- Email: [email protected]
Cloning a calcium channel α2δ-3 subunit gene from a putative tumor suppressor gene region at chromosome 3p21.1 in conventional renal cell carcinoma
Gene 264 (2001) 69±75
www.elsevier.com/locate/gene
Cloning a calcium channel a2d-3 subunit gene from a putative tumor suppressor gene region at chromosome 3p21.1 in conventional renal cell carcinoma Susanne Hanke, Peter Bugert, Jerzy Chudek 1, Gyula Kovacs* Laboratory of Molecular Oncology, Department of Urology, University of Heidelberg, Im Neuenheimer Feld 365, D-69120 Heidelberg, Germany Received 28 August 2000; received in revised form 1 December 2000; accepted 11 December 2000 Received by T. Sekiya
Abstract We have identi®ed loss of heterozygosity (LOH) of approx. 1 cM region around locus D3S1289 at chromosome 3p21.1 in a conventional renal cell carcinoma (RCC). During construction of a YAC/BAC contig for this region and shotgun sequencing of BACs 277p5, 55m24 and 428i24, we detected four new microsatellites. We narrowed down the target region by analysing these new loci to less than 100 kb within the BAC 55m24 and subsequently cloned a human calcium channel a2d-3 subunit gene. This gene is widely expressed in fetal tissues and different types of adult tumors. The exons of the a2d-3 subunit gene are distributed along approx. 500 kb DNA sequences. As the LOH involved exclusively intronic sequences and sequencing the entire coding region did not reveal any mutation, the a2d-3 subunit gene is probably not a tumor suppressor gene. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Deletion mapping; BAC contig; Positional cloning; Mutation analysis
1. Introduction Deletion of chromosome 3p is the most frequent genetic change in sporadic and von Hippel-Lindau disease (VHL) associated conventional renal cell carcinomas (RCC) (Kovacs and Frisch, 1989; Kovacs et al., 1991). The VHL gene has been cloned from the chromosome 3p25 region (Latif et al., 1993). Because of somatic mutation of one allele of the VHL gene occurs in approximately 50% of sporadic conventional RCCs, it was suggested to be the RCC tumor suppressor gene (Gnarra et al., 1994). A comprehensive microsatellite study mapped the smallest overlapping deletion to a large region of approx. 55 cM between loci D3S1560 and D3S3666 in nearly 100% of conventional RCCs (Chudek et al., 1997). Although, this deletion at the most distal end includes the VHL gene, the constant loss of a large chromosomal region suggests the Abbreviations: BAC, bacterial arte®cial chromosome; LOH, loss of heterozygosity; RCC, renal cell carcinoma; STS, sequenced tagged site; VHL, von Hippel-Lindau; YAC, yeast arte®cial chromosome * Corresponding author. Tel.: 149-6221-566519; fax: 149-6221564634. E-mail address: [email protected] (G. Kovacs). 1 Present address: Department of Nephrology, Endocrinology and Metabolic Diseases, Silesian Medical School, Katowice, Poland.
involvement of another gene in the development of RCC. Several deletion mapping as well as chromosomal replacement studies have been undertaken to localize and clone the RCC tumor suppressor gene during the last 10 years but without success (Foster et al., 1994; van der Hout et al., 1991; Killary et al., 1992; Lott et al., 1998; Lubinski et al., 1994; Sanchez et al., 1994; Yamakawa et al., 1991). In this report, we describe the identi®cation of LOH of 100 kb in size at chromosome 3p21.1 in a conventional RCC and cloning the a2d-3 calcium channel subunit gene.
2. Materials and methods 2.1. Microsatellite analysis DNA was isolated from short term cultures of normal kidney and tumor tissues as described (Chudek et al., 1997). Microsatellites were ampli®ed from 50 ng DNA using 5 pmoles each of forward (Cy5-labeled at 5 0 -end) and reverse primer, 50 mM KCl, 10 mM Tris-HCl pH 8.5, 1.5 mM MgCl2, and 1 unit Taq polymerase (Life Technologies, Karlsruhe, Germany) in a 10 ml reaction volume. The 28 PCR cycles consistent of 30 s denaturation at 948C, 30 s annealing at 558C, and 30 s extension at 728C and was
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(00)00600-4
70
S. Hanke et al. / Gene 264 (2001) 69±75
performed on a PTC200 (MJ-Research Inc., Watertown, Massachusetts) thermocycler. PCR products were analyzed on an ALFexpress system (Amersham Pharmacia Biotech, Freiburg, Germany) with the use of the Fragment Manager (FM 1.2) software. 2.2. Construction of an integrated YAC/BAC contig YAC clones (WC3.10 contig, www.genome.wi.mit.edu) were obtained from CEPH. High molecular weight yeast DNA plugs were prepared and pulsed-®eld electrophoresis was performed to control the size of YACs using the CHEFDRII system (Bio-Rad Laboratories, MuÈnich, Germany). Ampli®cation of microsatellites from the YAC DNA was used to identify overlapping clones. Microsatellites D3S1578, D3S1289, D3S3666, D3S1582, D3S3672 and D3S1613 were used to screen DNA pools of an 8x genome coverage BAC-library (Research Genetics Inc., Huntsville, AL). DNA of positive BAC clones was isolated from bacterial cultures using Nucleobond PC 500 kit (Macherey-Nagel, DuÈren, Germany). The insert sizes of BACs were calculated from agarose gels after digestion. The ends of BAC clones were sequenced and STS-markers were created for further screening the BAC-library until the contig was completed. 2.3. Shotgun sequencing of BAC clones BAC-DNA was puri®ed from liquid culture using the Nucleobond PC 500 kit. After removal of E. coli chromosomal DNA by Plasmid-Safee (Epicentre Technologies, Madison, WI), the BAC-DNA was restricted by frequent cutting enzymes Bsp143I and TaqI. Restriction fragments were subcloned into the multicloning site of the lacZ gene fragment of pBluescriptKS-vector. Plasmid DNA from shotgun subclones was puri®ed from 5 ml over night cultures using QIAprep Spin kit (Qiagen, Hilden, Germany). Sequencing of inserts was performed using ¯uorescently labeled universal and reverse lacZ primers and Thermosequenase Cycle Sequencing kit (Amersham Pharmacia Biotech, Amersham, UK) on a LI-COR L4200-2 DNA sequencer (MWG-Biotech, Ebersberg, Germany). The data were analyzed for homology and identi®cation of putative exons using the NIX program at the UK Human Genome Mapping Project Resource Centre (www.hgmp.mrc.ac.uk). 2.4. 5 0 - and 3 0 -RACE for cloning of full length cDNAs DNA from an unidirectional human fetal brain cDNA library (Stratagene Europe, Amsterdam, Netherlands) and adult kidney cDNA library constructed in our laboratory was used for RACE-PCR with an exon speci®c primer and a primer directed to the vector (lZAPII) sequence of the cDNA library. The Expande High Fidelity PCR System (Roche Molecular Biochemicals, Mannheim, Germany) was used under the following PCR conditions: 1 min initial denaturation at 958C, followed by 10 cycles with 15 s
