- Email: [email protected]
Clinical, biochemical and genetic analysis of Chinese patients with isobutyryl-CoA dehydrogenase deficiency
Clinica Chimica Acta 487 (2018) 133–138
Contents lists available at ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/cca
Clinical, biochemical and genetic analysis of Chinese patients with isobutyryl-CoA dehydrogenase deficiency
T
Yiming Lina, Weilin Penga, Mengyi Jiangb, Chunmei Lina, Weihua Lina, Zhenzhu Zhenga, ⁎ ⁎ Min Lib, , Qingliu Fua, a b
Neonatal Disease Screening Center of Quanzhou, Quanzhou Maternal and Children's Hospital, 700 Fengze Street, Quanzhou, Fujian Province 362000, China Genuine Diagnostics Company Limited, Hangzhou, Zhejiang Province 310007, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Isobutyryl-CoA dehydrogenase deficiency ACAD8 Newborn screening 3D crystal structure Valine catabolism
Isobutyryl-CoA dehydrogenase deficiency (IBDHD) is a rare autosomal recessive metabolic disorder related to valine catabolism and results from variants in ACAD8. Here, we present the clinical, biochemical, and genotypes of seven patients with IBDHD in China for the first time. Five patients remained asymptomatic during follow-up, whereas one juvenile had speech delay and one newborn exhibited clinical symptoms. All patients showed remarkably increased concentrations of C4-aclycarnitine with elevated C4/C2 and C4/C3 ratios. In urine organic acid tests, only one patient presented with an increased concentration of isobutyrylglycine excretion. Genetic testing was performed to detect the causative variants. Five previously unreported variants, c.235C > G, c.286G > A, c.444G > T c.1092 + 1G > A, and c.1176G > T, and one known variant, c.1000C > T, in ACAD8 were identified. These previously unreported variants in ACAD8 were predicted to be disease-causing and the c.1092 + 1G > A variant was confirmed to cause skipping of exon 9 by reverse transcription PCR. The most common variant was c.286G > A, which showed an allelic frequency of 50% (7/14), and thus may be a prevalent variant among Chinese patients. Our results broaden the mutational spectrum of ACAD8 and improve the understanding of the clinical phenotype of IBDHD.
1. Introduction Isobutyryl-CoA dehydrogenase (IBD) is a mitochondrial enzyme that catalyzes the third step of degradation of the branched chain amino acid valine [1,2]. This protein is encoded by ACAD8 (MIM 604773), which is located on chromosome 11q25 [3]. IBD deficiency (IBDHD, MIM #611283) is a very rare autosomal recessive metabolic disorder of valine metabolism. Most patients with IBDHD were identified through newborn screening (NBS) programs which rely on the detection of elevated C4 acylcarnitine concentrations by tandem MS/MS. However, elevations in C4 acylcarnitine are not specific to IBDHD and are also observed in short-chain acyl-CoA dehydrogenase deficiency and ethylmalonic encephalopathy [4–7]. Thus, the diagnosis of IBDHD depends on isobutyryl-CoA dehydrogenase activity determination or genetic testing. Symptoms of IBDHD generally appear until late in infancy or in childhood, and the symptoms can include poor feeding, developmental delay, dilated cardiomyopathy, seizures, and anemia [1,8]. Recently,
Nygaard et al. [9] reported a patient with IBDHD presenting with significant clinical symptoms in adulthood, indicating that asymptomatic children with IBDHD are at risk of developing clinical manifestations in adulthood. Moreover, in another study, Sabbagha et al. [10] found that alternative splicing in ACAD8 caused a mitochondrial defect and progressive hepatic steatosis in mice, suggesting a relationship between IBDHD and fatty liver. Thus, the clinical importance of IBDHD is unclear. Systematic assessment of this disease is particularly urgent and patients with IBDHD should be monitored carefully. However, few patients with IBDHD have been reported worldwide and no Chinese cases of IBDHD have been reported previously in English literature. In this study, we present clinical and biochemical information as well as the genotypes of seven patients with IBDHD in China for the first time.
Abbreviations: IBDHD, Isobutyryl-CoA dehydrogenase deficiency; NBS, Newborn screening; MS/MS, Tandem mass spectrometry; NGS, Next-generation sequencing; PCR, Polymerase chain reaction; SNPs, Single-nucleotide polymorphisms; 3D, Three-dimensional; ACMG, American College of Medical Genetics Association of Clinical Genetics; RT-PCR, Reverse transcription PCR ⁎ Corresponding authors. E-mail addresses: [email protected] (M. Li), [email protected] (Q. Fu). https://doi.org/10.1016/j.cca.2018.09.033 Received 24 June 2018; Received in revised form 24 August 2018; Accepted 21 September 2018 Available online 22 September 2018 0009-8981/ © 2018 Elsevier B.V. All rights reserved.
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
c.1092 + 1G > A c.1176G > T (p.R392S) c.286G > A (p.G96S) c.444G > T (p.P148P)
Speech delay, learning disability Haematemesis, hypotonia, poor feeding, recurrent vomiting
c.1092 + 1G > A c.286G > A (p.G96S)
Normal
c.444G > T (p.P148P) c.286G > A (p.G96S)
Normal
c.286G > A (p.G96S) c.286G > A (p.G96S)
Normal
c.286G > A (p.G96S) c.286G > A (p.G96S)
Normal
c.1000C > T (p.R334C) c.235C > G (p.R79G)
Normal Allele 2 Allele 1
Genotypef
Clinical manifestation
2. Materials and methods 2.1. Patients and auxiliary analysis A total of 309,344 newborns (178,620 males and 130,724 females) were screened by MS/MS at Quanzhou Maternity and Children's Hospital between January 2014 and March 2018. Five patients (patients no. 1–5) were asymptomatic and screened for further diagnostic investigation because they showed elevated C4-aclycarnitine in NBS. Patient no. 6 is the older brother of patient no. 5. He is an 8-year-old boy who had not undergone expanded NBS at birth but presented with clinical symptoms by this time and was diagnosed later because his younger sibling has IBDHD. Patient no. 7 is the only newborn who showed some clinical manifestations in this study. Additionally, a total of 100 healthy newborns whose expanded NBS results were within the reference range from our center were randomly selected as controls. The concentrations of C4-aclycarnitine, C4/acetylcarnitine (C2), and C4/propionylcarnitine (C3) on dried blood spot filter paper cards were determined by MS/MS (ACQUITY TQD, Waters, Milford, MA, USA). Their urine samples were collected for urine organic acid analysis by GC–MS (7890B/5977A, Agilent Technologies, Santa Clara, CA, USA). Genetic analysis was conducted as a confirmatory test. Informed consent in accordance with the Declaration of Helsinki was obtained from each of the participants' parents. This study was approved by the Ethical Committee of Quanzhou Maternity and Children's Hospital and all experimental procedures were performed in accordance with relevant guidelines and regulations.
8 y, 11 m 6m M M 6a 7
10 m F 5
1 y, 2 m M
a
4
1 y, 5 m F 3
1 y, 7 m M 2
Dried blood spots or peripheral whole blood of patients and their parents, as well as those of 100 control subjects, were collected and genomic DNA was extracted using Qiagen Blood DNA mini kits following the manufacturer's instructions (Qiagen, Hilden, Germany). DNA samples of the probands were collected for NGS. The target sequences of a metabolic disorder panel including abnormal C4-aclycarnitine related genes (ACAD8, ACADS, ETHE1) were enriched by multiplex polymerase chain reaction (PCR). The library concentration and amplicon size were determined using an Agilent High Sensitivity DNA Kit (Agilent Technologies). The libraries were then sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) in pairedend mode, generating 150-base pair (bp) paired-end reads and the data were analyzed by MiSeq Reporter. The paired-end reads were quality trimmed using the Trimmomatic program (http://www.usadellab.org/ cms/index.php?page¼trimmomatic) and aligned with the human genome reference sequence (UCSC Genome build hg19). Single-nucleotide polymorphisms (SNPs) and insertions or deletions were identified using the SAMtools program (http://www.htslib.org/).
d: day, w: week, m: month, y: year; f/u: follow up; MS/MS: tandem mass spectrometry; ND: not determined. a Siblings. b Reference range: 0.08–0.45 μmol/L. c Reference range: 0–0.03. d Reference range: 0.04–0.39. e Reference range: 0–0.4 mmol/mol creatinine. f The previously unreported variants are in boldface type.
