- Email: [email protected]
Clinical relevance of hepatitis G virus (HGV) infection in heart transplant patients
CLINICAL HEART TRANSPLANTATION
Clinical Relevance of Hepatitis G Virus (HGV) Infection in Heart Transplant Patients Birgit Kallinowski, MD,a Manuela Janicki,a Renate Seelig, MD,b Stefanie Seipp, MD,b Jens Hagel, MD,c Thomas Dengler, MD,c Peter Schnitzler, MD,d Lorenz Theilmann, MD,d Wolfgang Stremmel, MDd To investigate whether the recently discovered hepatitis G virus (HGV) influences the clinical outcome of heart transplant recipients under immunosuppression, we determined the prevalence of HGV infections correlated with liver function and survival in 51 patients. Presence of HGV RNA and anti-E2, a marker for resolved HGV infection, were serially tested in sera from patients before and after heart transplantation (HTX) by nested RTPCR and ELISA. Four of 51 (7.8%) patients before transplantation, and 22 of 50 patients (44%) after transplantation showed signs of persistent or resolved HGV infection. HGV infection was not associated with impairment of liver function or with patient survival. In summary, presence of HGV infection does not influence the clinical outcome in heart transplant patients. J Heart Lung Transplant 1999;18:190–193.
L
iver disease caused by parenterally transmitted viruses is an important cause of morbidity and mortality among organ transplant recipients.1 A novel flavilike RNA virus, named hepatitis G virus (HGV), discovered by Linnen and associates,2 has been identified in sera from individuals in whom hepatitis A to E viruses were excluded as underlying causes.3,4 HGV seems to be an exclusively humanopathogenic virus and is transmitted parenterally, i.e. by blood transfusions and probably by organ transplantation.5 With a prevalence of 1.7% to 3.6% among healthy blood donors, HGV infection is quite common,3–7 but only a From the Department of Medicine, University of Heidelberg,a Laboratory Drs. Seelig Karlsruheb, Department of Cardiovascular Surgeryc, Department of Virology,d University of Heidelberg, Heidelberg, Germany. Submitted September 24, 1997; accepted September 21, 1998. Corresponding author: Birgit Kallinowski, MD, Department of Internal Medicine IV, University of Heidelberg, Bergheimer Str. 58, D-69115 Heidelberg. Telephone: 49-6221-568611. Fax: 49-6221-565255. This work was supported in part by grants from the Forschungsschwerpunkt Transplantation der Medizinischen Fakulta¨t Heidelberg. Copyright © 1999 by the International Society for Heart and Lung Transplantation. 1053-2498/99/$–see front matter PII S1053-2498(98)00034-5
190
minority (5% to 10%) of HGV-infected patients develop mild hepatitis.6 The prevalence of HGV infection among intravenous drug abusers is 15% to 26%,8,9 among long-term hemodialysis patients 3% to 55%,7,10,11 and up to 36% among liver transplant recipients.12 Despite its hepatotropic character, the pathogenicity by HGV became increasingly questionable in immunocompetent individuals.6,12,13 To study whether HGV infection in heart transplant patients under immunosuppression worsens the clinical outcome of these patients, we retrospectively investigated the prevalence of HGV infections before and after orthotopic heart transplantation. We correlated the presence of this virus with liver function tests, transfusions, rejection episodes, and survival in HGVpositive vs HGV-negative patients. In addition, we wanted to clarify the relation between HGV viremia and the presence of antibodies to the E2 protein, a potential marker for resolved HGV infection.14,15
MATERIALS AND METHODS Study population Fifty-one of a total of 164 patients who received a heart transplant were studied retrospectively. At least 3 frozen sera per patient were investigated (1
The Journal of Heart and Lung Transplantation Volume 18, Number 3
serum dating 3 to 5 months before transplantation, 1 serum sample 3 6 0.5 months postoperatively, and the last available serum sample (4 to 66 months after HTX). Among the 51 (7 female, 44 male) heart transplant patients, 42 (82.3%) were German, the remaining 9 (17.7%) patients were from Southern and Eastern Europe. Records were reviewed to determine the number of blood products given intraoperatively, liver function tests, the protocol of immunosuppression, episodes of rejection, and patient survival.