958C and 3 min annealing and polymerization at 688C, followed by 20 cycles with 15 s at 958C and 3 min 120 s/ cycle annealing and polymerization at 688C. After ®nal extension at 728C for 5 min an aliquote of the PCR reaction was analyzed by agarose gel electrophoresis. Speci®c PCR products were identi®ed by Southern blot hybridization to the putative exon sequence as a probe. Corresponding RACE products were subcloned into the pGEM w-Teasy vector (Promega Corp., Madison, WI) and sequenced. Sequence data were analyzed using the HUSAR software (DKFZ, Heidelberg, Germany) and homology searches in the EMBL and SWISS databases were performed using BLAST 2.0 software. 2.5. RT-PCR ampli®cation of the a 2d-3 gene Reverse transcription was performed on 5 mg total RNA with use of dT24-primer (100 pmol) and 200 units Superscript II (Life Technologies) reverse transcriptase. After heat inactivation of the enzyme, RNA was degraded by alkali treatment and cDNA was precipitated in ethanol. After resuspension of the cDNA in 40 ml sterile water, 1 ml was used for PCR. For ampli®cation of the full length transcript of the a2d-3 gene nested PCR was performed using primers CRCC1-F1 (5 0 -GTGGGGAGATAAAATCCATTGCTG-3 0 ) and CRCC1-R1 (5 0 -GCAAACTCACATTTGCATGACTGG-3 0 ) in the ®rst PCR round. The Expande High Fidelity PCR System was used and the PCR conditions were: initial denaturation for 1 min at 958C, followed by 10 cycles with 15 s at 958C, 30 s at 658C and 3 min at 688C, followed by 20 cycles with 15 s at 958C, 30 s at 658C and 3 min 1 20 s/cycle at 688C, followed by a ®nal extension step at 728C for 5 min. In the second round of PCR primers CRCC-F2 (5 0 -AATCCATTGCTGCTAAGTACTCCG-3 0 ) and CRCC1-R2 (5 0 TTGCATGACTGGCAAAGTAAAAAG-3 0 ) were used to amplify the 997 amino acids coding region, whereas the 519 amino acids coding region was ampli®ed using primers CRCC-F2 (as above) and CRCC-R3 (5 0 -CAAACAGGTTGATTCTGGAGAGGC-3 0 ). The PCR was performed in a ®nal reaction volume of 20 ml using 0.5 ml of the ®rst round PCR reaction (diluted 1:10), 10 pmoles of each primer, 50 mM KCl, 10 mM Tris/HCl pH 8.3, 0.01 % bovine serum albumin, 200 mM each dNTP, and 1 unit Taq DNA-Polymerase (Life Technologies). The conditions were: 2 min initial denaturation at 948C, followed by 25 cycles with 30 s at 948C, 30 s at 658C, 3 min at 728C, followed by a ®nal extension for 5 min at 728C. For detection of presence or absence of the 62 bp frame shift deletion primers CRCC-F4 (5 0 -GGAAGACCGAGATGACGTGTTGAG-3 0 ) and CRCC-R4 (5 0 -ATCGGGATGTTCTAAGTCATGCAG-3 0 ) were used. The PCR conditions were the same except of only 30 s polymerization time in each cycle. 2.6. Direct sequencing of a 2d-3 gene The RT-PCR products of the a2d-3 gene were reampli-
S. Hanke et al. / Gene 264 (2001) 69±75
71
®ed with the use of nested tailed primers creating three overlapping fragments each with approx. 1 kb in size. The primer tails contained the sequence of the lacZ universal primer (for the forward strand sequencing) or lacZ reverse primer (for the reverse strand sequencing). Reampli®ed products were sequenced using ¯uorescently labelled lacZ primers and the Thermosequenase Cycle Sequencing Kit on a LI-COR L4200-2 DNA sequencer (MWG-Biotech). 2.7. Localisation of putative exons of the a 2d-3 gene BAC clones 158d7, 277p5, 358e5, 348i3, 55m24, 428i24, 230a11, and 32c13 were digested using restriction enzyme HindIII, separated on a 0.8% agarose gel and blotted to a nylon membrane. The full length a2d-3 transcript ampli®ed by nested RT-PCR with primers CRCC1-F1/R1 and CRCCF2/R2 was used as a probe for Southern hybridization of restricted BAC clones. After stringent hybridization at 688C and washing of the ®lter with 0.1 £ SSC, speci®c genomic fragments were detected by exposure to X-ray ®lms. For mapping the 3 0 -end of the genomic gene structure a STS marker was created with the use of primers CRCC-F5 (5 0 GACTGAGATGTTCTCTTGGCATGC-3 0 ) and CRCC-R1. All YACs and BACs from the contig were tested for this STS marker by PCR. 3. Results 3.1. Deletion mapping Previously, we delineated the smallest overlapping region to an approximately 55 cM genetic distance on chromosome 3p in 100 of 104 conventional RCCs (Chudek et al., 1997). One of the remaining four tumors (HD188) showed a LOH at locus D3S1289 and retention of heterozygosity at loci D3S1768 and D3S1766 marking an interstitial deletion of approx. 15 cM. Therefore, we have analysed HD188 as well as the three other tumors for loci D3S3559, D3S3685, D3S3664, D3S1568, D3S1621, D3S3667, D3S1578, D3S3666, D3S1582, D3S3672, D3S1613, D3S3660, D3S3719 and D3S1606, all within 10 cM around the locus D3S1289. We narrowed down the region of interest to 1 cM between loci DS31578 and D3S1613, both retained in tumor HD188 (Fig. 1). During construction of a BAC contig for this region and shotgun sequencing of BACs 277p5, 55m24 and 428i24 we have identi®ed three new dinucleotide repeats (277ca1, 55ca1 and 428ca1) and a tetranucleotide repeat (55attt1). Primer sequences for ampli®cation of the new microsatellite loci are shown in Table 1. We determined the exact location of all microsatellites from the region by amplifying DNA from YAC and BAC clones. Subsequently, the polymorphic loci were ampli®ed from normal and tumor DNA from case HD188 as well as from the other three tumors. All new loci were informative in normal tissue and revealed retention of both alleles in tumor DNA from HD188 (Fig. 1). The three other tumors
Fig. 1. Fluorescent microsatellite analysis of conventional RCC HD188 at chromosome 3p21.1 region. LOH was detected at locus D3S1289, whereas both allels were retained at all other loci. Microsatellites were ampli®ed from normal (N) and tumor (T) DNA using ¯uorescently labelled primers and were analyzed on an ALFexpress DNA sequencer.
retained the heterozygosity at all informative loci. Thus, the deletion in tumor HD188 was delineated to a region of less than 100 kb in size between loci 55ca1 and 55attt1, both localized to BAC clone 55m24.
Table 1 Primer sequences for ampli®cation of new microsatellites Name of locus
Primer sequences a
Type of repeat
277ca1
F: ATATGACACATCTCAGGCATGC R: ATCTGCAGGTGAAACCTGTG F: AAGATTGTGCCACTGCACTC R: TGAACTTCCCTTCCAGAACC F: TAACACATGAACTTTGGGGGAC R: CTCCAAGTGTCAAAGAACAAACC F: ATTGCCCATAGCAACTACTCCC R: TCGTCAGAGTGAGCCTGATTTC
CA
55ca1 55attt1 428ca1 a
F, forward primer; R, reverse primer.
CA ATTT CA
72
S. Hanke et al. / Gene 264 (2001) 69±75
Fig. 2. Integrated YAC/BAC contig for the interstitial deletion between loci D3S1578 and D3S1613 at chromosome 3p21.1, which was covered by overlapping YAC clones 960d11 and 870e5 and a BAC contig. Loss of one allele (D) at locus D3S1289 and retention of the constitutional heterozygosity (R) at loci 55ca1 and 55attt1 delineated the ®nal target region to BAC clone 55m24. STS-markers of the BAC ends are symbolized by squares and circles. The location and direction of transcription of the calcium channel a2d-3 subunit gene is given below. Distribution of exons of the a2d-3 gene is marked by a dashed line and approximately location of the 3 0 -end on YAC 840e5 by an asterisk.
3.2. Construction of a physical map Nearly the entire target region was covered by the YAC clone 960d11 (890 kb insert size), which was positive for all but one microsatellites mapped to the region. The gap between loci D3S3672 and D3S1613 was covered by a
partially overlapping YAC clone 870e5, which was positive for D3S1613 as well. The BAC contig was constructed by using microsatellite and new STS markers from the BAC ends. The YAC/BAC contig extends from D3S1578 to D3S1613 and incorporates two YACs and 14 BACs. (Fig. 2).