ND 0
2.58
0
0
0
0
1.03/1.96(4 d/13 d) 0.82/2.38(4 d/11 d) 1.63/2.09(7 d/21 d) 0.53/0.86(4 d/21 d) 0.62/1.79(4 d/20 d) 1.20(8 y, 8 m) 0.79/1.61(10 d/ 19 d) 0.14/0.21(4 d/13 d) 0.12/0.19(4 d/11 d) 0.16/0.17(7 d/21 d) 0.03/0.07(4 d/21 d) 0.06/0.19(4 d/20 d) 0.13(8 y, 8 m) 0.14/0.38(10 d/ 19 d) F 1
1 y, 7 m
1.47/1.31(4 d/13 d) 1.94/1.69(4 d/11 d) 1.29/1.96(7 d/21 d) 0.98/0.77(4 d/21 d) 0.83/1.38(4 d/20 d) 1.07(8 y, 8 m) 1.01/0.98(10 d/ 19 d)
C4/C3d C4/C2c C4 (μmol/L)b
MS/MS analysis Age at last f/u Sex Patient no.
Table 1 Data on individuals with IBDHD in this study.
Urine isobutyrylglycine (mmol/mol creatinine)e
2.2. DNA isolation and next-generation sequencing (NGS)
2.3. Bioinformatics analysis We checked the identified variants in frequently used databases such as the Human Gene Mutation Database (http://www.hgmd.cf.ac. uk/ac/index.php), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), dbSNP (https://www.ncbi.nlm.nih.gov/projects/SNP/), ExAC consortium (http://exac.broadinstitue.org/), and 1000 Genome Project database (http://www.1000genomes.org/). Missense variants were further assessed for possible pathogenicity using several bioinformatic programs including SIFT, PolyPhen-2, PROVEAN, and MutationTaster to predict the effect of three new amino acid substitutions (p.Arg79Gly, p.Gly96Ser, and p.Arg392Ser). Multiple amino acid sequences of different species were extracted from the National Center for Biotechnology Information and aligned to evaluate the evolutionary conservation of the variants using ClustalX (http://www.clustal.org/ clustal2). Furthermore, homology modeling was used to build threedimensional (3D) models of ACAD8 using Swiss Model Workspace with 134
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Fig. 1. Validation of ACAD8 mutation by Sanger sequencing (the variant is indicated with a red arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the PDB entry code 1RX0 [11]. The PDB files were submitted to the Swiss-pdb Viewer 4.0 to view the 3D-structure. The c.444G > T (p.Pro148Pro) and c.1092 + 1G > A variants were predicted by MutationTaster and Human Splicing Finder (HSF). Pathogenicity analysis of these five previously unreported variants was performed to comply with American College of Medical Genetics and Genomics (ACMG) guidelines [12].
3. Results 3.1. Clinical and biochemical characteristics All seven patients were born at term and five (patients no. 1–5) remained asymptomatic and no acute metabolic crisis occurred during follow-up. Patient no. 6 was diagnosed after a younger sister (patient no. 5) tested positive by NBS. The juvenile had a speech delay and learning disability and his parents complained that he did not perform well at memorization. Patient no. 7 was born by cesarean delivery and presented with hematemesis and hypotonia at the age of 2 days, and then feeding difficulty and recurrent vomiting occurred at 9 days. All patients showed significantly increased concentrations of C4-aclycarnitine with increased C4/C2 and C4/C3 ratios. Urine organic acids analysis was conducted for six patients (patient no. 1–5 and patient no. 7) and only patient no. 5 showed small amounts of isobutyryl-glycine excretion. The results of the remaining five patients were within the reference range. Detailed clinical and biochemical information, as well as the genotypes of the seven cases with IBDHD, are summarized in Table 1.
2.4. Sanger sequencing The variants identified by NGS were further verified by Sanger sequencing of the patients and their parents or family members. All coding exons of ACAD8 with flanking intron sequences were amplified by PCR. Sequencing was performed on an ABI Prism 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). All primers used are listed in Supplementary file 1: Table S1. 2.5. Reverse transcription PCR (RT-PCR) To determine the biological consequence of the c.1092 + 1G > A variant, total RNA from patient no. 5, the patient's parents, and healthy control subjects was isolated using TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) followed by phenol-chloroform extraction. Reverse transcription of RNA into cDNA using oligo-dT primers and M-MLV RT (Life Technologies) was conducted according to the manufacturer's protocol. Subsequent PCR amplification was performed using specific primers spanning from exons 7 to 10 of ACAD8 (For_ TGTAAAACGAC GGCCAGTGACTGTGCTGTCCCTGTGG and Rev_ CAGGAAACAGCTATG ACCTAGCCGTAGCCCCCGTG). PCR products were detected by electrophoresis on a 1% agarose gel. After excision and gel extraction with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), PCR products were evaluated by sequencing analysis (3500xl Genetic Analyzer, Applied Biosystems).
3.2. Genetic testing and bioinformatics analysis Six different variants identified in ACAD8 in seven patients were confirmed to be inherited from their parents, including four missense variants, one splicing variant, and one synonymous variant (conserved and predicted to be deleterious). The detection rate of mutated alleles was 100%. As shown in Table 1, patients 1, 4, 5, 6, and 7 were compound heterozygotes, while patients 2 and 3 were homozygotes. Among the six variants, only the c.1000C > T (p.Arg334Cys) variant in exon 9 has been reported previously. The remaining five variants, c.235C > G (p.Arg79Gly) and c.286G > A (p.Gly96Ser) in exon 3, c.444G > T (p.Pro148Pro) in exon 4, c.1092 + 1G > A in intron 9, and 135
Clinica Chimica Acta 487 (2018) 133–138
ND ND ND 1.997E-04 ND
c.1176G > T (p.Arg392Ser) in exon 10, were previously unreported (Fig. 1). These previously unreported variants can be found in the public variant database dbSNP and the frequency of these variants were extremely low in the ExAC database; none have not reported in the disease databases HGMD, ClinVar, and LOVD (Table 2). None of these variants were detected in the 100 healthy individuals. The missense variants c.235C > G, c.286G > A, and c.1176G > T were predicted to be deleterious in silico by Polyphen-2, SIFT, PROVEAN, and MutationTaster. Additionally, multiple sequence alignments revealed that the amino acid residues at positions 79, 96, and 392 in the ACAD8 protein are highly conserved across species (Supplementary file 2: Fig. S1). Furthermore, 3D-modeling analysis showed the p.Arg79Gly variant substitutes a hydrophilic arginine for the hydrophobic glycine, which interferes with the original side chain hydrogen bonding with 152-Met and 153-Glu, resulting in abnormal folding of ACAD8 (Fig. 2a). The p.Gly96Ser variant leads to a change from hydrophobic glycine to hydrophilic cysteine and introduces two βstrands (89-Val to 93-Thr and 96-Ser to 100-Leu) which may destabilize ACAD8 (Fig. 2b). The p.Arg392Ser variant may alter the side chain conformations of residues in the binding cavity and affect the ability of the ACAD8 quaternary structure to form intramolecular hydrogen bonds with 395-Gln. Moreover, 392-Arg is close to the catalytic residue Glu-398, and the induced hydrogen bond may block isovaleryl-CoA binding in the ACAD8 substrate binding pocket (Fig. 2c). The variants c.444G > T and c.1092 + 1G > A were predicted to affect splicing in silico by both MutationTaster and HSF (Table 2). According to HSF, the c.444G > T mutant silencer value score was 69.14 (above 60), and thus the variant can lead to introduction of an exonic splicing silencers site and cause abnormal splicing. According to HSF, c.1092 + 1G has a strong splice site with a score of 82.48, while c.1092 + 1G > A has a weak splice site (55.64). The score variation was −32.54% (under −10%), and thus the variant can break the wildtype site and likely affects splicing (Table 2). The c.1092 + 1G > A mutation in patient no. 5 (proband) was inherited from her mother. RTPCR analysis showed that patient no. 5 and her mother produced both authentic and aberrantly spliced RNAs of 386 and 233 bp, respectively, while her father produced only authentic spliced RNAs. cDNA sequencing further confirmed that exon 9 of the proband and her mother were spliced out, while the proband's father and control showed normal expression (Fig. 3a, c).
p.R392S
The reference sequence used in this study was based on the NCBI37/hg19 assembly of the human genome. NM_014384.2 was employed as reference sequence for ACAD8. ND: no data. N/A: not available.