Kallinowski et al.
191
Statistical analysis Results were expressed as mean 6 standard deviation (SD). Comparisons between HGV-positive and HGV-negative patients were calculated using the Mann-Whitney U test. All p-values were 2-tailed, and a p-value of less than 0.05 was considered statistically significant.
RESULTS Prevalence of HGV infection before transplantation
All endomyocardial biopsy specimens, exclusively obtained for diagnostic purposes, were examined by a single, experienced pathologist, and histologic classification was done according to standard ISHLT nomenclature.16 An individual ratio of the sum of the ISHLT grading and number of biopsy specimens taken was calculated per patient. We called this ratio biopsy score.
In 1 of 51 (1.9%) of the heart transplant candidates, HGV RNA was detected by PCR. This patient remained positive for HGV and negative for anti-E2 for at least 4.4 years postoperatively. Three of 51 (5.9%) heart transplant patients were positive for anti-E2 but negative for HGV RNA before transplantation and remained positive for this marker for the entire follow-up period postoperatively. In summary, 4 of 51 (7.8%) patients awaiting a heart transplantation had serological signs of persistent or resolved HGV infection.
Virologic assessment
Prevelance and clinical impact of HGV infection after transplantation
HGV was detected by nested RT-PCR using primers derived from the 59UTR region sequence deposited in GENBANK (accession numbers: U 36380, U 44402, and U 45966.3,7 After RNA extraction, reverse transcription to cDNA was performed using the outer antisense primer, as described by Seipp and colleagues.17 To enhance sensitivity and ascertain specificity of the PCR product, a second round of amplification was performed using internal primers, using the same conditions as outlined for the first round of PCR. Primers were designed to yield maximal discrimination against hepatitis C virus. Outer primers were: a3 (antisense): 59CCCCACTGGTCCTTGTCAACTCGCCG-39, s3 (sense): 59ATGACAGGGTTGGTAGGTCGTAAATC 39. Inner primers were: a4 (antisense) 59-ACATTGAAGGGCGACGTGGACCGTAC-39, s4 (sense) 59-TGGTAGCCACTAGGTGGGTCTTAA-39. Amplified products (expected size 145 bp) were visualized under UV light after 2% agarose gel electrophoresis and ethidium bromide staining. PCR products were cloned into blunt-ended pUC 18 plasmids, and two clones per HGV-positive serum sample were sequenced partially by using the T7 sequencing kit (Pharmacia, Uppsala, Sweden) to confirm specificity of HGV. Presence of anti-E2 was determined by an ELISA according to the manufacturer’s instructions (Boehringer Mannheim, Mannheim, Germany).
Eighteen of the remaining 50 patients, who were negative for HGV before HTX (Table 1), became infected with HGV after HTX, indicating a prevalence of hepatitis G viremia after transplantation of 36%. In 17 of 18 (94.4%) cases, HGV RNA persisted for the entire follow-up period, a maximum of 5.5 years (34.1 6 21.2 months, range: 4 to 66 months). One of 18 HGV-positive patients cleared the virus and developed antibodies to anti-E2 despite immunosuppression, 19 months postoperatively. Three of 51 patients who were positive for anti-E2 preoperatively remained positive for this antibody throughout the postoperative period. In our study, all individuals positive for anti-E2 were HGV RNA-negative, and vice versa, which indicates that once patients develop a humoral response against HGV the virus has been cleared from the serum. Anti-E2 might be a protective antibody for HGV infection. Altogether we found 44% (22 of 50) heart transplant patients who had signs of persistent or resolved hepatitis G virus infection. HGV-positive patients had received more blood transfusions intraoperatively (7.2 6 4.4 red cell packs and or platelet packs) compared to HGVnegative transplant recipients (5.3 6 4.6), although this result did not reach statistical significance (p 5 0.09, Table 1). ALT and AST levels as well as other liver function tests such as cholinesterase and partial
Histologic assessment
192
Kallinowski et al.