Fig. 3. Identi®cation of splicing variant of the a2d-3 subunit gene with the 62 bp frame shift deletion. One ml cDNA from the tissues indicated below were ampli®ed by using primers ¯aking the 62 bp deletion. RT-PCR product of 247 bp indicates the fetal brain type whereas the 185 bp product the deleted transcript. Fetal brain tissue (lanes 1) expresses the a2d-3 subunit gene without deletion. All other fetal tissues (lane 2, lung; lane 3, liver; lane 4, testis; lane 5, kidney; lane 6, spleen; lane 7, colon; lane 8, skeletal muscle; lane 9, stomach; lane 10, pancreas; lane 11, thymus; lane 12, placenta; lane 13, adrenal gland) as well as the adult tissues (lanes 14 and 16, normal kidney; lanes 15 and 17, conventional RCC tissue; lanes 18±20, conventional RCC cell lines; lanes 21±23, bladder cancer tissues; lanes 24±26, lung cancer cell lines) show either the 185 bp PCR product or both the 185 and 247 bp product. In some tissues a larger third fragment was seen, possible due to homologous basepairing. Cloning this fragment resulted in two fragments with size of 247 and 185 bp.
S. Hanke et al. / Gene 264 (2001) 69±75
3.3. Isolation of the calcium channel a 2d subunit gene Shotgun sequencing of the BAC clones 55m24 and 428i24 identi®ed three putative exons of 163, 193 and 151 bp in size, each with homology to calcium channel a2d subunit genes from different species. 5 0 - and 3 0 - RACEPCR with a human fetal brain cDNA library resulted in a full length cDNA clone of 3544 bp (accession number AJ272268). The open reading frame (ORF) encodes a 997 amino acids protein with signi®cant homology to the calcium channel a2d-3 subunit from mouse (accession number aj010949; Klugbauer et al., 1999). Compared to the mouse sequence, where the protein consists of 1040 amino acids, the N-terminal 44 amino acids are not present in the human gene. We found two TGA stop codons at positions 3±5 and 9±11 bp and the 5 0 -part of the gene from different cDNA libraries revealed the same structure indicating that we have cloned the full length transcript. This result was con®rmed by the isolation of full length cDNA clones with the same structure at the 5 0 - sequences of the gene from two adult kidney cDNA libraries. The cDNA clones from adult kidney and fetal brain libraries revealed two differences: (1) a 18 bp segment (position 1313±1320; codons 366 to 371) was not present in adult kidney, (2) a 62 bp frame shift deletion (position 1713 to 1774) resulted in a premature truncation of the deduced protein sequence after 519 amino acids in adult kidney (accession number AJ272213).
73
bp insertion of an unknown sequence was found after position 311 in a subpopulation of transcripts in the tumor sample, whereas the corresponding normal tissue sample revealed a 84 bp deletion (position 1540±1623) in 100% of transcripts. All other samples showed normal sequences within the coding region of the a2d-3 gene. 3.5. Distribution of a 2d-3 subunit exons The distribution of exons was analyzed by Southern-blot hybridization of HindIII digested BAC clones from the
3.4. Characterization of the a 2d-3 gene Expression of the human calcium channel a2d-3 subunit gene was studied by RT-PCR ampli®cation of the full length transcript from different fetal tissues. Using nested RT-PCR strong signals were seen in all human fetal tissues. We have also analyzed human fetal and adult tissues and tumor cell lines for expression of the splicing variants of transcript by using primers ¯anking the 62 bp deletion. Most fetal tissue samples, with exception of the fetal brain, expressed predominantly the smaller 185 bp fragment but in some cases the 247 bp fragment as well as a larger third fragment was seen (Fig. 3). Cloning the largest fragment, which is possible due to homologous basepairing, resulted in the two fragments with size of 247 and 185 bp. RT-PCR analysis revealed the 185 bp transcript in normal adult kidney and corresponding conventional RCC samples as well as in bladder and lung cancer cell lines (Fig. 3). We have sequenced the coding region of the calcium channel a2d-3 subunit gene from four paired normal/ tumor tissue samples (conventional RCCs HA350, HA388, HD110, HD112) and from 11 conventional RCC cell lines. We found a 5 bp deletion (position 1695±1699) in a subpopulation of transcripts of the primary tumor HA350. We did not ®nd this deletion in the cell line established from RCC HA350, but we detected an 85 bp insertion of an unknown sequence after position 252. In case HA388 a 95
Fig. 4. (A) Southern blot hybridization of HindIII digested BAC clones with the full length cDNA of the a2d-3 subunit gene as a probe. Asterisk marks a faint hybridisation signal which was seen only after long exposure of the Xray ®lm. Approximately size of positive HindIII fragments are given on the right. (B) Result of PCR using STS-primers from the 3 0 -end close to the polyA signal of the a2d-3 subunit gene. Only the YAC clone 870e5 was positive indicating that the 3 0 -end of the gene is located in the overhanging part of the YAC 870e5 outside the BAC contig.
74
S. Hanke et al. / Gene 264 (2001) 69±75
contig to the full length a2d-3 cDNA (Fig. 4A). Shot gun sequencing revealed a 163 and a 193 bp exon in the overlapping region of the BAC clones 55m24 and 428i24 and a 151 bp exon in the BAC 428i24. Corresponding, the hybridisation showed two signals of identical size in the two BACs and an additional signal in BAC 428i24. One genomic HindIII fragment of each BAC clone 158d7, 358e5 and 348i3 hybridized to the cDNA probe. The BACs 230a11 and 32c13 showed two and six positive HindIII fragments, respectively. Only the YAC clone 870e5 was positive when tested the YAC and BAC clones of the contig by STS-primers generated for the 3 0 -end of the cDNA close to the polyA signal. (Fig. 4B). Thus, the genomic structure of the human a2d-3 gene seems to spann approx. 500 kb from BAC 158d7 to the centromeric end of YAC 870e5 (see Fig. 2). The new microsatellite loci 55ca1 and 55attt1 revealed retention of both alleles in the conventional RCC HD188 and were mapped on BAC 55m24 but not on the neighbouring BACs 348i3 and 428i24. These microsatellite loci as well as locus D3S1289 showing LOH in case HD188 are located in the non-overlapping region of BAC 55m24, whereas, exons of the a2d-3 gene were found in the centromeric overlapping region of BACs 55m24 and 428i24 and in other parts of the contig. The interstitial deletion found in case HD188, presumably, does not involve an exon of the a2d-3 gene. 3.6. In silico cloning During preparation of this manuscript sequence data of 14 unordered fragments (AC018353) were placed on the website (www.ncbi.nlm.nih.gov/genome/seq). One of the fragments of 30252 bp contains the sequences of microsatellite D8S1289. We have identi®ed three putative exons by using the NIX program (www.hgmp.mrc.ac.uk). RT-PCR analysis revealed a good signal for each exon in distinct fetal tissues, normal adult kidneys and renal cell carcinomas as well as in bladder and lung cancer tissues. These sequences will be used for constructing full length cDNA which will be further analysed in different tumor types. 4. Discussion We have identi®ed a LOH of approx. 1 cM region around the locus D3S1289 on chromosome 3p21.1 by deletion mapping in a conventional RCC, constructed a detailed YAC/BAC contig and narrowed down the putative tumor suppressor gene region by using newly isolated microsatellites to a single BAC clone. We cloned the calcium channel a2d-3 subunit gene by shot gun sequencing of corresponding BAC clones. Database search for calcium channel a2d subunits revealed four human sequences mapped to the chromosome 3p21.3 region (accession numbers af042792, af042793, af040709, ab011130). These sequences represent type 2 subunit genes which were cloned from a homozygously deleted region identi®ed in lung cancer cell lines
(Wei et al., 1996). The human type 1 subunit gene (accession number M76559) has been published earlier (Williams et al., 1992). Recently, cloning the type 2 and type 3 genes from mouse and the diversity of calcium channel a2d subunits was reported by Klugbauer et al. (1999). The human calcium channel a2d-3 subunit gene has a full length transcript as well as a splice variants carrying a 62 bp frame shift deletion. Splice variants of the type 1 gene have also been found in various species and tissues (Ellis et al., 1988; Williams et al., 1992; Kim et al., 1992; Brust et al., 1993; Angelotti and Hofmann, 1996). Although one allele of the a2d-3 gene is deleted in 97% of conventional RCC, the lack of mutation of the remaining allele makes questionable the role of this gene in the development of conventional RCCs. Insertions of unknown sequences and deletions were observed not only in tumor but also in normal kidney samples. Of interest, the FHIT gene at chromosome 3p21.1, similarly to the calcium channel a2d subunit gene, showed a mixed population of transcripts with different insertions of unknown sequences in a RCC cell line (Bugert et al., 1997). Both the FHIT and a2d3 genes encompass a large genomic structure of approx. 1 Mb and 500 kb, respectively. The FHIT is located at the most common fragile site FRA3B at chromosome 3p21.1, which is a highly unstable region in the human genome. The insertions into and deletions of the mRNA of both genes may result from mitotic recombination within genomic sequences in subpopulations of cells or by processing error of the primary transcript. Several small homozygous deletions at chromosome 3p12 and 3p21.3-22 have been described in lung cancer cell lines (Latif et al., 1992; Daly et al., 1993; Yamakawa et al., 1993; Kok et al., 1994; Wei et al., 1996; Fong et al., 1997; Ong et al., 1997). Sekido et al. (1998) have recently identi®ed a homozygous deletion of 120 kb in a breast cancer cell line at 3p21.3 that overlaps those described in lung cancer cell lines. We found a LOH of approx. 100 kb at chromosome 3p21.1 in a conventional RCC. The calcium channel a2d-3 subunit gene as well as other calcium channel genes are cloned from the hemi- or homozygously deleted regions, but they were excluded to be tumor suppressor genes. It is possible that most of the small interstitial hemi- or homozygous `deletions' detected by LOH studies at chromosome 3p result from homologous recombination, which is a frequent genetic event in the human genome, especially in cancer cell lines (Tisch®eld, 1997). Analysing the three putative exons detected in silico within the target deletion of 100 kb at chromosome 3p21.1 will show whether the small interstitial deletion contains a tumor suppressor gene or it is a result of random genetic event in tumor cells. Acknowledgements This work was supported by a grant from the German Research Council (Ko 841/8-1).