3.295E-05 9.885E-05 1.885E-04 2.505E-05 3.432E-05 rs377629003 rs773472208 rs572820646 rs572619478 rs766307334 ND ND ND ND ND ND ND ND ND ND N/A N/A Potential alteration of splicing. Most Probably affecting splicing. N/A 0.999 0.999 0.999 1 0.999 −4.893 −5.744 0 N/A −5.664 Exon 3 Exon 3 Exon 4 IVS 9 Exon 10 1 2 3 4 5
c.235C > G c.286G > A c.444G > T c.1092 + 1G > A c.1176G > T
R79G G96S P148P
0 0 N/A N/A 0
0.811 1 N/A N/A 1
Mutation Taster PROVEAN PolyPhen-2 SIFT Protein change Nucleotide change Location No
Table 2 In silico prediction and analysis of the novel ACAD8 gene variants.
HSF
HGMD
ClinVar
dbSNP
Freq in ExAC
Freq in 1000 Genome
Y. Lin et al.
4. Discussion IBDHD was described for the first time in a 2-year-old girl who presented with cardiomyopathy, anemia, and carnitine deficiency at the age of 12 months [1]. Since then, approximately 20 patients have been reported, whereas IBDHD has been identified in only seven patients in Asian countries [13–17]. Little is known about the prevalence of IBDHD, Oglesbee et al. [17] found that the incidence of this disease is at least 1:70,000, Scolamiero et al. [18] identified a neonate with IBDHD among 45,466 infants screened in southern Italy. In contrast, Gallant et al. [19] reported the incidence of IBDHD by neonatal screening to be 1: 292,451 in California. The relatively high cutoff value (1.8 μM) of the California NBS program may explain the low incidence of IBDHD and increase the possibility of obtaining false-negative screening results. In this study, six newborns (patient no. 6 was not included in the incidence statistics) with IBDHD were identified by NBS for the first time in China, revealing an incidence of 1:51,557 for IBDHD in a Chinese population reported from a single center. The elevated concentrations of C4-acylcarnitine in blood spots samples together with the detection of isobutyryl-glycine in the urine, enabled differentiation of IBDHD from short-chain acyl-CoA dehydrogenase deficiency, which also resulted in an increased concentration of C4-acylcarnitine. However, isobutyryl-glycine is not always detectable in the urine of patients with IBDHD and genetic analysis should be performed to confirm the diagnosis [17]. All patients reported here 136
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Fig. 2. Three-dimensional modeling structure analysis of wild-type and ACAD8 mutant products. Green dashed lines represent hydrogen bonds and the green number shows the hydrogen bonds distances. a The p.Arg79Gly variant substitutes a hydrophilic arginine for hydrophobic glycine, which interfered with the original side chain hydrogen bonding with 152-Met and 153-Glu, resulting in abnormal folding of ACAD8. b The p.Gly96Ser variant leads to hydrophobic glycine altered by hydrophilic cysteine, which introduced two β-strands (89-Val to 93-Thr and 96-Ser to 100-Leu) that may have destabilized ACAD8. c The p.Arg392Ser variant may have altered the side chain conformations of the residues in the binding cavity and affect the ACAD8 quaternary structure to induce intramolecular hydrogen bonding with 395-Gln. Moreover, 392-Arg is closed to the catalytic residue Glu-398, and the induced hydrogen bond may block isovaleryl-CoA binding in the ACAD8 substrate binding pocket. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Fig. 3. Reverse transcription PCR analysis of the previously unreported splice site variant c.1092 + 1G > A. a cDNA gel electrophoresis. Lane 1: MW, DNA molecular weight marker (100–1000 bp); Gel electrophoresis analysis showed that the proband's father and control had the expected PCR products of 386 bp from exons 8 to 10, while additional PCR products of 233 bp corresponding to a lack of exon 9 were observed in the patient's and her mother's samples. b Schematic representation the effect of the splicing change. c Sequence of the wild-type cDNA amplification product and mutant cDNA amplification product, with the latter showing skipping of exon 9.
into account that one adult-onset patient with IBDHD presented with significant clinical symptoms such as muscle pain, weakness, third-degree atrioventricular block, and cardiomyopathy [9] and a mouse model of IBDHD grew normally but demonstrated cold intolerance at a young age with progressive hepatic steatosis [10], patients with IBDHD may exhibit clinical symptoms with age. Therefore, long-term follow-up and monitoring of these patients is essential for timely evaluating possible clinical symptoms. The pathogenic gene of IBDHD is ACAD8, which is located on chromosome 11q25 and contains 11 exons. To date, more than 22 ACAD8 mutations have been reported, with missense mutation as the most common type [16]. We genetically analyzed this rare disease in the Chinese population for the first time. Six different ACAD8 variants were identified, five of which were previously unreported (c.235C > G, c.286G > A, c.444G > T, c.1092 + 1G > A, and c.1176G > T). The c.1000C > T (p.Arg334Cys) variant was reported previously in
showed an abnormal C4 acylcarnitine spectrum in the blood, while isobutyrylglycine in the urine was indistinctive. Only one patient showed slightly increased excretion of isobutyrylglycine. Furthermore, all patients had biallelic variants in ACAD8. These findings indicate that urinary isobutyrylglycine is not a specific indicator and highlights the importance of genetic testing for disease diagnosis. As in previous studies [4], most patients reported in this study remained asymptomatic, whereas one juvenile (patient no. 6) had speech delay and one newborn (patient no. 7) exhibited clinical symptoms including hematemesis, hypotonia, feeding difficulty, and recurrent vomiting in the newborn period. Hematemesis has not been reported in previous patients with IBDHD. Given that the intrauterine fetal heart rate of patient no. 6 was more than 170 beats/min, clinical manifestation of hematemesis may be triggered by stressful gastric bleeding due to intrauterine distress. Thus, it is possible that the hematemesis symptom presented in this patient was not related to IBDHD. However, taking 137
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Project, China (Grant No. 2018Z160).