The Journal of Heart and Lung Transplantation March 1999
TABLE 1 Epidemiologic data from HGV RNA-negative and HGV RNA-positive heart transplant patients. Number of patients (%) Age (years) ALT (U/l) Bilirubin (mg/dl) Rejection grade .R2* Biopsy score 1 Transfusions # Survival (days)
HGV RNA-negative
HGV RNA-positive
p-value
32/51 (62.7%) 53 6 8 7 6 15 0.3 6 0.3 2.8 6 2.4 0.9 6 0.4 5.3 6 4.6 970 6 484
18/50 (36%) 49 6 10 564 0.7 6 0.6 2.6 6 2.1 0.9 6 0.4 7.2 6 4.4 1025 6 637
0.4 0.23 0.11 0.89 0.97 0.09 0.88
Values are expressed as mean 6 SD. * 5 Number of rejections with a rejection grade higher than 2 (significant rejection) as defined by the ISHLT nomenclature. 1 5 Individual biopsy score: sum of ISHLT score/number of biopsies taken. # 5 Intraoperatively given red cell packs, platelets, and fresh frozen plasma.
thrombin time remained within normal limits in all HGV-positive individuals. HGV-positive patients did not differ in number or in severity of rejection episodes, defined by the biopsy score, from HGVnegative patients (Table 1). HGV infection did not impair survival either (Table 1).
DISCUSSION Whether HGV influences the clinical outcome of heart transplant recipients, who run a higher risk of acquiring hepatotropic viral infections,18 is not known. To our knowledge this is the first investigation that correlated HGV viremia and presence of putative antibodies in serial blood samples in a well-defined cohort of heart transplant patients. In this study 7.8% (4 of 51) of heart transplant candidates had been exposed to HGV before HTX. A similar percentage has been described for healthy individuals.14,15 Therefore we assume that heart transplant candidates do not run a higher risk of acquiring a HGV infection than healthy controls. After heart transplantation, 36% of HTX patients were positive for HGV RNA. Comparable HGV prevalences were found in liver transplant recipients,12,13 whereas Wolff and colleagues19 described a lower HGV viremia of 24% among heart transplant patients. Whether the high frequency of HGV after HTX was in all instances the consequence of a true new infection remains to be determined. Another explanation could be that preoperative HGV levels, due to low-level replication, were just too low to be detected by PCR. This phenomenon of low-level pretransplant viremia followed by high-level posttransplant viremia already has been demonstrated in hepatitis C virus-infected patients.20 Transfusion of blood products given intraoperatively could have
been responsible for the high rate of HGV infection after transplantation, considering that HGV infections are present in about 0.9% to 3.6% of healthy blood donors.2–7 However, in the present study we detected only a weak but not significant correlation between the number of blood transfusions given and HGV infection, a result also found by Dickson and coworkers.13 In addition, the number of individuals investigated per study group (HGV-positive vs HGV-negative) might have been too small to achieve statistical significance. Furthermore, it can not be excluded that parenteral transmission took place by the donor organs that had not been tested for the presence of HGV RNA, as suggested by Murthy.5 To determine the clinical relevance of this novel virus, we correlated the occurence of clinical hepatitis, graft rejections, and patient survival with HGV viremia. No significant differences were observed between the 2 groups (HGV-positive vs HGVnegative) concerning aminotransferases and bilirubin levels, or in number and severity of rejection episodes. From these findings and those of other studies,19 there is evidence that HGV infection after heart transplantation does not contribute to a more severe course of liver disease5,6 in contrast to acquired hepatitis B and hepatitis C virus infection.18 Furthermore, HGV positivity did not influence survival of heart transplant patients, an observation that is also supported by studies of liver transplant recipients.12,13 In summary, HGV seems to have little impact on the clinical outcome of heart transplant patients. Due to the minor clinical importance of HGV, testing of donor organs and/or blood products for HGV does not as yet seem to be justified. Even in
The Journal of Heart and Lung Transplantation Volume 18, Number 3
immunocompromised patients, such as heart transplant patients, anti-E2 may serve as a valid marker for resolved HGV infection.14,15
Kallinowski et al.
