1 and Mad2 suggests a direct or indirect role of Rna14 in promoting the kinetochore attachment to the mitotic spindle. The accumulation of Bub1-GFP foci upon inactivation of Rna14 could be due to the result of unattached kinetochore as has previously been observed in pfs2 mutant background [41]. In addition rna14-11 mutant cells exhibit mild sensitivity towards thiabendazole (Fig. 6A), and this sensitivity was further exaggerated in the bub1 deletion background suggesting that these proteins participate in distinct pathways to promote survival in response to microtubule destabilizing agent. Consistently, the chromosomal segregation defects and the loss of viability in rna14-11 bub1Δ double mutant were higher than the single mutants at restrictive temperature. These observations suggest that a functional spindle checkpoint response is required for the cells to survive after rna14 inactivation. The persistence of 2C DNA content peak in rna14-11 mutant cells at restrictive temperature with high level of septation (Fig. 7) indicates defect in cell cycle progression that leads to mitotic abnormalities. Fission yeast Rna14 contains similar domain architecture as S. cerevisiae Rna14 and human CstF3. These orthologs contain 8–10 HAT (Half a TPR) repeats and have been reported to require for 3′-end processing of pre-mRNA [18,19,27]. We presented evidence that fission yeast Rna14 is also required for normal transcriptional termination. The inability of rna14-11 mutant to execute mitosis faithfully can be explained in two ways. One possibility is the rna14-11 mutant may have some direct effect on the structure and function of the kinetochore where the mitotic spindle associates and hence affect the chromosome segregation. However, the possibility of impaired expression of the genes required for the proper chromosome segregation in rna14-11 mutant cannot be ruled out. An earlier study has reported the activation of spindle checkpoint in S. cerevisiae due to the mutation in the components of splicing factors [42]. Additionally, the role of RNA processing machinery in chromosome segregation [41], transcription-dependent hyper-recombination [43] and more recently in DNA damage response Fig. 7. Inactivation of Rna14 results defects in cell cycle progression. A, wild type and rna14-11 cells were synchronized in early S phase by treating with 12 mM HU for 4 h at 25 °C, washed and shifted at 36 °C. The cells were harvested at hourly intervals and processed for flow cytometry. B, the cells were synchronized at early S phase and shifted at 36 °C. The samples were collected at 30 min time interval, fixed and stained with calcoflour. The number of cells having septa was counted and percentage septation was plotted.
196
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197
Fig. 8. Rna14-11 is required for transcription termination. Wild type and rna14-11 mutant cells were grown at permissive temperature till mid-log phase then shifted at 36 °C for 4 h. RNA was isolated and RT-PCR analysis of downstream region of tbp1+ (A) and uar4+ (B) genes was performed using forward primer located upstream to stop codon and reverse primers located downstream to stop codon as depicted in the schematic diagram (upper panel). The position of stop codon has been marked. Lane C, the negative control in which no reverse transcriptase was added to the RT-PCR reaction. Lane M, size markers.
[44] have also been well reported. Altogether our finding shows a novel role of Rna14 in segregation of chromosome during cell division and also emphasizes the importance of transcription termination in the maintenance of genomic stability through the regulation of kinetochore function in fission yeast S. pombe. Conflict of interest We have no conflict of interest in any part of this article. Acknowledgment We thank Dr. Nancy Walworth and YGRC for providing the strains. We are grateful to Dr. Amir Nazir for fluorescence microscopy. We thank Dr. JV Pratap, Dr. R Ravishankar and Dr. Sabyasachi Sanyal for critical reading of this manuscript and helpful discussion. We also thank Sophisticated Analytical Instrument Facility (SAIF) of CDRI for FACS analysis. This study was supported by a grant from the Department of Science and Technology, India (GAP0124) and Council of Scientific and Industrial Research (BSC0103 and BSC0121), New Delhi, India. The CDRI communication number for this manuscript is 9116. References [1] A. Amon, The spindle checkpoint, Curr. Opin. Genet. Dev. 1 (1999) 69–75. [2] D.J. Lew, D.J. Burke, The spindle assembly and spindle position checkpoints, Annu. Rev. Genet. 37 (2003) 251–282. [3] B.A. Pinsky, S. Biggins, The spindle checkpoint: tension versus attachment, Trends Cell Biol. 15 (2005) 486–493. [4] P. Lara-Gonzalez, F.G. Westhorpe, S.S. Taylor, The spindle assembly checkpoint, Curr. Biol. 22 (2012) R966–R980. [5] D.W. Cleveland, Y. Mao, K.F. Sullivan, Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling, Cell 112 (2003) 407–421. [6] T. Hayashi, Y. Fujita, O. Iwasaki, Y. Adachi, K. Takahashi, M. Yanagida, Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres, Cell 118 (2004) 715–729. [7] C. Obuse, O. Iwasaki, T. Kiyomitsu, G. Goshima, Y. Toyoda, M. Yanagida, A conserved Mis12 centromere complex is linked to heterochromatic HP1 and outer kinetochore protein Zwint-1, Nat. Cell Biol. 6 (2004) 1135–1141. [8] D. Burke, P. Stukenberg, Linking kinetochore microtubule binding to the spindle checkpoint, Dev. Cell 14 (2008) 474–479. [9] E. Foley, T. Kapoor, Microtubule attachment and spindle assembly checkpoint signaling at the kinetochore, Nat. Rev. Mol. Cell Biol. 14 (2013) 25–37. [10] A.L. Pidoux, W. Richardson, R. Allshire, Sim4: a novel fission yeast kinetochore protein required for centromeric silencing and chromosome segregation, J. Cell Biol. 161 (2003) 295–307.