Caucasian and Korean populations [15,20]. The c.286G > A variant allelic frequency was up to 50% (7/14) in this study; two patients were homozygous and three were heterozygous for this variant, suggesting that it is a hot-spot mutation or founder mutation among Chinese patients with IBDHD. ACAD8 is a member of the mammalian acyl-CoA dehydrogenases, which consists of an NH2-terminal α-helical domain, medial β-strand domain, and C-terminal α-helical domain [2,21]. Computational analysis predicted that these previously unreported missense variants are pathogenic and conservation analysis showed that the residues Arg79, Gly96, and Arg392 are highly conserved. Additionally, 3D-modeling analysis showed that the three missense variants may result in instability of the ACAD8 protein structure. Overall, these previously unreported missense variants are likely disease-causing based on the results of various function-prediction algorithms. c.444G > T and c.1092 + 1G > A were predicted to be damaging by both MutationTaster and HSF, indicating that both variants cause a splicing change in the cDNA. For c.1092 + 1G > A, the variant is in the highly conserved donor splice site of intron 9 and an alteration in this position is likely disease-causing. Therefore, RT-PCR was performed and c.1092 + 1G > A was confirmed as a splice site mutation, causing skipping of exon 9 and leading to production of a truncated ACAD8 protein. For c.444G > T (p.Pro148Pro), although the substitution did not alter the amino acid sequence, the variant can lead to introduction of an exonic splicing silencer site and result in abnormal splicing, and thus the variant is likely pathogenic. Unfortunately, because the parents of both patients refused to undergo further investigation, we were unable to analyze the cDNA change in the patients, and further studies may be warranted to validate this variant. Hence, according to ACMG guidelines [12], c.1092 + 1G > A was classified as pathogenic, c.286G > A was classified as likely pathogenic, and c.235C > G, c.1176G > T, and c.444G > T were classified as variants of unknown significance. In addition to the splicing variant c.1092 + 1G > A, there is not sufficient evidence of support that the remaining four variants are pathogenic; however, we still predict that these variants are deleterious based on our bioinformatics analysis results. In summary, most patients with IBDHD diagnosed through NBS are free of symptoms and the clinical significance of IBDHD is unclear because of the limited number of cases. However, these cases are at risk of developing clinical manifestations, and thus close follow-up and monitoring is essential for detecting the gradual development of symptoms. Although urinary acylcarnitine analysis is a practical tool for diagnosing IBDHD, confirmatory genetic testing is desirable for suspected IBDHD cases following NBS.
Competing interests The authors declare that they have no competing interests. References [1] C.R. Roe, S.D. Cederbaum, D.S. Roe, R. Mardach, A. Galindo, L. Sweetman, Isolated isobutyryl-CoA dehydrogenase deficiency: an unrecognized defect in human valine metabolism, Mol. Genet. Metab. 65 (1998) 264–271. [2] K.P. Battaile, T.V. Nguyen, J. Vockley, J.J. Kim, Structures of isobutyryl-CoA dehydrogenase and enzyme-product complex: comparison with isovaleryl- and shortchain acyl-CoA dehydrogenases, J. Biol. Chem. 279 (2004) 16526–16534. [3] T.V. Nguyen, B.S. Andresen, T.J. Corydon, S. Ghisla, N. Abd-El Razik, A.W. Mohsen, et al., Identification of isobutyryl-CoA dehydrogenase and its deficiency in humans, Mol. Genet. Metab. 77 (2002) 68–79. [4] L. Pena, B. Angle, B. Burton, J. Charrow, Follow-up of patients with short-chain acyl-CoA dehydrogenase and isobutyryl-CoA dehydrogenase deficiencies identified through newborn screening: one center's experience. Genetics in medicine : official journal of the American College of, Medical Genetics 14 (2012) 342–347. [5] D.I. Zafeiriou, P. Augoustides-Savvopoulou, D. Haas, J. Smet, P. Triantafyllou, E. Vargiami, et al., Ethylmalonic encephalopathy: clinical and biochemical observations, Neuropediatrics 38 (2007) 78–82. [6] B. Merinero, C. Perez-Cerda, P. Ruiz Sala, I. Ferrer, M.J. Garcia, M. Martinez Pardo, et al., Persistent increase of plasma butyryl/isobutyrylcarnitine concentrations as marker of SCAD defect and ethylmalonic encephalopathy, J. Inherit. Metab. Dis. 29 (2006) 685. [7] A. Drousiotou, I. Dimeo, R. Mineri, T. Georgiou, G. Stylianidou, V. Tiranti, Ethylmalonic encephalopathy: application of improved biochemical and molecular diagnostic approaches, Clin. Genet. 79 (2011) 385–390. [8] J.O. Sass, S. Sander, J. Zschocke, Isobutyryl-CoA dehydrogenase deficiency: isobutyrylglycinuria and ACAD8 gene mutations in two infants, J. Inherit. Metab. Dis. 27 (2004) 741–745. [9] H. Nygaard, D. Gaist, M. Christensen, M. Dunø, M. Kjeldsen, H. Daaschrøder, et al., Isobutyryl-CoA dehydrogenase deficiency presenting with significant clinical disease in adulthood, The 18th Nordic Congress in Human Genetics. Reykjavik, Island, 2016. [10] N.G. Sabbagha, H.J. Kao, C.F. Yang, C.C. Huang, W.D. Lin, F.J. Tsai, et al., Alternative splicing in Acad8 resulting a mitochondrial defect and progressive hepatic steatosis in mice, Pediatr. Res. 70 (2011) 31–36. [11] M. Biasini, S. Bienert, A. Waterhouse, K. Arnold, G. Studer, T. Schmidt, et al., SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information, Nucleic Acids Res. 42 (2014) W252–W258. [12] S. Richards, N. Aziz, S. Bale, D. Bick, S. Das, J. Gastier-Foster, et al., Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology, Genetics Med. 17 (2015) 405–424. [13] M. Popek, M. Walter, M. Fernando, M. Lindner, K.O. Schwab, J.O. Sass, Two inborn errors of metabolism in a newborn: glutaric aciduria type I combined with isobutyrylglycinuria, Clinica Chimica Acta 411 (2010) 2087–2091. [14] S. Santra, A. Macdonald, M.A. Preece, R.K. Olsen, B.S. Andresen, Long-term outcome of isobutyryl-CoA dehydrogenase deficiency diagnosed following an episode of ketotic hypoglycaemia, Mol. Genet. Metabol. Rep. 10 (2017) 28–30. [15] E.H. Yoo, H.J. Cho, C.S. Ki, S.Y. Lee, Isobutyryl-CoA dehydrogenase deficiency with a novel ACAD8 gene mutation detected by tandem mass spectrometry newborn screening, Clin. Chem. Lab. Med. 45 (2007) 1495–1497. [16] J.W. Yun, K.I. Jo, H.I. Woo, S.Y. Lee, C.S. Ki, J.W. Kim, et al., A novel ACAD8 mutation in asymptomatic patients with isobutyryl-CoA dehydrogenase deficiency and a review of the ACAD8 mutation spectrum, Clin. Genet. 87 (2015) 196–198. [17] D. Oglesbee, M. He, N. Majumder, J. Vockley, A. Ahmad, B. Angle, et al., Development of a newborn screening follow-up algorithm for the diagnosis of isobutyryl-CoA dehydrogenase deficiency, Genet. Med. 9 (2007) 108–116. [18] E. Scolamiero, C. Cozzolino, L. Albano, A. Ansalone, M. Caterino, G. Corbo, et al., Targeted metabolomics in the expanded newborn screening for inborn errors of metabolism, Mol. BioSyst. 11 (2015) 1525–1535. [19] N.M. Gallant, K. Leydiker, H. Tang, L. Feuchtbaum, F. Lorey, R. Puckett, et al., Biochemical, molecular, and clinical characteristics of children with short chain acyl-CoA dehydrogenase deficiency detected by newborn screening in California, Mol. Genet. Metab. 106 (2012) 55–61. [20] C.B. Pedersen, C. Bischoff, E. Christensen, H. Simonsen, A.M. Lund, S.P. Young, et al., Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening, Pediatr. Res. 60 (2006) 315–320. [21] E.A. Telford, L.M. Moynihan, A.F. Markham, N.J. Lench, Isolation and characterisation of a cDNA encoding the precursor for a novel member of the acyl-CoA dehydrogenase gene family, Biochim. Biophys. Acta 1446 (1999) 371–376.