11.
REFERENCES 1. Natov S, Pereira B. Transmission of disease by organ transplantation. In: Chapman J, Deierhoi M, Wight C, eds. Organ and tissue donation for transplantation. London: Edward Arnold, 1996. 2. Linnen J, Wages J, Zhang-Keck Z, et al. Molecular cloning and disease association of hepatitis G virus: a transfusion transmissible agent. Science 1996;271:505– 8. 3. Simons J, Leary T, Dawson G, et al. Isolation of novel virus-like sequences associated with human hepatitis. Nature Med 1995;1:564 –9. 4. Leary T, Muerhoff A, Simons J, et al. Sequence and genomic organization of GBV-C: a novel member of the Flaviviridae associated with human non-A-C hepatitis. J Med Virol 1996;48:60 –7. 5. Murthy B, Muerhoff A, Desai S, et al. GB hepatitis agent in cadaver organ donors and their recipients. Transplantation 1997;63:346 –51. 6. Alter H, Nakatsuji Y, Melpolder J, et al. The incidence of transfusion-associated hepatitis G virus infection and its relation to liver disease. N Engl J Med 1997;336:747–54. 7. Kallinowski B, Ahmadi R, Seipp S, et al. Clinical impact of GB-C virus in hemodialysis patients. Nephrol Dial Transplant 1998;1:93– 8. 8. Goeser T, Seipp S, Wahl R, Mu ¨ller H, Stremmel W, Theilmann L. Clinical presentation of GB-C virus infection in drug abusers with chronic hepatitis C. J Hepatol 1997;26: 498 –502. 9. Thomas D, Nakatsuji Y, Shih H, et al. Persistence and clinical significance of hepatitis G virus infections in injecting drug users. J Infect Dis 1997;176:586 –92. 10. Masuko K, Mitsui T, Iwano K, et al. Infection with hepatitis
12.
13.
14.
15.
16.
17.
18.
19.
20.
193
GB virus in patients on maintenance hemodialysis. N Engl J Med 1996;334:1485–90. Tsuda F, Hadiwandowo S, Sawada N, et al. Infection with GB virus C (GBV-C) in patients with chronic liver disease or on maintenance hemodialysis in Indonesia. J Med Virol 1996; 49:248 –53. Kallinowski B, Buhrmann C, Seipp S, et al. Incidence, prevalence, and clinical outcome of GBV-C infection in liver transplant patients. Liver Transplant Surgery, 1998; 4:28 –33. Dickson R, Qian K, Lau JY. High prevalence of GB virusC/hepatitis G virus infection in liver transplant recipients. Transplantation 1997;63:1695–7. Tacke M, Kiyosawa K, Stark K, Schlueter V. Detection of antibodies to a putative hepatitis G virus envelope protein. Lancet 1997;349:318 –20. Dille B, Surowy N, Gutierrez R, et al. An ELISA for detection of antibodies to the E2 protein of GB virus C. J Infect Dis 1997;175:458 – 61. Billingham M, Cary N, Hammond M, et al. A working formulation for the standardization of nomenclature in the diagnosis of heart and lung rejection: Heart Rejection Study Group. The International Society for Heart Transplantation. J Heart Transplant 1990;9:587–93. Seipp S, Wahl R, Selzer S, et al. Sequence analysis of hepatitis GB virus (GBV-C) isolates from 14 patients. Virus Res 1996;46:81– 8. Lake K, Smith C, Milfred La-Forest S, Pritzker M, Emery R. Outcome of hepatitis C positive (HCV1) heart transplant recipients. Transplant Proc 1997;29:581–2. Wolff D, Ko ¨rner M, Wolff C, Ko ¨rfer R, Kleesiek K. Transfusion-related hepatitis G virus infections in heart transplant recipients. Transplantation 1996;62:1697– 8. Fukomoto T, Berg T, Naumann U, et al. HCV RNA titers in the early course after orthotopic liver transplantation in patients with chronic hepatitis C (abstract). Hepatology 1995;23:A18.