[11] K. Takahashi, E.S. Chen, M. Yanagida, Requirement of Mis6 centromere connector for localizing a CENP-A-like protein in fission yeast, Science 288 (2000) 2215–2219. [12] E.S. Chen, S. Saitoh, M. Yanagida, K. Takahashi, A cell cycle-regulated GATA factor promotes centromeric localization of CENP-A in fission yeast, Mol. Cell 11 (2003) 175–187. [13] S. Saitoh, K. Ishii, Y. Kobayashi, K. Takahashi, Spindle checkpoint signaling requires the mis6 kinetochore subcomplex, which interacts with mad2 and mitotic spindles, Mol. Biol. Cell 16 (2005) 3666–3677. [14] S. Saitoh, K. Takahashi, M. Yanagida, Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation, Cell 90 (1997) 131–143. [15] G. Goshima, S. Saitoh, M. Yanagida, Proper metaphase spindle length is determined by centromere proteins Mis12 and Mis6 required for faithful chromosome segregation, Genes Dev. 13 (1999) 1664–1677. [16] M. Gu, C.D. Lima, Processing the message: structural insights into capping and decapping mRNA, Curr. Opin. Struct. Biol. 15 (2005) 99–106. [17] R. Luna, S. Jimeno, M. Marin, P. Huertas, M. Garcia-Rubio, A. Aquilera, Interdependence between transcription and mRNP processing and export, and its impact on genetic stability, Mol. Cell 18 (2005) 711–722. [18] K. Murthy, J. Manley, The 160 kDa subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA3′-end formation, Genes Dev. 9 (1995) 2672–2683. [19] C.C. MacDonald, J. Wilusz, T. Shenk, The 64-kiloDalton subunit of the CstF polyadenylation factor binds to pre-mRNAs downstream of the cleavage site and influences cleavage site location, Mol. Cell. Biol. 14 (1994) 6647–6654. [20] N. Proudfoot, J. O'Sullivan, Polyadenylation: a tail of two complexes, Curr. Biol. 12 (2002) R855–R857. [21] J. Chen, C. Moore, Separation of factors required for cleavage and polyadenylation of yeast pre-mRNA, Mol. Cell. Biol. 12 (1992) 3470–3481. [22] M. Kessler, J. Zhao, C. Moore, Purification of the Saccharomyces cerevisiae cleavage/ polyadenylation factor I. Separation into two components that are required for both cleavage and polyadenylation of mRNA 3′ ends, J. Biol. Chem. 27 (1996) 27167–27175. [23] S. Millevoi, S. Vagner, Molecular mechanisms of eukaryotic pre-mRNA 3′ end processing regulation, Nucleic Acids Res. 38 (2010) 2757–2774. [24] C. Pancevac, D. Goldstone, A. Ramos, I. Taylor, Structure of the Rna15 RRM–RNA complex reveals the molecular basis of GU specificity in transcriptional 3′-end processing factors, Nucleic Acids Res. 38 (2010) 3119–3132. [25] X. Qu, J. Perez-Canadillas, S. Agrawal, J. de Baecke, H. Cheng, G. Varani, C. Moore, The C-terminal domains of vertebrate CstF-64 and its yeast orthologue Rna15 form a new structure critical for mRNA 3′-end processing, J. Biol. Chem. 283 (2007) 2101–2115. [26] M. Moreno-Morcillo, L. Minvielle-Sebastia, S. Fribourg, C.D. Mackereth, Locked tether formation by cooperative folding of Rna14p monkeytail and Rna15p hinge domains in the yeast CFIA complex, Structure 19 (2011) 534–545. [27] L. Minvielle-Sebastia, P.J. Preker, W. Keller, RNA14 and RNA15 proteins as components of a yeast pre-mRNA 3′-end processing factor, Science 266 (1994) 1702–1705. [28] S. Moreno, A. Klar, P. Nurse, Molecular genetic analysis of fission yeast Schizosaccharomyces pombe, Methods Enzymol. 194 (1991) 93–823. [29] J. Bahler, J.Q. Wu, M.S. Longtine, N.G. Shah, A. McKenzie, Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe, Yeast 14 (1998) 943–951. [30] S. Ahmed, C. Palermo, S. Wan, N. Walworth, A novel protein with similarities to Rb binding protein 2 compensate for the loss of Chk1 function and affects histone modification in fission yeast, Mol. Cell. Biol. 24 (2004) 3660–3666.