S. Hanke et al. / Gene 264 (2001) 69±75
References Angelotti, T., Hofmann, F., 1996. Tissue-speci®c expression of splice variants of the mouse voltage-gated calcium channel alpha2/delta subunit. FEBS Lett. 397, 331±337. Brust, P.F., Simerson, S., McCue, A.F., Deal, C.R., Schoonmaker, S., Williams, M.E., Velicelebi, G., Johnson, E.C., Harpold, M.M., Ellis, S.B., 1993. Human neuronal voltage-dependent calcium channels: studies on subunit structure and role in channel assembly. Neuropharmacology 32, 1089±1102. Bugert, P., Wilhelm, M., Kovacs, G., 1997. FHIT gene and the FRA3B region are not involved in the genetics of renal cell carcinomas. Genes Chromosomes Cancer 20, 9±15. Chudek, J., Wilhelm, M., Bugert, P., Herbers, J., Kovacs, G., 1997. Detailed deletion mapping of chromosome 3p in non-papillary renal cell carcinoma by microsatellites. Int. J. Cancer 73, 225±229. Daly, M.C., Xiang, R.H., Buchhagen, D., Hensel, C.H., Garcia, D.K., Killary, A.M., Minna, J.D., Naylor, S.L., 1993. A homozygous deletion on chromosome 3 in a small cell lung cancer cell line correlates with a region of tumor suppressor activity. Oncogene 8, 1721±1729. Ellis, S.B., et al., 1988. Sequence and expression of mRNAs encoding the alpha 1 and alpha 2 subunits of a DHP-sensitive calcium channel. Science 241, 1661±1664. Fong, K.M., Biesterveld, E.J., Virmani, A., Wistuba, I., Sekido, Y., Bader, S.A., Ahmadian, M., Ong, S.T., Rassool, F.V., Zimmerman, P.V., Giaccone, G., Gazdar, A.F., Minna, J.D., 1997. FHIT and FRA3B 3p14.2 allele loss are common in lung cancer and preneoplastic bronchial lesions and are associated with cancer-related FHIT cDNA splicing aberrations. Cancer Res. 57, 2256±2267. Foster, K., Crossey, P.A., Cairns, P., Hetherington, J.W., Richards, F.M., Jones, M.H., Bentley, E., Affara, N.A., Ferguson-Smith, M.A., Maher, E.R., 1994. Molecular genetic investigation of sporadic renal cell carcinoma: analysis of allele loss on chromosomes 3p, 5q, 11p, 17 and 22. Br. J. Cancer 69, 230±234. Gnarra, J.R., et al., 1994. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat. Genet. 7, 85±90. Killary, A.M., Wolf, M.E., Giambernardi, T.A., Naylor, S.L., 1992. De®nition of a tumor suppressor locus within human chromosome 3p21-22. Proc. Natl. Acad. Sci. USA 89, 10877±10881. Kim, H.L., Kim, H., Lee, P., King, R.G., Chin, H., 1992. Rat brain expresses an alternatively spliced form of the dihydropyridine-sensitive L-type calcium channel alpha 2 subunit. Proc. Natl. Acad. Sci. USA 89, 3251±3255. Klugbauer, N., Lacinova, L., Marais, E., Hobom, M., Hofmann, F., 1999. Molecular diversity of the calcium channel alpha2delta subunit. J. Neurosci. 19, 684±691. Kok, K., et al., 1994. A homozygous deletion in a small cell lung cancer cell line involving a 3p21 region with a marked instability in yeast arti®cial chromosomes. Cancer Res. 54, 4183±4187. Kovacs, G., Frisch, S., 1989. Clonal chromosome abnormalities in tumor cells from patients with sporadic renal cell carcinomas. Cancer Res. 49, 651±659. Kovacs, G., Emanuel, A., Neumann, H.P.H., Kung, H., 1991. Cytogenetics
75
of renal cell carcinomas associated with von Hippel-Lindau disease. Genes Chromosomes Cancer 3, 256±262. Latif, F., et al., 1993. Identi®cation of the von Hippel-Lindau disease tumor suppressor gene. Science 260, 1317±1320. Latif, F., Tory, K., Modi, W.S., Graziano, S.L., Gamble, G., Douglas, J., Heppell-Parton, A.C., Rabbitts, P.H., Zbar, B., Lerman, M.I., 1992. Molecular characterization of a large homozygous deletion in the small cell lung cancer cell line U2020: a strategy for cloning the putative tumor suppressor gene. Genes Chromosomes Cancer 5, 119±127. Lott, S.T., Lovell, M., Naylor, S.L., Killary, A.M., 1998. Physical and functional mapping of a tumor suppressor locus for renal cell carcinoma within chromosome 3p12. Cancer Res. 58, 3533±3537. Lubinski, J., Hadaczek, P., Podolski, J., Toloczko, A., Sikorski, A., McCue, P., Druck, T., Huebner, K., 1994. Common regions of deletion in chromosome regions 3p12 and 3p14.2 in primary clear cell renal cell carcinomas. Cancer Res. 54, 3710±3713. Ong, S.T., Fong, K.M., Bader, S.A., Minna, J.D., Le Beau, M.M., McKeithan, T.W., Rassool, F.V., 1997. Precise localization of the FHIT gene to the common fragile site at 3p14.2 (FRA3B) and characterization of homozygous deletions within FRA3B that affect FHIT transcription in tumor cell lines. Genes Chromosomes Cancer 20, 16± 23. Sanchez, Y., el-Naggar, A., Pathak, S., Killary, A.M., 1994. A tumor suppressor locus within 3p14-p12 mediates rapid cell death of renal cell carcinoma in vivo. Proc. Natl. Acad. Sci. USA 91, 3383±3387. Sekido, Y., Ahmadian, M., Wistuba, I.I., Latif, F., Bader, S., Wie, M.H., Duh, F.M., Gazdar, A.F., Lerman, M.I., Minna, J.D., 1998. Cloning of a breast cancer homozygous deletion junction narrows the region of search for a 3p21.3 tumor suppressor gene. Oncogene 16, 3151±3157. Tisch®eld, Y.A., 1997. Loss of heterozygsity or: How I learned to stop worrying and love mitotic recombination. Am. J. Hum. Genet. 61, 995±999. van der Hout, A.H., van der Vlies, P., Wijmenga, C., Li, F.P., Oosterhuis, J.W., Buys, C.H.C.M., 1991. The region of common allelic losses in sporadic renal cell carcinoma is bordered by the loci D3S2 and THRB. Genomics 11, 537±542. Wei, M.H., Latif, F., Bader, S., Kashuba, V., Chen, J.Y., Duh, F.M., Sekido, Y., Lee, C.C., Geil, L., Kuzmin, I., Zabarovsky, E., Klein, G., Zbar, B., Minna, J.D., Lerman, M.I., 1996. Construction of a 600-kilobase cosmid clone contig and generation of a transcriptional map surrounding the lung cancer tumor suppressor gene (TSG) locus on human chromosome 3p21.3: progress toward the isolation of a lung cancer TSG. Cancer Res. 56, 1487±1492. Williams, M.E., Feldman, D.H., McCue, A.F., Brenner, R., Velicelebi, G., Ellis, S.B., Harpold, M.M., 1992. Structure and functional expression of alpha 1, alpha 2, and beta subunits of a novel human neuronal calcium channel subtype. Neuron 8, 71±84. Yamakawa, K., Morita, R., Takahashi, E., Hori, T., Ishikawa, J., Nakamura, Y., 1991. A detailed deletion mapping of the short arm of chromosome 3 in sporadic renal cell carcinoma. Cancer Res. 51, 4707±4711. Yamakawa, K., Takahashi, T., Horio, Y., Murata, Y., Takahashi, E., Hibi, K., Yokoyama, S., Ueda, R., Takahashi, T., Nakamura, Y., 1993. Frequent homozygous deletions in lung cancer cell lines detected by a DNA marker located at 3p21.3-p22. Oncogene 8, 327±330.