Clinical Relevance of Hepatitis G Virus (HGV) Infection in Heart Transplant Patients Birgit Kallinowski, MD,a Manuela Janicki,a Renate Seelig, MD,b Stefanie Seipp, MD,b Jens Hagel, MD,c Thomas Dengler, MD,c Peter Schnitzler, MD,d Lorenz Theilmann, MD,d Wolfgang Stremmel, MDd To investigate whether the recently discovered hepatitis G virus (HGV) influences the clinical outcome of heart transplant recipients under immunosuppression, we determined the prevalence of HGV infections correlated with liver function and survival in 51 patients. Presence of HGV RNA and anti-E2, a marker for resolved HGV infection, were serially tested in sera from patients before and after heart transplantation (HTX) by nested RTPCR and ELISA. Four of 51 (7.8%) patients before transplantation, and 22 of 50 patients (44%) after transplantation showed signs of persistent or resolved HGV infection. HGV infection was not associated with impairment of liver function or with patient survival. In summary, presence of HGV infection does not influence the clinical outcome in heart transplant patients. J Heart Lung Transplant 1999;18:190–193.
L
iver disease caused by parenterally transmitted viruses is an important cause of morbidity and mortality among organ transplant recipients.1 A novel flavilike RNA virus, named hepatitis G virus (HGV), discovered by Linnen and associates,2 has been identified in sera from individuals in whom hepatitis A to E viruses were excluded as underlying causes.3,4 HGV seems to be an exclusively humanopathogenic virus and is transmitted parenterally, i.e. by blood transfusions and probably by organ transplantation.5 With a prevalence of 1.7% to 3.6% among healthy blood donors, HGV infection is quite common,3–7 but only a From the Department of Medicine, University of Heidelberg,a Laboratory Drs. Seelig Karlsruheb, Department of Cardiovascular Surgeryc, Department of Virology,d University of Heidelberg, Heidelberg, Germany. Submitted September 24, 1997; accepted September 21, 1998. Corresponding author: Birgit Kallinowski, MD, Department of Internal Medicine IV, University of Heidelberg, Bergheimer Str. 58, D-69115 Heidelberg. Telephone: 49-6221-568611. Fax: 49-6221-565255. This work was supported in part by grants from the Forschungsschwerpunkt Transplantation der Medizinischen Fakulta¨t Heidelberg. Copyright © 1999 by the International Society for Heart and Lung Transplantation. 1053-2498/99/$–see front matter PII S1053-2498(98)00034-5
190
minority (5% to 10%) of HGV-infected patients develop mild hepatitis.6 The prevalence of HGV infection among intravenous drug abusers is 15% to 26%,8,9 among long-term hemodialysis patients 3% to 55%,7,10,11 and up to 36% among liver transplant recipients.12 Despite its hepatotropic character, the pathogenicity by HGV became increasingly questionable in immunocompetent individuals.6,12,13 To study whether HGV infection in heart transplant patients under immunosuppression worsens the clinical outcome of these patients, we retrospectively investigated the prevalence of HGV infections before and after orthotopic heart transplantation. We correlated the presence of this virus with liver function tests, transfusions, rejection episodes, and survival in HGVpositive vs HGV-negative patients. In addition, we wanted to clarify the relation between HGV viremia and the presence of antibodies to the E2 protein, a potential marker for resolved HGV infection.14,15
MATERIALS AND METHODS Study population Fifty-one of a total of 164 patients who received a heart transplant were studied retrospectively. At least 3 frozen sera per patient were investigated (1
The Journal of Heart and Lung Transplantation Volume 18, Number 3
serum dating 3 to 5 months before transplantation, 1 serum sample 3 6 0.5 months postoperatively, and the last available serum sample (4 to 66 months after HTX). Among the 51 (7 female, 44 male) heart transplant patients, 42 (82.3%) were German, the remaining 9 (17.7%) patients were from Southern and Eastern Europe. Records were reviewed to determine the number of blood products given intraoperatively, liver function tests, the protocol of immunosuppression, episodes of rejection, and patient survival.