A. Sonkar et al. / Biochimica et Biophysica Acta 1863 (2016) 189–197 [31] O. Niwa, T. Matsumoto, M. Yanagida, Construction of a minichromosome by deletion and its mitotic and meiotic behaviour in fission yeast, Mol. Gen. Genet. 203 (1986) 397–405. [32] R. Ranjan, N. Ahamad, S. Ahmed, Fission yeast Drp1 is an essential protein required for recovery from DNA damage and chromosome segregation, DNA Repair 24 (2014) 98–106. [33] L.D. D'Andrea, L. Regan, TPR proteins: the versatile helix, Trends Biochem. Sci. 28 (2003) 655–662. [34] P.J. Preker, W. Keller, The HAT helix a repetitive motif implicated in RNA processing, Trends Biochem. Sci. 23 (1998) 15–16. [35] A. Audibert, M. Simonelig, Autoregulation at the level of mRNA 3′ end formation of the suppressor of forked gene of Drosophila melanogaster is conserved in Drosophila virilis, Proc. Natl Acad. Sci. USA 95 (1998) 14302–14307. [36] D.U. Kim, J. Hayles, D. Kim, V. Wood, H. Park, M. Won, H. Yoo, T. Duhig, M. Nam, G. Palmer, S. Han, L. Jeffery, S. Baek, H. Lee, Y. Shim, et al., Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe, Nat. Biotechnol. 12 (2010) 1308–1323. [37] N. Bonneaud, L. Minvielle-Sebastia, C. Cullin, F. Lacroute, Cellular localization of RNA14p and RNA15p, two yeast proteins involved in mRNA stability, J. Cell Sci. 107 (1994) 913–921. [38] S.K. Verma, R. Ranjan, V. Kumar, M.I. Siddiqi, S. Ahmed, Wat1/pop3, a conserved WD repeat containing protein acts synergistically with checkpoint kinase Chk1
[39]
[40] [41]
[42]
[43]
[44]
197
to maintain genome ploidy in fission yeast S. pombe, PLoS One 9 (2) (2014), e89587. S. Yadav, S. Verma, S. Ahmed, DNA topoisomerase 2 mutant activates DNA damage checkpoint protein kinase Chk1 in fission yeast S. pombe, Genet. Res. 93 (2011) 275–283. S. Khan, S. Ahmed, Role of swi7H4 mutant allele of DNA polymerase α in the DNA damage checkpoint response, PLoS One 10 (2015), e0124063. S. Wang, K. Asakawa, T. Win, T. Toda, C. Norbury, Inactivation of the pre-mRNA cleavage and polyadenylation factor Pfs2 in fission yeast causes lethal cell cycle defects, Mol. Cell. Biol. 25 (2005) 2288–2296. O. Dahan, M. Kupiec, Mutations in genes of Saccharomyces cerevisiae encoding premRNA splicing factors cause cell cycle arrest through activation of the spindle checkpoint, Nucleic Acids Res. 30 (2002) 4361–4370. R. Luna, S. Jimeno, M. Marin, P. Huertas, M. Garcia-Rubio, A. Aguilera, Interdependence between transcription and mRNP processing and export, and its impact on genetic stability, Mol. Cell 18 (2005) 711–722. H. Gaillard, A. Aguilera, Cleavage factor I links transcription termination to DNA damage response and genome integrity maintenance in Saccharomyces cerevisiae, PLoS Genet. 10 (3) (2014), e1004203.