5. Conclusions This is the first report of clinical, biochemical, and genetic analysis of this rare disease in the Chinese population. Five previously unreported ACAD8 variants were identified, among which the c.286G > A variant was observed in five patients and was the most frequently detected variant. The identification of these previously unreported variants extends the landscape of genetic alterations in IBDHD. Identification of the most prevalent variant may facilitate genetic diagnoses of IBDHD within the population. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cca.2018.09.033. Acknowledgements We thank all the participants for their co-operation. This study was supported by the Quanzhou Municipal Science and Technology Plan
138
Contents lists available at ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/cca
Clinical, biochemical and genetic analysis of Chinese patients with isobutyryl-CoA dehydrogenase deficiency
T
Yiming Lina, Weilin Penga, Mengyi Jiangb, Chunmei Lina, Weihua Lina, Zhenzhu Zhenga, ⁎ ⁎ Min Lib, , Qingliu Fua, a b
Neonatal Disease Screening Center of Quanzhou, Quanzhou Maternal and Children's Hospital, 700 Fengze Street, Quanzhou, Fujian Province 362000, China Genuine Diagnostics Company Limited, Hangzhou, Zhejiang Province 310007, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Isobutyryl-CoA dehydrogenase deficiency ACAD8 Newborn screening 3D crystal structure Valine catabolism
Isobutyryl-CoA dehydrogenase deficiency (IBDHD) is a rare autosomal recessive metabolic disorder related to valine catabolism and results from variants in ACAD8. Here, we present the clinical, biochemical, and genotypes of seven patients with IBDHD in China for the first time. Five patients remained asymptomatic during follow-up, whereas one juvenile had speech delay and one newborn exhibited clinical symptoms. All patients showed remarkably increased concentrations of C4-aclycarnitine with elevated C4/C2 and C4/C3 ratios. In urine organic acid tests, only one patient presented with an increased concentration of isobutyrylglycine excretion. Genetic testing was performed to detect the causative variants. Five previously unreported variants, c.235C > G, c.286G > A, c.444G > T c.1092 + 1G > A, and c.1176G > T, and one known variant, c.1000C > T, in ACAD8 were identified. These previously unreported variants in ACAD8 were predicted to be disease-causing and the c.1092 + 1G > A variant was confirmed to cause skipping of exon 9 by reverse transcription PCR. The most common variant was c.286G > A, which showed an allelic frequency of 50% (7/14), and thus may be a prevalent variant among Chinese patients. Our results broaden the mutational spectrum of ACAD8 and improve the understanding of the clinical phenotype of IBDHD.
1. Introduction Isobutyryl-CoA dehydrogenase (IBD) is a mitochondrial enzyme that catalyzes the third step of degradation of the branched chain amino acid valine [1,2]. This protein is encoded by ACAD8 (MIM 604773), which is located on chromosome 11q25 [3]. IBD deficiency (IBDHD, MIM #611283) is a very rare autosomal recessive metabolic disorder of valine metabolism. Most patients with IBDHD were identified through newborn screening (NBS) programs which rely on the detection of elevated C4 acylcarnitine concentrations by tandem MS/MS. However, elevations in C4 acylcarnitine are not specific to IBDHD and are also observed in short-chain acyl-CoA dehydrogenase deficiency and ethylmalonic encephalopathy [4–7]. Thus, the diagnosis of IBDHD depends on isobutyryl-CoA dehydrogenase activity determination or genetic testing. Symptoms of IBDHD generally appear until late in infancy or in childhood, and the symptoms can include poor feeding, developmental delay, dilated cardiomyopathy, seizures, and anemia [1,8]. Recently,
Nygaard et al. [9] reported a patient with IBDHD presenting with significant clinical symptoms in adulthood, indicating that asymptomatic children with IBDHD are at risk of developing clinical manifestations in adulthood. Moreover, in another study, Sabbagha et al. [10] found that alternative splicing in ACAD8 caused a mitochondrial defect and progressive hepatic steatosis in mice, suggesting a relationship between IBDHD and fatty liver. Thus, the clinical importance of IBDHD is unclear. Systematic assessment of this disease is particularly urgent and patients with IBDHD should be monitored carefully. However, few patients with IBDHD have been reported worldwide and no Chinese cases of IBDHD have been reported previously in English literature. In this study, we present clinical and biochemical information as well as the genotypes of seven patients with IBDHD in China for the first time.
Abbreviations: IBDHD, Isobutyryl-CoA dehydrogenase deficiency; NBS, Newborn screening; MS/MS, Tandem mass spectrometry; NGS, Next-generation sequencing; PCR, Polymerase chain reaction; SNPs, Single-nucleotide polymorphisms; 3D, Three-dimensional; ACMG, American College of Medical Genetics Association of Clinical Genetics; RT-PCR, Reverse transcription PCR ⁎ Corresponding authors. E-mail addresses: [email protected] (M. Li), [email protected] (Q. Fu). https://doi.org/10.1016/j.cca.2018.09.033 Received 24 June 2018; Received in revised form 24 August 2018; Accepted 21 September 2018 Available online 22 September 2018 0009-8981/ © 2018 Elsevier B.V. All rights reserved.
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
c.1092 + 1G > A c.1176G > T (p.R392S) c.286G > A (p.G96S) c.444G > T (p.P148P)
Speech delay, learning disability Haematemesis, hypotonia, poor feeding, recurrent vomiting
c.1092 + 1G > A c.286G > A (p.G96S)
Normal
c.444G > T (p.P148P) c.286G > A (p.G96S)
Normal
c.286G > A (p.G96S) c.286G > A (p.G96S)
Normal
c.286G > A (p.G96S) c.286G > A (p.G96S)
Normal
c.1000C > T (p.R334C) c.235C > G (p.R79G)
Normal Allele 2 Allele 1
Genotypef
Clinical manifestation
2. Materials and methods 2.1. Patients and auxiliary analysis A total of 309,344 newborns (178,620 males and 130,724 females) were screened by MS/MS at Quanzhou Maternity and Children's Hospital between January 2014 and March 2018. Five patients (patients no. 1–5) were asymptomatic and screened for further diagnostic investigation because they showed elevated C4-aclycarnitine in NBS. Patient no. 6 is the older brother of patient no. 5. He is an 8-year-old boy who had not undergone expanded NBS at birth but presented with clinical symptoms by this time and was diagnosed later because his younger sibling has IBDHD. Patient no. 7 is the only newborn who showed some clinical manifestations in this study. Additionally, a total of 100 healthy newborns whose expanded NBS results were within the reference range from our center were randomly selected as controls. The concentrations of C4-aclycarnitine, C4/acetylcarnitine (C2), and C4/propionylcarnitine (C3) on dried blood spot filter paper cards were determined by MS/MS (ACQUITY TQD, Waters, Milford, MA, USA). Their urine samples were collected for urine organic acid analysis by GC–MS (7890B/5977A, Agilent Technologies, Santa Clara, CA, USA). Genetic analysis was conducted as a confirmatory test. Informed consent in accordance with the Declaration of Helsinki was obtained from each of the participants' parents. This study was approved by the Ethical Committee of Quanzhou Maternity and Children's Hospital and all experimental procedures were performed in accordance with relevant guidelines and regulations.
8 y, 11 m 6m M M 6a 7
10 m F 5
1 y, 2 m M
a
4
1 y, 5 m F 3
1 y, 7 m M 2
Dried blood spots or peripheral whole blood of patients and their parents, as well as those of 100 control subjects, were collected and genomic DNA was extracted using Qiagen Blood DNA mini kits following the manufacturer's instructions (Qiagen, Hilden, Germany). DNA samples of the probands were collected for NGS. The target sequences of a metabolic disorder panel including abnormal C4-aclycarnitine related genes (ACAD8, ACADS, ETHE1) were enriched by multiplex polymerase chain reaction (PCR). The library concentration and amplicon size were determined using an Agilent High Sensitivity DNA Kit (Agilent Technologies). The libraries were then sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) in pairedend mode, generating 150-base pair (bp) paired-end reads and the data were analyzed by MiSeq Reporter. The paired-end reads were quality trimmed using the Trimmomatic program (http://www.usadellab.org/ cms/index.php?page¼trimmomatic) and aligned with the human genome reference sequence (UCSC Genome build hg19). Single-nucleotide polymorphisms (SNPs) and insertions or deletions were identified using the SAMtools program (http://www.htslib.org/).
d: day, w: week, m: month, y: year; f/u: follow up; MS/MS: tandem mass spectrometry; ND: not determined. a Siblings. b Reference range: 0.08–0.45 μmol/L. c Reference range: 0–0.03. d Reference range: 0.04–0.39. e Reference range: 0–0.4 mmol/mol creatinine. f The previously unreported variants are in boldface type.