Kallinowski et al.
191
Statistical analysis Results were expressed as mean 6 standard deviation (SD). Comparisons between HGV-positive and HGV-negative patients were calculated using the Mann-Whitney U test. All p-values were 2-tailed, and a p-value of less than 0.05 was considered statistically significant.
RESULTS Prevalence of HGV infection before transplantation
All endomyocardial biopsy specimens, exclusively obtained for diagnostic purposes, were examined by a single, experienced pathologist, and histologic classification was done according to standard ISHLT nomenclature.16 An individual ratio of the sum of the ISHLT grading and number of biopsy specimens taken was calculated per patient. We called this ratio biopsy score.
In 1 of 51 (1.9%) of the heart transplant candidates, HGV RNA was detected by PCR. This patient remained positive for HGV and negative for anti-E2 for at least 4.4 years postoperatively. Three of 51 (5.9%) heart transplant patients were positive for anti-E2 but negative for HGV RNA before transplantation and remained positive for this marker for the entire follow-up period postoperatively. In summary, 4 of 51 (7.8%) patients awaiting a heart transplantation had serological signs of persistent or resolved HGV infection.
Virologic assessment
Prevelance and clinical impact of HGV infection after transplantation
HGV was detected by nested RT-PCR using primers derived from the 59UTR region sequence deposited in GENBANK (accession numbers: U 36380, U 44402, and U 45966.3,7 After RNA extraction, reverse transcription to cDNA was performed using the outer antisense primer, as described by Seipp and colleagues.17 To enhance sensitivity and ascertain specificity of the PCR product, a second round of amplification was performed using internal primers, using the same conditions as outlined for the first round of PCR. Primers were designed to yield maximal discrimination against hepatitis C virus. Outer primers were: a3 (antisense): 59CCCCACTGGTCCTTGTCAACTCGCCG-39, s3 (sense): 59ATGACAGGGTTGGTAGGTCGTAAATC 39. Inner primers were: a4 (antisense) 59-ACATTGAAGGGCGACGTGGACCGTAC-39, s4 (sense) 59-TGGTAGCCACTAGGTGGGTCTTAA-39. Amplified products (expected size 145 bp) were visualized under UV light after 2% agarose gel electrophoresis and ethidium bromide staining. PCR products were cloned into blunt-ended pUC 18 plasmids, and two clones per HGV-positive serum sample were sequenced partially by using the T7 sequencing kit (Pharmacia, Uppsala, Sweden) to confirm specificity of HGV. Presence of anti-E2 was determined by an ELISA according to the manufacturer’s instructions (Boehringer Mannheim, Mannheim, Germany).
Eighteen of the remaining 50 patients, who were negative for HGV before HTX (Table 1), became infected with HGV after HTX, indicating a prevalence of hepatitis G viremia after transplantation of 36%. In 17 of 18 (94.4%) cases, HGV RNA persisted for the entire follow-up period, a maximum of 5.5 years (34.1 6 21.2 months, range: 4 to 66 months). One of 18 HGV-positive patients cleared the virus and developed antibodies to anti-E2 despite immunosuppression, 19 months postoperatively. Three of 51 patients who were positive for anti-E2 preoperatively remained positive for this antibody throughout the postoperative period. In our study, all individuals positive for anti-E2 were HGV RNA-negative, and vice versa, which indicates that once patients develop a humoral response against HGV the virus has been cleared from the serum. Anti-E2 might be a protective antibody for HGV infection. Altogether we found 44% (22 of 50) heart transplant patients who had signs of persistent or resolved hepatitis G virus infection. HGV-positive patients had received more blood transfusions intraoperatively (7.2 6 4.4 red cell packs and or platelet packs) compared to HGVnegative transplant recipients (5.3 6 4.6), although this result did not reach statistical significance (p 5 0.09, Table 1). ALT and AST levels as well as other liver function tests such as cholinesterase and partial
Histologic assessment
192
Kallinowski et al.