www.elsevier.com/locate/gene
Cloning a calcium channel a2d-3 subunit gene from a putative tumor suppressor gene region at chromosome 3p21.1 in conventional renal cell carcinoma Susanne Hanke, Peter Bugert, Jerzy Chudek 1, Gyula Kovacs* Laboratory of Molecular Oncology, Department of Urology, University of Heidelberg, Im Neuenheimer Feld 365, D-69120 Heidelberg, Germany Received 28 August 2000; received in revised form 1 December 2000; accepted 11 December 2000 Received by T. Sekiya
Abstract We have identi®ed loss of heterozygosity (LOH) of approx. 1 cM region around locus D3S1289 at chromosome 3p21.1 in a conventional renal cell carcinoma (RCC). During construction of a YAC/BAC contig for this region and shotgun sequencing of BACs 277p5, 55m24 and 428i24, we detected four new microsatellites. We narrowed down the target region by analysing these new loci to less than 100 kb within the BAC 55m24 and subsequently cloned a human calcium channel a2d-3 subunit gene. This gene is widely expressed in fetal tissues and different types of adult tumors. The exons of the a2d-3 subunit gene are distributed along approx. 500 kb DNA sequences. As the LOH involved exclusively intronic sequences and sequencing the entire coding region did not reveal any mutation, the a2d-3 subunit gene is probably not a tumor suppressor gene. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Deletion mapping; BAC contig; Positional cloning; Mutation analysis
1. Introduction Deletion of chromosome 3p is the most frequent genetic change in sporadic and von Hippel-Lindau disease (VHL) associated conventional renal cell carcinomas (RCC) (Kovacs and Frisch, 1989; Kovacs et al., 1991). The VHL gene has been cloned from the chromosome 3p25 region (Latif et al., 1993). Because of somatic mutation of one allele of the VHL gene occurs in approximately 50% of sporadic conventional RCCs, it was suggested to be the RCC tumor suppressor gene (Gnarra et al., 1994). A comprehensive microsatellite study mapped the smallest overlapping deletion to a large region of approx. 55 cM between loci D3S1560 and D3S3666 in nearly 100% of conventional RCCs (Chudek et al., 1997). Although, this deletion at the most distal end includes the VHL gene, the constant loss of a large chromosomal region suggests the Abbreviations: BAC, bacterial arte®cial chromosome; LOH, loss of heterozygosity; RCC, renal cell carcinoma; STS, sequenced tagged site; VHL, von Hippel-Lindau; YAC, yeast arte®cial chromosome * Corresponding author. Tel.: 149-6221-566519; fax: 149-6221564634. E-mail address: [email protected] (G. Kovacs). 1 Present address: Department of Nephrology, Endocrinology and Metabolic Diseases, Silesian Medical School, Katowice, Poland.
involvement of another gene in the development of RCC. Several deletion mapping as well as chromosomal replacement studies have been undertaken to localize and clone the RCC tumor suppressor gene during the last 10 years but without success (Foster et al., 1994; van der Hout et al., 1991; Killary et al., 1992; Lott et al., 1998; Lubinski et al., 1994; Sanchez et al., 1994; Yamakawa et al., 1991). In this report, we describe the identi®cation of LOH of 100 kb in size at chromosome 3p21.1 in a conventional RCC and cloning the a2d-3 calcium channel subunit gene.
2. Materials and methods 2.1. Microsatellite analysis DNA was isolated from short term cultures of normal kidney and tumor tissues as described (Chudek et al., 1997). Microsatellites were ampli®ed from 50 ng DNA using 5 pmoles each of forward (Cy5-labeled at 5 0 -end) and reverse primer, 50 mM KCl, 10 mM Tris-HCl pH 8.5, 1.5 mM MgCl2, and 1 unit Taq polymerase (Life Technologies, Karlsruhe, Germany) in a 10 ml reaction volume. The 28 PCR cycles consistent of 30 s denaturation at 948C, 30 s annealing at 558C, and 30 s extension at 728C and was
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(00)00600-4
70
S. Hanke et al. / Gene 264 (2001) 69±75
performed on a PTC200 (MJ-Research Inc., Watertown, Massachusetts) thermocycler. PCR products were analyzed on an ALFexpress system (Amersham Pharmacia Biotech, Freiburg, Germany) with the use of the Fragment Manager (FM 1.2) software. 2.2. Construction of an integrated YAC/BAC contig YAC clones (WC3.10 contig, www.genome.wi.mit.edu) were obtained from CEPH. High molecular weight yeast DNA plugs were prepared and pulsed-®eld electrophoresis was performed to control the size of YACs using the CHEFDRII system (Bio-Rad Laboratories, MuÈnich, Germany). Ampli®cation of microsatellites from the YAC DNA was used to identify overlapping clones. Microsatellites D3S1578, D3S1289, D3S3666, D3S1582, D3S3672 and D3S1613 were used to screen DNA pools of an 8x genome coverage BAC-library (Research Genetics Inc., Huntsville, AL). DNA of positive BAC clones was isolated from bacterial cultures using Nucleobond PC 500 kit (Macherey-Nagel, DuÈren, Germany). The insert sizes of BACs were calculated from agarose gels after digestion. The ends of BAC clones were sequenced and STS-markers were created for further screening the BAC-library until the contig was completed. 2.3. Shotgun sequencing of BAC clones BAC-DNA was puri®ed from liquid culture using the Nucleobond PC 500 kit. After removal of E. coli chromosomal DNA by Plasmid-Safee (Epicentre Technologies, Madison, WI), the BAC-DNA was restricted by frequent cutting enzymes Bsp143I and TaqI. Restriction fragments were subcloned into the multicloning site of the lacZ gene fragment of pBluescriptKS-vector. Plasmid DNA from shotgun subclones was puri®ed from 5 ml over night cultures using QIAprep Spin kit (Qiagen, Hilden, Germany). Sequencing of inserts was performed using ¯uorescently labeled universal and reverse lacZ primers and Thermosequenase Cycle Sequencing kit (Amersham Pharmacia Biotech, Amersham, UK) on a LI-COR L4200-2 DNA sequencer (MWG-Biotech, Ebersberg, Germany). The data were analyzed for homology and identi®cation of putative exons using the NIX program at the UK Human Genome Mapping Project Resource Centre (www.hgmp.mrc.ac.uk). 2.4. 5 0 - and 3 0 -RACE for cloning of full length cDNAs DNA from an unidirectional human fetal brain cDNA library (Stratagene Europe, Amsterdam, Netherlands) and adult kidney cDNA library constructed in our laboratory was used for RACE-PCR with an exon speci®c primer and a primer directed to the vector (lZAPII) sequence of the cDNA library. The Expande High Fidelity PCR System (Roche Molecular Biochemicals, Mannheim, Germany) was used under the following PCR conditions: 1 min initial denaturation at 958C, followed by 10 cycles with 15 s