ND 0
2.58
0
0
0
0
1.03/1.96(4 d/13 d) 0.82/2.38(4 d/11 d) 1.63/2.09(7 d/21 d) 0.53/0.86(4 d/21 d) 0.62/1.79(4 d/20 d) 1.20(8 y, 8 m) 0.79/1.61(10 d/ 19 d) 0.14/0.21(4 d/13 d) 0.12/0.19(4 d/11 d) 0.16/0.17(7 d/21 d) 0.03/0.07(4 d/21 d) 0.06/0.19(4 d/20 d) 0.13(8 y, 8 m) 0.14/0.38(10 d/ 19 d) F 1
1 y, 7 m
1.47/1.31(4 d/13 d) 1.94/1.69(4 d/11 d) 1.29/1.96(7 d/21 d) 0.98/0.77(4 d/21 d) 0.83/1.38(4 d/20 d) 1.07(8 y, 8 m) 1.01/0.98(10 d/ 19 d)
C4/C3d C4/C2c C4 (μmol/L)b
MS/MS analysis Age at last f/u Sex Patient no.
Table 1 Data on individuals with IBDHD in this study.
Urine isobutyrylglycine (mmol/mol creatinine)e
2.2. DNA isolation and next-generation sequencing (NGS)
2.3. Bioinformatics analysis We checked the identified variants in frequently used databases such as the Human Gene Mutation Database (http://www.hgmd.cf.ac. uk/ac/index.php), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), dbSNP (https://www.ncbi.nlm.nih.gov/projects/SNP/), ExAC consortium (http://exac.broadinstitue.org/), and 1000 Genome Project database (http://www.1000genomes.org/). Missense variants were further assessed for possible pathogenicity using several bioinformatic programs including SIFT, PolyPhen-2, PROVEAN, and MutationTaster to predict the effect of three new amino acid substitutions (p.Arg79Gly, p.Gly96Ser, and p.Arg392Ser). Multiple amino acid sequences of different species were extracted from the National Center for Biotechnology Information and aligned to evaluate the evolutionary conservation of the variants using ClustalX (http://www.clustal.org/ clustal2). Furthermore, homology modeling was used to build threedimensional (3D) models of ACAD8 using Swiss Model Workspace with 134
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Fig. 1. Validation of ACAD8 mutation by Sanger sequencing (the variant is indicated with a red arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
the PDB entry code 1RX0 [11]. The PDB files were submitted to the Swiss-pdb Viewer 4.0 to view the 3D-structure. The c.444G > T (p.Pro148Pro) and c.1092 + 1G > A variants were predicted by MutationTaster and Human Splicing Finder (HSF). Pathogenicity analysis of these five previously unreported variants was performed to comply with American College of Medical Genetics and Genomics (ACMG) guidelines [12].
3. Results 3.1. Clinical and biochemical characteristics All seven patients were born at term and five (patients no. 1–5) remained asymptomatic and no acute metabolic crisis occurred during follow-up. Patient no. 6 was diagnosed after a younger sister (patient no. 5) tested positive by NBS. The juvenile had a speech delay and learning disability and his parents complained that he did not perform well at memorization. Patient no. 7 was born by cesarean delivery and presented with hematemesis and hypotonia at the age of 2 days, and then feeding difficulty and recurrent vomiting occurred at 9 days. All patients showed significantly increased concentrations of C4-aclycarnitine with increased C4/C2 and C4/C3 ratios. Urine organic acids analysis was conducted for six patients (patient no. 1–5 and patient no. 7) and only patient no. 5 showed small amounts of isobutyryl-glycine excretion. The results of the remaining five patients were within the reference range. Detailed clinical and biochemical information, as well as the genotypes of the seven cases with IBDHD, are summarized in Table 1.
2.4. Sanger sequencing The variants identified by NGS were further verified by Sanger sequencing of the patients and their parents or family members. All coding exons of ACAD8 with flanking intron sequences were amplified by PCR. Sequencing was performed on an ABI Prism 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). All primers used are listed in Supplementary file 1: Table S1. 2.5. Reverse transcription PCR (RT-PCR) To determine the biological consequence of the c.1092 + 1G > A variant, total RNA from patient no. 5, the patient's parents, and healthy control subjects was isolated using TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) followed by phenol-chloroform extraction. Reverse transcription of RNA into cDNA using oligo-dT primers and M-MLV RT (Life Technologies) was conducted according to the manufacturer's protocol. Subsequent PCR amplification was performed using specific primers spanning from exons 7 to 10 of ACAD8 (For_ TGTAAAACGAC GGCCAGTGACTGTGCTGTCCCTGTGG and Rev_ CAGGAAACAGCTATG ACCTAGCCGTAGCCCCCGTG). PCR products were detected by electrophoresis on a 1% agarose gel. After excision and gel extraction with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), PCR products were evaluated by sequencing analysis (3500xl Genetic Analyzer, Applied Biosystems).
3.2. Genetic testing and bioinformatics analysis Six different variants identified in ACAD8 in seven patients were confirmed to be inherited from their parents, including four missense variants, one splicing variant, and one synonymous variant (conserved and predicted to be deleterious). The detection rate of mutated alleles was 100%. As shown in Table 1, patients 1, 4, 5, 6, and 7 were compound heterozygotes, while patients 2 and 3 were homozygotes. Among the six variants, only the c.1000C > T (p.Arg334Cys) variant in exon 9 has been reported previously. The remaining five variants, c.235C > G (p.Arg79Gly) and c.286G > A (p.Gly96Ser) in exon 3, c.444G > T (p.Pro148Pro) in exon 4, c.1092 + 1G > A in intron 9, and 135
Clinica Chimica Acta 487 (2018) 133–138
ND ND ND 1.997E-04 ND
c.1176G > T (p.Arg392Ser) in exon 10, were previously unreported (Fig. 1). These previously unreported variants can be found in the public variant database dbSNP and the frequency of these variants were extremely low in the ExAC database; none have not reported in the disease databases HGMD, ClinVar, and LOVD (Table 2). None of these variants were detected in the 100 healthy individuals. The missense variants c.235C > G, c.286G > A, and c.1176G > T were predicted to be deleterious in silico by Polyphen-2, SIFT, PROVEAN, and MutationTaster. Additionally, multiple sequence alignments revealed that the amino acid residues at positions 79, 96, and 392 in the ACAD8 protein are highly conserved across species (Supplementary file 2: Fig. S1). Furthermore, 3D-modeling analysis showed the p.Arg79Gly variant substitutes a hydrophilic arginine for the hydrophobic glycine, which interferes with the original side chain hydrogen bonding with 152-Met and 153-Glu, resulting in abnormal folding of ACAD8 (Fig. 2a). The p.Gly96Ser variant leads to a change from hydrophobic glycine to hydrophilic cysteine and introduces two βstrands (89-Val to 93-Thr and 96-Ser to 100-Leu) which may destabilize ACAD8 (Fig. 2b). The p.Arg392Ser variant may alter the side chain conformations of residues in the binding cavity and affect the ability of the ACAD8 quaternary structure to form intramolecular hydrogen bonds with 395-Gln. Moreover, 392-Arg is close to the catalytic residue Glu-398, and the induced hydrogen bond may block isovaleryl-CoA binding in the ACAD8 substrate binding pocket (Fig. 2c). The variants c.444G > T and c.1092 + 1G > A were predicted to affect splicing in silico by both MutationTaster and HSF (Table 2). According to HSF, the c.444G > T mutant silencer value score was 69.14 (above 60), and thus the variant can lead to introduction of an exonic splicing silencers site and cause abnormal splicing. According to HSF, c.1092 + 1G has a strong splice site with a score of 82.48, while c.1092 + 1G > A has a weak splice site (55.64). The score variation was −32.54% (under −10%), and thus the variant can break the wildtype site and likely affects splicing (Table 2). The c.1092 + 1G > A mutation in patient no. 5 (proband) was inherited from her mother. RTPCR analysis showed that patient no. 5 and her mother produced both authentic and aberrantly spliced RNAs of 386 and 233 bp, respectively, while her father produced only authentic spliced RNAs. cDNA sequencing further confirmed that exon 9 of the proband and her mother were spliced out, while the proband's father and control showed normal expression (Fig. 3a, c).
p.R392S
The reference sequence used in this study was based on the NCBI37/hg19 assembly of the human genome. NM_014384.2 was employed as reference sequence for ACAD8. ND: no data. N/A: not available.