The Journal of Heart and Lung Transplantation March 1999
TABLE 1 Epidemiologic data from HGV RNA-negative and HGV RNA-positive heart transplant patients. Number of patients (%) Age (years) ALT (U/l) Bilirubin (mg/dl) Rejection grade .R2* Biopsy score 1 Transfusions # Survival (days)
HGV RNA-negative
HGV RNA-positive
p-value
32/51 (62.7%) 53 6 8 7 6 15 0.3 6 0.3 2.8 6 2.4 0.9 6 0.4 5.3 6 4.6 970 6 484
18/50 (36%) 49 6 10 564 0.7 6 0.6 2.6 6 2.1 0.9 6 0.4 7.2 6 4.4 1025 6 637
0.4 0.23 0.11 0.89 0.97 0.09 0.88
Values are expressed as mean 6 SD. * 5 Number of rejections with a rejection grade higher than 2 (significant rejection) as defined by the ISHLT nomenclature. 1 5 Individual biopsy score: sum of ISHLT score/number of biopsies taken. # 5 Intraoperatively given red cell packs, platelets, and fresh frozen plasma.
thrombin time remained within normal limits in all HGV-positive individuals. HGV-positive patients did not differ in number or in severity of rejection episodes, defined by the biopsy score, from HGVnegative patients (Table 1). HGV infection did not impair survival either (Table 1).
DISCUSSION Whether HGV influences the clinical outcome of heart transplant recipients, who run a higher risk of acquiring hepatotropic viral infections,18 is not known. To our knowledge this is the first investigation that correlated HGV viremia and presence of putative antibodies in serial blood samples in a well-defined cohort of heart transplant patients. In this study 7.8% (4 of 51) of heart transplant candidates had been exposed to HGV before HTX. A similar percentage has been described for healthy individuals.14,15 Therefore we assume that heart transplant candidates do not run a higher risk of acquiring a HGV infection than healthy controls. After heart transplantation, 36% of HTX patients were positive for HGV RNA. Comparable HGV prevalences were found in liver transplant recipients,12,13 whereas Wolff and colleagues19 described a lower HGV viremia of 24% among heart transplant patients. Whether the high frequency of HGV after HTX was in all instances the consequence of a true new infection remains to be determined. Another explanation could be that preoperative HGV levels, due to low-level replication, were just too low to be detected by PCR. This phenomenon of low-level pretransplant viremia followed by high-level posttransplant viremia already has been demonstrated in hepatitis C virus-infected patients.20 Transfusion of blood products given intraoperatively could have
been responsible for the high rate of HGV infection after transplantation, considering that HGV infections are present in about 0.9% to 3.6% of healthy blood donors.2–7 However, in the present study we detected only a weak but not significant correlation between the number of blood transfusions given and HGV infection, a result also found by Dickson and coworkers.13 In addition, the number of individuals investigated per study group (HGV-positive vs HGV-negative) might have been too small to achieve statistical significance. Furthermore, it can not be excluded that parenteral transmission took place by the donor organs that had not been tested for the presence of HGV RNA, as suggested by Murthy.5 To determine the clinical relevance of this novel virus, we correlated the occurence of clinical hepatitis, graft rejections, and patient survival with HGV viremia. No significant differences were observed between the 2 groups (HGV-positive vs HGVnegative) concerning aminotransferases and bilirubin levels, or in number and severity of rejection episodes. From these findings and those of other studies,19 there is evidence that HGV infection after heart transplantation does not contribute to a more severe course of liver disease5,6 in contrast to acquired hepatitis B and hepatitis C virus infection.18 Furthermore, HGV positivity did not influence survival of heart transplant patients, an observation that is also supported by studies of liver transplant recipients.12,13 In summary, HGV seems to have little impact on the clinical outcome of heart transplant patients. Due to the minor clinical importance of HGV, testing of donor organs and/or blood products for HGV does not as yet seem to be justified. Even in
The Journal of Heart and Lung Transplantation Volume 18, Number 3
immunocompromised patients, such as heart transplant patients, anti-E2 may serve as a valid marker for resolved HGV infection.14,15
Kallinowski et al.