958C and 3 min annealing and polymerization at 688C, followed by 20 cycles with 15 s at 958C and 3 min 120 s/ cycle annealing and polymerization at 688C. After ®nal extension at 728C for 5 min an aliquote of the PCR reaction was analyzed by agarose gel electrophoresis. Speci®c PCR products were identi®ed by Southern blot hybridization to the putative exon sequence as a probe. Corresponding RACE products were subcloned into the pGEM w-Teasy vector (Promega Corp., Madison, WI) and sequenced. Sequence data were analyzed using the HUSAR software (DKFZ, Heidelberg, Germany) and homology searches in the EMBL and SWISS databases were performed using BLAST 2.0 software. 2.5. RT-PCR ampli®cation of the a 2d-3 gene Reverse transcription was performed on 5 mg total RNA with use of dT24-primer (100 pmol) and 200 units Superscript II (Life Technologies) reverse transcriptase. After heat inactivation of the enzyme, RNA was degraded by alkali treatment and cDNA was precipitated in ethanol. After resuspension of the cDNA in 40 ml sterile water, 1 ml was used for PCR. For ampli®cation of the full length transcript of the a2d-3 gene nested PCR was performed using primers CRCC1-F1 (5 0 -GTGGGGAGATAAAATCCATTGCTG-3 0 ) and CRCC1-R1 (5 0 -GCAAACTCACATTTGCATGACTGG-3 0 ) in the ®rst PCR round. The Expande High Fidelity PCR System was used and the PCR conditions were: initial denaturation for 1 min at 958C, followed by 10 cycles with 15 s at 958C, 30 s at 658C and 3 min at 688C, followed by 20 cycles with 15 s at 958C, 30 s at 658C and 3 min 1 20 s/cycle at 688C, followed by a ®nal extension step at 728C for 5 min. In the second round of PCR primers CRCC-F2 (5 0 -AATCCATTGCTGCTAAGTACTCCG-3 0 ) and CRCC1-R2 (5 0 TTGCATGACTGGCAAAGTAAAAAG-3 0 ) were used to amplify the 997 amino acids coding region, whereas the 519 amino acids coding region was ampli®ed using primers CRCC-F2 (as above) and CRCC-R3 (5 0 -CAAACAGGTTGATTCTGGAGAGGC-3 0 ). The PCR was performed in a ®nal reaction volume of 20 ml using 0.5 ml of the ®rst round PCR reaction (diluted 1:10), 10 pmoles of each primer, 50 mM KCl, 10 mM Tris/HCl pH 8.3, 0.01 % bovine serum albumin, 200 mM each dNTP, and 1 unit Taq DNA-Polymerase (Life Technologies). The conditions were: 2 min initial denaturation at 948C, followed by 25 cycles with 30 s at 948C, 30 s at 658C, 3 min at 728C, followed by a ®nal extension for 5 min at 728C. For detection of presence or absence of the 62 bp frame shift deletion primers CRCC-F4 (5 0 -GGAAGACCGAGATGACGTGTTGAG-3 0 ) and CRCC-R4 (5 0 -ATCGGGATGTTCTAAGTCATGCAG-3 0 ) were used. The PCR conditions were the same except of only 30 s polymerization time in each cycle. 2.6. Direct sequencing of a 2d-3 gene The RT-PCR products of the a2d-3 gene were reampli-
S. Hanke et al. / Gene 264 (2001) 69±75
71
®ed with the use of nested tailed primers creating three overlapping fragments each with approx. 1 kb in size. The primer tails contained the sequence of the lacZ universal primer (for the forward strand sequencing) or lacZ reverse primer (for the reverse strand sequencing). Reampli®ed products were sequenced using ¯uorescently labelled lacZ primers and the Thermosequenase Cycle Sequencing Kit on a LI-COR L4200-2 DNA sequencer (MWG-Biotech). 2.7. Localisation of putative exons of the a 2d-3 gene BAC clones 158d7, 277p5, 358e5, 348i3, 55m24, 428i24, 230a11, and 32c13 were digested using restriction enzyme HindIII, separated on a 0.8% agarose gel and blotted to a nylon membrane. The full length a2d-3 transcript ampli®ed by nested RT-PCR with primers CRCC1-F1/R1 and CRCCF2/R2 was used as a probe for Southern hybridization of restricted BAC clones. After stringent hybridization at 688C and washing of the ®lter with 0.1 £ SSC, speci®c genomic fragments were detected by exposure to X-ray ®lms. For mapping the 3 0 -end of the genomic gene structure a STS marker was created with the use of primers CRCC-F5 (5 0 GACTGAGATGTTCTCTTGGCATGC-3 0 ) and CRCC-R1. All YACs and BACs from the contig were tested for this STS marker by PCR. 3. Results 3.1. Deletion mapping Previously, we delineated the smallest overlapping region to an approximately 55 cM genetic distance on chromosome 3p in 100 of 104 conventional RCCs (Chudek et al., 1997). One of the remaining four tumors (HD188) showed a LOH at locus D3S1289 and retention of heterozygosity at loci D3S1768 and D3S1766 marking an interstitial deletion of approx. 15 cM. Therefore, we have analysed HD188 as well as the three other tumors for loci D3S3559, D3S3685, D3S3664, D3S1568, D3S1621, D3S3667, D3S1578, D3S3666, D3S1582, D3S3672, D3S1613, D3S3660, D3S3719 and D3S1606, all within 10 cM around the locus D3S1289. We narrowed down the region of interest to 1 cM between loci DS31578 and D3S1613, both retained in tumor HD188 (Fig. 1). During construction of a BAC contig for this region and shotgun sequencing of BACs 277p5, 55m24 and 428i24 we have identi®ed three new dinucleotide repeats (277ca1, 55ca1 and 428ca1) and a tetranucleotide repeat (55attt1). Primer sequences for ampli®cation of the new microsatellite loci are shown in Table 1. We determined the exact location of all microsatellites from the region by amplifying DNA from YAC and BAC clones. Subsequently, the polymorphic loci were ampli®ed from normal and tumor DNA from case HD188 as well as from the other three tumors. All new loci were informative in normal tissue and revealed retention of both alleles in tumor DNA from HD188 (Fig. 1). The three other tumors
Fig. 1. Fluorescent microsatellite analysis of conventional RCC HD188 at chromosome 3p21.1 region. LOH was detected at locus D3S1289, whereas both allels were retained at all other loci. Microsatellites were ampli®ed from normal (N) and tumor (T) DNA using ¯uorescently labelled primers and were analyzed on an ALFexpress DNA sequencer.
retained the heterozygosity at all informative loci. Thus, the deletion in tumor HD188 was delineated to a region of less than 100 kb in size between loci 55ca1 and 55attt1, both localized to BAC clone 55m24.