3.295E-05 9.885E-05 1.885E-04 2.505E-05 3.432E-05 rs377629003 rs773472208 rs572820646 rs572619478 rs766307334 ND ND ND ND ND ND ND ND ND ND N/A N/A Potential alteration of splicing. Most Probably affecting splicing. N/A 0.999 0.999 0.999 1 0.999 −4.893 −5.744 0 N/A −5.664 Exon 3 Exon 3 Exon 4 IVS 9 Exon 10 1 2 3 4 5
c.235C > G c.286G > A c.444G > T c.1092 + 1G > A c.1176G > T
R79G G96S P148P
0 0 N/A N/A 0
0.811 1 N/A N/A 1
Mutation Taster PROVEAN PolyPhen-2 SIFT Protein change Nucleotide change Location No
Table 2 In silico prediction and analysis of the novel ACAD8 gene variants.
HSF
HGMD
ClinVar
dbSNP
Freq in ExAC
Freq in 1000 Genome
Y. Lin et al.
4. Discussion IBDHD was described for the first time in a 2-year-old girl who presented with cardiomyopathy, anemia, and carnitine deficiency at the age of 12 months [1]. Since then, approximately 20 patients have been reported, whereas IBDHD has been identified in only seven patients in Asian countries [13–17]. Little is known about the prevalence of IBDHD, Oglesbee et al. [17] found that the incidence of this disease is at least 1:70,000, Scolamiero et al. [18] identified a neonate with IBDHD among 45,466 infants screened in southern Italy. In contrast, Gallant et al. [19] reported the incidence of IBDHD by neonatal screening to be 1: 292,451 in California. The relatively high cutoff value (1.8 μM) of the California NBS program may explain the low incidence of IBDHD and increase the possibility of obtaining false-negative screening results. In this study, six newborns (patient no. 6 was not included in the incidence statistics) with IBDHD were identified by NBS for the first time in China, revealing an incidence of 1:51,557 for IBDHD in a Chinese population reported from a single center. The elevated concentrations of C4-acylcarnitine in blood spots samples together with the detection of isobutyryl-glycine in the urine, enabled differentiation of IBDHD from short-chain acyl-CoA dehydrogenase deficiency, which also resulted in an increased concentration of C4-acylcarnitine. However, isobutyryl-glycine is not always detectable in the urine of patients with IBDHD and genetic analysis should be performed to confirm the diagnosis [17]. All patients reported here 136
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Fig. 2. Three-dimensional modeling structure analysis of wild-type and ACAD8 mutant products. Green dashed lines represent hydrogen bonds and the green number shows the hydrogen bonds distances. a The p.Arg79Gly variant substitutes a hydrophilic arginine for hydrophobic glycine, which interfered with the original side chain hydrogen bonding with 152-Met and 153-Glu, resulting in abnormal folding of ACAD8. b The p.Gly96Ser variant leads to hydrophobic glycine altered by hydrophilic cysteine, which introduced two β-strands (89-Val to 93-Thr and 96-Ser to 100-Leu) that may have destabilized ACAD8. c The p.Arg392Ser variant may have altered the side chain conformations of the residues in the binding cavity and affect the ACAD8 quaternary structure to induce intramolecular hydrogen bonding with 395-Gln. Moreover, 392-Arg is closed to the catalytic residue Glu-398, and the induced hydrogen bond may block isovaleryl-CoA binding in the ACAD8 substrate binding pocket. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Fig. 3. Reverse transcription PCR analysis of the previously unreported splice site variant c.1092 + 1G > A. a cDNA gel electrophoresis. Lane 1: MW, DNA molecular weight marker (100–1000 bp); Gel electrophoresis analysis showed that the proband's father and control had the expected PCR products of 386 bp from exons 8 to 10, while additional PCR products of 233 bp corresponding to a lack of exon 9 were observed in the patient's and her mother's samples. b Schematic representation the effect of the splicing change. c Sequence of the wild-type cDNA amplification product and mutant cDNA amplification product, with the latter showing skipping of exon 9.
into account that one adult-onset patient with IBDHD presented with significant clinical symptoms such as muscle pain, weakness, third-degree atrioventricular block, and cardiomyopathy [9] and a mouse model of IBDHD grew normally but demonstrated cold intolerance at a young age with progressive hepatic steatosis [10], patients with IBDHD may exhibit clinical symptoms with age. Therefore, long-term follow-up and monitoring of these patients is essential for timely evaluating possible clinical symptoms. The pathogenic gene of IBDHD is ACAD8, which is located on chromosome 11q25 and contains 11 exons. To date, more than 22 ACAD8 mutations have been reported, with missense mutation as the most common type [16]. We genetically analyzed this rare disease in the Chinese population for the first time. Six different ACAD8 variants were identified, five of which were previously unreported (c.235C > G, c.286G > A, c.444G > T, c.1092 + 1G > A, and c.1176G > T). The c.1000C > T (p.Arg334Cys) variant was reported previously in
showed an abnormal C4 acylcarnitine spectrum in the blood, while isobutyrylglycine in the urine was indistinctive. Only one patient showed slightly increased excretion of isobutyrylglycine. Furthermore, all patients had biallelic variants in ACAD8. These findings indicate that urinary isobutyrylglycine is not a specific indicator and highlights the importance of genetic testing for disease diagnosis. As in previous studies [4], most patients reported in this study remained asymptomatic, whereas one juvenile (patient no. 6) had speech delay and one newborn (patient no. 7) exhibited clinical symptoms including hematemesis, hypotonia, feeding difficulty, and recurrent vomiting in the newborn period. Hematemesis has not been reported in previous patients with IBDHD. Given that the intrauterine fetal heart rate of patient no. 6 was more than 170 beats/min, clinical manifestation of hematemesis may be triggered by stressful gastric bleeding due to intrauterine distress. Thus, it is possible that the hematemesis symptom presented in this patient was not related to IBDHD. However, taking 137
Clinica Chimica Acta 487 (2018) 133–138
Y. Lin et al.
Project, China (Grant No. 2018Z160).