11.
REFERENCES 1. Natov S, Pereira B. Transmission of disease by organ transplantation. In: Chapman J, Deierhoi M, Wight C, eds. Organ and tissue donation for transplantation. London: Edward Arnold, 1996. 2. Linnen J, Wages J, Zhang-Keck Z, et al. Molecular cloning and disease association of hepatitis G virus: a transfusion transmissible agent. Science 1996;271:505– 8. 3. Simons J, Leary T, Dawson G, et al. Isolation of novel virus-like sequences associated with human hepatitis. Nature Med 1995;1:564 –9. 4. Leary T, Muerhoff A, Simons J, et al. Sequence and genomic organization of GBV-C: a novel member of the Flaviviridae associated with human non-A-C hepatitis. J Med Virol 1996;48:60 –7. 5. Murthy B, Muerhoff A, Desai S, et al. GB hepatitis agent in cadaver organ donors and their recipients. Transplantation 1997;63:346 –51. 6. Alter H, Nakatsuji Y, Melpolder J, et al. The incidence of transfusion-associated hepatitis G virus infection and its relation to liver disease. N Engl J Med 1997;336:747–54. 7. Kallinowski B, Ahmadi R, Seipp S, et al. Clinical impact of GB-C virus in hemodialysis patients. Nephrol Dial Transplant 1998;1:93– 8. 8. Goeser T, Seipp S, Wahl R, Mu ¨ller H, Stremmel W, Theilmann L. Clinical presentation of GB-C virus infection in drug abusers with chronic hepatitis C. J Hepatol 1997;26: 498 –502. 9. Thomas D, Nakatsuji Y, Shih H, et al. Persistence and clinical significance of hepatitis G virus infections in injecting drug users. J Infect Dis 1997;176:586 –92. 10. Masuko K, Mitsui T, Iwano K, et al. Infection with hepatitis
12.
13.
14.
15.
16.
17.
18.
19.
20.
193
GB virus in patients on maintenance hemodialysis. N Engl J Med 1996;334:1485–90. Tsuda F, Hadiwandowo S, Sawada N, et al. Infection with GB virus C (GBV-C) in patients with chronic liver disease or on maintenance hemodialysis in Indonesia. J Med Virol 1996; 49:248 –53. Kallinowski B, Buhrmann C, Seipp S, et al. Incidence, prevalence, and clinical outcome of GBV-C infection in liver transplant patients. Liver Transplant Surgery, 1998; 4:28 –33. Dickson R, Qian K, Lau JY. High prevalence of GB virusC/hepatitis G virus infection in liver transplant recipients. Transplantation 1997;63:1695–7. Tacke M, Kiyosawa K, Stark K, Schlueter V. Detection of antibodies to a putative hepatitis G virus envelope protein. Lancet 1997;349:318 –20. Dille B, Surowy N, Gutierrez R, et al. An ELISA for detection of antibodies to the E2 protein of GB virus C. J Infect Dis 1997;175:458 – 61. Billingham M, Cary N, Hammond M, et al. A working formulation for the standardization of nomenclature in the diagnosis of heart and lung rejection: Heart Rejection Study Group. The International Society for Heart Transplantation. J Heart Transplant 1990;9:587–93. Seipp S, Wahl R, Selzer S, et al. Sequence analysis of hepatitis GB virus (GBV-C) isolates from 14 patients. Virus Res 1996;46:81– 8. Lake K, Smith C, Milfred La-Forest S, Pritzker M, Emery R. Outcome of hepatitis C positive (HCV1) heart transplant recipients. Transplant Proc 1997;29:581–2. Wolff D, Ko ¨rner M, Wolff C, Ko ¨rfer R, Kleesiek K. Transfusion-related hepatitis G virus infections in heart transplant recipients. Transplantation 1996;62:1697– 8. Fukomoto T, Berg T, Naumann U, et al. HCV RNA titers in the early course after orthotopic liver transplantation in patients with chronic hepatitis C (abstract). Hepatology 1995;23:A18.