Table 1 Primer sequences for ampli®cation of new microsatellites Name of locus
Primer sequences a
Type of repeat
277ca1
F: ATATGACACATCTCAGGCATGC R: ATCTGCAGGTGAAACCTGTG F: AAGATTGTGCCACTGCACTC R: TGAACTTCCCTTCCAGAACC F: TAACACATGAACTTTGGGGGAC R: CTCCAAGTGTCAAAGAACAAACC F: ATTGCCCATAGCAACTACTCCC R: TCGTCAGAGTGAGCCTGATTTC
CA
55ca1 55attt1 428ca1 a
F, forward primer; R, reverse primer.
CA ATTT CA
72
S. Hanke et al. / Gene 264 (2001) 69±75
Fig. 2. Integrated YAC/BAC contig for the interstitial deletion between loci D3S1578 and D3S1613 at chromosome 3p21.1, which was covered by overlapping YAC clones 960d11 and 870e5 and a BAC contig. Loss of one allele (D) at locus D3S1289 and retention of the constitutional heterozygosity (R) at loci 55ca1 and 55attt1 delineated the ®nal target region to BAC clone 55m24. STS-markers of the BAC ends are symbolized by squares and circles. The location and direction of transcription of the calcium channel a2d-3 subunit gene is given below. Distribution of exons of the a2d-3 gene is marked by a dashed line and approximately location of the 3 0 -end on YAC 840e5 by an asterisk.
3.2. Construction of a physical map Nearly the entire target region was covered by the YAC clone 960d11 (890 kb insert size), which was positive for all but one microsatellites mapped to the region. The gap between loci D3S3672 and D3S1613 was covered by a
partially overlapping YAC clone 870e5, which was positive for D3S1613 as well. The BAC contig was constructed by using microsatellite and new STS markers from the BAC ends. The YAC/BAC contig extends from D3S1578 to D3S1613 and incorporates two YACs and 14 BACs. (Fig. 2).
Fig. 3. Identi®cation of splicing variant of the a2d-3 subunit gene with the 62 bp frame shift deletion. One ml cDNA from the tissues indicated below were ampli®ed by using primers ¯aking the 62 bp deletion. RT-PCR product of 247 bp indicates the fetal brain type whereas the 185 bp product the deleted transcript. Fetal brain tissue (lanes 1) expresses the a2d-3 subunit gene without deletion. All other fetal tissues (lane 2, lung; lane 3, liver; lane 4, testis; lane 5, kidney; lane 6, spleen; lane 7, colon; lane 8, skeletal muscle; lane 9, stomach; lane 10, pancreas; lane 11, thymus; lane 12, placenta; lane 13, adrenal gland) as well as the adult tissues (lanes 14 and 16, normal kidney; lanes 15 and 17, conventional RCC tissue; lanes 18±20, conventional RCC cell lines; lanes 21±23, bladder cancer tissues; lanes 24±26, lung cancer cell lines) show either the 185 bp PCR product or both the 185 and 247 bp product. In some tissues a larger third fragment was seen, possible due to homologous basepairing. Cloning this fragment resulted in two fragments with size of 247 and 185 bp.
S. Hanke et al. / Gene 264 (2001) 69±75
3.3. Isolation of the calcium channel a 2d subunit gene Shotgun sequencing of the BAC clones 55m24 and 428i24 identi®ed three putative exons of 163, 193 and 151 bp in size, each with homology to calcium channel a2d subunit genes from different species. 5 0 - and 3 0 - RACEPCR with a human fetal brain cDNA library resulted in a full length cDNA clone of 3544 bp (accession number AJ272268). The open reading frame (ORF) encodes a 997 amino acids protein with signi®cant homology to the calcium channel a2d-3 subunit from mouse (accession number aj010949; Klugbauer et al., 1999). Compared to the mouse sequence, where the protein consists of 1040 amino acids, the N-terminal 44 amino acids are not present in the human gene. We found two TGA stop codons at positions 3±5 and 9±11 bp and the 5 0 -part of the gene from different cDNA libraries revealed the same structure indicating that we have cloned the full length transcript. This result was con®rmed by the isolation of full length cDNA clones with the same structure at the 5 0 - sequences of the gene from two adult kidney cDNA libraries. The cDNA clones from adult kidney and fetal brain libraries revealed two differences: (1) a 18 bp segment (position 1313±1320; codons 366 to 371) was not present in adult kidney, (2) a 62 bp frame shift deletion (position 1713 to 1774) resulted in a premature truncation of the deduced protein sequence after 519 amino acids in adult kidney (accession number AJ272213).
73
bp insertion of an unknown sequence was found after position 311 in a subpopulation of transcripts in the tumor sample, whereas the corresponding normal tissue sample revealed a 84 bp deletion (position 1540±1623) in 100% of transcripts. All other samples showed normal sequences within the coding region of the a2d-3 gene. 3.5. Distribution of a 2d-3 subunit exons The distribution of exons was analyzed by Southern-blot hybridization of HindIII digested BAC clones from the
3.4. Characterization of the a 2d-3 gene Expression of the human calcium channel a2d-3 subunit gene was studied by RT-PCR ampli®cation of the full length transcript from different fetal tissues. Using nested RT-PCR strong signals were seen in all human fetal tissues. We have also analyzed human fetal and adult tissues and tumor cell lines for expression of the splicing variants of transcript by using primers ¯anking the 62 bp deletion. Most fetal tissue samples, with exception of the fetal brain, expressed predominantly the smaller 185 bp fragment but in some cases the 247 bp fragment as well as a larger third fragment was seen (Fig. 3). Cloning the largest fragment, which is possible due to homologous basepairing, resulted in the two fragments with size of 247 and 185 bp. RT-PCR analysis revealed the 185 bp transcript in normal adult kidney and corresponding conventional RCC samples as well as in bladder and lung cancer cell lines (Fig. 3). We have sequenced the coding region of the calcium channel a2d-3 subunit gene from four paired normal/ tumor tissue samples (conventional RCCs HA350, HA388, HD110, HD112) and from 11 conventional RCC cell lines. We found a 5 bp deletion (position 1695±1699) in a subpopulation of transcripts of the primary tumor HA350. We did not ®nd this deletion in the cell line established from RCC HA350, but we detected an 85 bp insertion of an unknown sequence after position 252. In case HA388 a 95
Fig. 4. (A) Southern blot hybridization of HindIII digested BAC clones with the full length cDNA of the a2d-3 subunit gene as a probe. Asterisk marks a faint hybridisation signal which was seen only after long exposure of the Xray ®lm. Approximately size of positive HindIII fragments are given on the right. (B) Result of PCR using STS-primers from the 3 0 -end close to the polyA signal of the a2d-3 subunit gene. Only the YAC clone 870e5 was positive indicating that the 3 0 -end of the gene is located in the overhanging part of the YAC 870e5 outside the BAC contig.