Caucasian and Korean populations [15,20]. The c.286G > A variant allelic frequency was up to 50% (7/14) in this study; two patients were homozygous and three were heterozygous for this variant, suggesting that it is a hot-spot mutation or founder mutation among Chinese patients with IBDHD. ACAD8 is a member of the mammalian acyl-CoA dehydrogenases, which consists of an NH2-terminal α-helical domain, medial β-strand domain, and C-terminal α-helical domain [2,21]. Computational analysis predicted that these previously unreported missense variants are pathogenic and conservation analysis showed that the residues Arg79, Gly96, and Arg392 are highly conserved. Additionally, 3D-modeling analysis showed that the three missense variants may result in instability of the ACAD8 protein structure. Overall, these previously unreported missense variants are likely disease-causing based on the results of various function-prediction algorithms. c.444G > T and c.1092 + 1G > A were predicted to be damaging by both MutationTaster and HSF, indicating that both variants cause a splicing change in the cDNA. For c.1092 + 1G > A, the variant is in the highly conserved donor splice site of intron 9 and an alteration in this position is likely disease-causing. Therefore, RT-PCR was performed and c.1092 + 1G > A was confirmed as a splice site mutation, causing skipping of exon 9 and leading to production of a truncated ACAD8 protein. For c.444G > T (p.Pro148Pro), although the substitution did not alter the amino acid sequence, the variant can lead to introduction of an exonic splicing silencer site and result in abnormal splicing, and thus the variant is likely pathogenic. Unfortunately, because the parents of both patients refused to undergo further investigation, we were unable to analyze the cDNA change in the patients, and further studies may be warranted to validate this variant. Hence, according to ACMG guidelines [12], c.1092 + 1G > A was classified as pathogenic, c.286G > A was classified as likely pathogenic, and c.235C > G, c.1176G > T, and c.444G > T were classified as variants of unknown significance. In addition to the splicing variant c.1092 + 1G > A, there is not sufficient evidence of support that the remaining four variants are pathogenic; however, we still predict that these variants are deleterious based on our bioinformatics analysis results. In summary, most patients with IBDHD diagnosed through NBS are free of symptoms and the clinical significance of IBDHD is unclear because of the limited number of cases. However, these cases are at risk of developing clinical manifestations, and thus close follow-up and monitoring is essential for detecting the gradual development of symptoms. Although urinary acylcarnitine analysis is a practical tool for diagnosing IBDHD, confirmatory genetic testing is desirable for suspected IBDHD cases following NBS.
Competing interests The authors declare that they have no competing interests. References [1] C.R. Roe, S.D. Cederbaum, D.S. Roe, R. Mardach, A. Galindo, L. Sweetman, Isolated isobutyryl-CoA dehydrogenase deficiency: an unrecognized defect in human valine metabolism, Mol. Genet. Metab. 65 (1998) 264–271. [2] K.P. Battaile, T.V. Nguyen, J. Vockley, J.J. Kim, Structures of isobutyryl-CoA dehydrogenase and enzyme-product complex: comparison with isovaleryl- and shortchain acyl-CoA dehydrogenases, J. Biol. Chem. 279 (2004) 16526–16534. [3] T.V. Nguyen, B.S. Andresen, T.J. Corydon, S. Ghisla, N. Abd-El Razik, A.W. Mohsen, et al., Identification of isobutyryl-CoA dehydrogenase and its deficiency in humans, Mol. Genet. Metab. 77 (2002) 68–79. [4] L. Pena, B. Angle, B. Burton, J. Charrow, Follow-up of patients with short-chain acyl-CoA dehydrogenase and isobutyryl-CoA dehydrogenase deficiencies identified through newborn screening: one center's experience. Genetics in medicine : official journal of the American College of, Medical Genetics 14 (2012) 342–347. [5] D.I. Zafeiriou, P. Augoustides-Savvopoulou, D. Haas, J. Smet, P. Triantafyllou, E. Vargiami, et al., Ethylmalonic encephalopathy: clinical and biochemical observations, Neuropediatrics 38 (2007) 78–82. [6] B. Merinero, C. Perez-Cerda, P. Ruiz Sala, I. Ferrer, M.J. Garcia, M. Martinez Pardo, et al., Persistent increase of plasma butyryl/isobutyrylcarnitine concentrations as marker of SCAD defect and ethylmalonic encephalopathy, J. Inherit. Metab. Dis. 29 (2006) 685. [7] A. Drousiotou, I. Dimeo, R. Mineri, T. Georgiou, G. Stylianidou, V. Tiranti, Ethylmalonic encephalopathy: application of improved biochemical and molecular diagnostic approaches, Clin. Genet. 79 (2011) 385–390. [8] J.O. Sass, S. Sander, J. Zschocke, Isobutyryl-CoA dehydrogenase deficiency: isobutyrylglycinuria and ACAD8 gene mutations in two infants, J. Inherit. Metab. Dis. 27 (2004) 741–745. [9] H. Nygaard, D. Gaist, M. Christensen, M. Dunø, M. Kjeldsen, H. Daaschrøder, et al., Isobutyryl-CoA dehydrogenase deficiency presenting with significant clinical disease in adulthood, The 18th Nordic Congress in Human Genetics. Reykjavik, Island, 2016. [10] N.G. Sabbagha, H.J. Kao, C.F. Yang, C.C. Huang, W.D. Lin, F.J. Tsai, et al., Alternative splicing in Acad8 resulting a mitochondrial defect and progressive hepatic steatosis in mice, Pediatr. Res. 70 (2011) 31–36. [11] M. Biasini, S. Bienert, A. Waterhouse, K. Arnold, G. Studer, T. Schmidt, et al., SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information, Nucleic Acids Res. 42 (2014) W252–W258. [12] S. Richards, N. Aziz, S. Bale, D. Bick, S. Das, J. Gastier-Foster, et al., Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology, Genetics Med. 17 (2015) 405–424. [13] M. Popek, M. Walter, M. Fernando, M. Lindner, K.O. Schwab, J.O. Sass, Two inborn errors of metabolism in a newborn: glutaric aciduria type I combined with isobutyrylglycinuria, Clinica Chimica Acta 411 (2010) 2087–2091. [14] S. Santra, A. Macdonald, M.A. Preece, R.K. Olsen, B.S. Andresen, Long-term outcome of isobutyryl-CoA dehydrogenase deficiency diagnosed following an episode of ketotic hypoglycaemia, Mol. Genet. Metabol. Rep. 10 (2017) 28–30. [15] E.H. Yoo, H.J. Cho, C.S. Ki, S.Y. Lee, Isobutyryl-CoA dehydrogenase deficiency with a novel ACAD8 gene mutation detected by tandem mass spectrometry newborn screening, Clin. Chem. Lab. Med. 45 (2007) 1495–1497. [16] J.W. Yun, K.I. Jo, H.I. Woo, S.Y. Lee, C.S. Ki, J.W. Kim, et al., A novel ACAD8 mutation in asymptomatic patients with isobutyryl-CoA dehydrogenase deficiency and a review of the ACAD8 mutation spectrum, Clin. Genet. 87 (2015) 196–198. [17] D. Oglesbee, M. He, N. Majumder, J. Vockley, A. Ahmad, B. Angle, et al., Development of a newborn screening follow-up algorithm for the diagnosis of isobutyryl-CoA dehydrogenase deficiency, Genet. Med. 9 (2007) 108–116. [18] E. Scolamiero, C. Cozzolino, L. Albano, A. Ansalone, M. Caterino, G. Corbo, et al., Targeted metabolomics in the expanded newborn screening for inborn errors of metabolism, Mol. BioSyst. 11 (2015) 1525–1535. [19] N.M. Gallant, K. Leydiker, H. Tang, L. Feuchtbaum, F. Lorey, R. Puckett, et al., Biochemical, molecular, and clinical characteristics of children with short chain acyl-CoA dehydrogenase deficiency detected by newborn screening in California, Mol. Genet. Metab. 106 (2012) 55–61. [20] C.B. Pedersen, C. Bischoff, E. Christensen, H. Simonsen, A.M. Lund, S.P. Young, et al., Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening, Pediatr. Res. 60 (2006) 315–320. [21] E.A. Telford, L.M. Moynihan, A.F. Markham, N.J. Lench, Isolation and characterisation of a cDNA encoding the precursor for a novel member of the acyl-CoA dehydrogenase gene family, Biochim. Biophys. Acta 1446 (1999) 371–376.
5. Conclusions This is the first report of clinical, biochemical, and genetic analysis of this rare disease in the Chinese population. Five previously unreported ACAD8 variants were identified, among which the c.286G > A variant was observed in five patients and was the most frequently detected variant. The identification of these previously unreported variants extends the landscape of genetic alterations in IBDHD. Identification of the most prevalent variant may facilitate genetic diagnoses of IBDHD within the population. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cca.2018.09.033. Acknowledgements We thank all the participants for their co-operation. This study was supported by the Quanzhou Municipal Science and Technology Plan
138