74
S. Hanke et al. / Gene 264 (2001) 69±75
contig to the full length a2d-3 cDNA (Fig. 4A). Shot gun sequencing revealed a 163 and a 193 bp exon in the overlapping region of the BAC clones 55m24 and 428i24 and a 151 bp exon in the BAC 428i24. Corresponding, the hybridisation showed two signals of identical size in the two BACs and an additional signal in BAC 428i24. One genomic HindIII fragment of each BAC clone 158d7, 358e5 and 348i3 hybridized to the cDNA probe. The BACs 230a11 and 32c13 showed two and six positive HindIII fragments, respectively. Only the YAC clone 870e5 was positive when tested the YAC and BAC clones of the contig by STS-primers generated for the 3 0 -end of the cDNA close to the polyA signal. (Fig. 4B). Thus, the genomic structure of the human a2d-3 gene seems to spann approx. 500 kb from BAC 158d7 to the centromeric end of YAC 870e5 (see Fig. 2). The new microsatellite loci 55ca1 and 55attt1 revealed retention of both alleles in the conventional RCC HD188 and were mapped on BAC 55m24 but not on the neighbouring BACs 348i3 and 428i24. These microsatellite loci as well as locus D3S1289 showing LOH in case HD188 are located in the non-overlapping region of BAC 55m24, whereas, exons of the a2d-3 gene were found in the centromeric overlapping region of BACs 55m24 and 428i24 and in other parts of the contig. The interstitial deletion found in case HD188, presumably, does not involve an exon of the a2d-3 gene. 3.6. In silico cloning During preparation of this manuscript sequence data of 14 unordered fragments (AC018353) were placed on the website (www.ncbi.nlm.nih.gov/genome/seq). One of the fragments of 30252 bp contains the sequences of microsatellite D8S1289. We have identi®ed three putative exons by using the NIX program (www.hgmp.mrc.ac.uk). RT-PCR analysis revealed a good signal for each exon in distinct fetal tissues, normal adult kidneys and renal cell carcinomas as well as in bladder and lung cancer tissues. These sequences will be used for constructing full length cDNA which will be further analysed in different tumor types. 4. Discussion We have identi®ed a LOH of approx. 1 cM region around the locus D3S1289 on chromosome 3p21.1 by deletion mapping in a conventional RCC, constructed a detailed YAC/BAC contig and narrowed down the putative tumor suppressor gene region by using newly isolated microsatellites to a single BAC clone. We cloned the calcium channel a2d-3 subunit gene by shot gun sequencing of corresponding BAC clones. Database search for calcium channel a2d subunits revealed four human sequences mapped to the chromosome 3p21.3 region (accession numbers af042792, af042793, af040709, ab011130). These sequences represent type 2 subunit genes which were cloned from a homozygously deleted region identi®ed in lung cancer cell lines
(Wei et al., 1996). The human type 1 subunit gene (accession number M76559) has been published earlier (Williams et al., 1992). Recently, cloning the type 2 and type 3 genes from mouse and the diversity of calcium channel a2d subunits was reported by Klugbauer et al. (1999). The human calcium channel a2d-3 subunit gene has a full length transcript as well as a splice variants carrying a 62 bp frame shift deletion. Splice variants of the type 1 gene have also been found in various species and tissues (Ellis et al., 1988; Williams et al., 1992; Kim et al., 1992; Brust et al., 1993; Angelotti and Hofmann, 1996). Although one allele of the a2d-3 gene is deleted in 97% of conventional RCC, the lack of mutation of the remaining allele makes questionable the role of this gene in the development of conventional RCCs. Insertions of unknown sequences and deletions were observed not only in tumor but also in normal kidney samples. Of interest, the FHIT gene at chromosome 3p21.1, similarly to the calcium channel a2d subunit gene, showed a mixed population of transcripts with different insertions of unknown sequences in a RCC cell line (Bugert et al., 1997). Both the FHIT and a2d3 genes encompass a large genomic structure of approx. 1 Mb and 500 kb, respectively. The FHIT is located at the most common fragile site FRA3B at chromosome 3p21.1, which is a highly unstable region in the human genome. The insertions into and deletions of the mRNA of both genes may result from mitotic recombination within genomic sequences in subpopulations of cells or by processing error of the primary transcript. Several small homozygous deletions at chromosome 3p12 and 3p21.3-22 have been described in lung cancer cell lines (Latif et al., 1992; Daly et al., 1993; Yamakawa et al., 1993; Kok et al., 1994; Wei et al., 1996; Fong et al., 1997; Ong et al., 1997). Sekido et al. (1998) have recently identi®ed a homozygous deletion of 120 kb in a breast cancer cell line at 3p21.3 that overlaps those described in lung cancer cell lines. We found a LOH of approx. 100 kb at chromosome 3p21.1 in a conventional RCC. The calcium channel a2d-3 subunit gene as well as other calcium channel genes are cloned from the hemi- or homozygously deleted regions, but they were excluded to be tumor suppressor genes. It is possible that most of the small interstitial hemi- or homozygous `deletions' detected by LOH studies at chromosome 3p result from homologous recombination, which is a frequent genetic event in the human genome, especially in cancer cell lines (Tisch®eld, 1997). Analysing the three putative exons detected in silico within the target deletion of 100 kb at chromosome 3p21.1 will show whether the small interstitial deletion contains a tumor suppressor gene or it is a result of random genetic event in tumor cells. Acknowledgements This work was supported by a grant from the German Research Council (Ko 841/8-1).
S. Hanke et al. / Gene 264 (2001) 69±75
References Angelotti, T., Hofmann, F., 1996. Tissue-speci®c expression of splice variants of the mouse voltage-gated calcium channel alpha2/delta subunit. FEBS Lett. 397, 331±337. Brust, P.F., Simerson, S., McCue, A.F., Deal, C.R., Schoonmaker, S., Williams, M.E., Velicelebi, G., Johnson, E.C., Harpold, M.M., Ellis, S.B., 1993. Human neuronal voltage-dependent calcium channels: studies on subunit structure and role in channel assembly. Neuropharmacology 32, 1089±1102. Bugert, P., Wilhelm, M., Kovacs, G., 1997. FHIT gene and the FRA3B region are not involved in the genetics of renal cell carcinomas. Genes Chromosomes Cancer 20, 9±15. Chudek, J., Wilhelm, M., Bugert, P., Herbers, J., Kovacs, G., 1997. Detailed deletion mapping of chromosome 3p in non-papillary renal cell carcinoma by microsatellites. Int. J. Cancer 73, 225±229. Daly, M.C., Xiang, R.H., Buchhagen, D., Hensel, C.H., Garcia, D.K., Killary, A.M., Minna, J.D., Naylor, S.L., 1993. A homozygous deletion on chromosome 3 in a small cell lung cancer cell line correlates with a region of tumor suppressor activity. Oncogene 8, 1721±1729. Ellis, S.B., et al., 1988. Sequence and expression of mRNAs encoding the alpha 1 and alpha 2 subunits of a DHP-sensitive calcium channel. Science 241, 1661±1664. Fong, K.M., Biesterveld, E.J., Virmani, A., Wistuba, I., Sekido, Y., Bader, S.A., Ahmadian, M., Ong, S.T., Rassool, F.V., Zimmerman, P.V., Giaccone, G., Gazdar, A.F., Minna, J.D., 1997. FHIT and FRA3B 3p14.2 allele loss are common in lung cancer and preneoplastic bronchial lesions and are associated with cancer-related FHIT cDNA splicing aberrations. Cancer Res. 57, 2256±2267. Foster, K., Crossey, P.A., Cairns, P., Hetherington, J.W., Richards, F.M., Jones, M.H., Bentley, E., Affara, N.A., Ferguson-Smith, M.A., Maher, E.R., 1994. Molecular genetic investigation of sporadic renal cell carcinoma: analysis of allele loss on chromosomes 3p, 5q, 11p, 17 and 22. Br. J. Cancer 69, 230±234. Gnarra, J.R., et al., 1994. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat. Genet. 7, 85±90. Killary, A.M., Wolf, M.E., Giambernardi, T.A., Naylor, S.L., 1992. De®nition of a tumor suppressor locus within human chromosome 3p21-22. Proc. Natl. Acad. Sci. USA 89, 10877±10881. Kim, H.L., Kim, H., Lee, P., King, R.G., Chin, H., 1992. Rat brain expresses an alternatively spliced form of the dihydropyridine-sensitive L-type calcium channel alpha 2 subunit. Proc. Natl. Acad. Sci. USA 89, 3251±3255. Klugbauer, N., Lacinova, L., Marais, E., Hobom, M., Hofmann, F., 1999. Molecular diversity of the calcium channel alpha2delta subunit. J. Neurosci. 19, 684±691. Kok, K., et al., 1994. A homozygous deletion in a small cell lung cancer cell line involving a 3p21 region with a marked instability in yeast arti®cial chromosomes. Cancer Res. 54, 4183±4187. Kovacs, G., Frisch, S., 1989. Clonal chromosome abnormalities in tumor cells from patients with sporadic renal cell carcinomas. Cancer Res. 49, 651±659. Kovacs, G., Emanuel, A., Neumann, H.P.H., Kung, H., 1991. Cytogenetics
75
of renal cell carcinomas associated with von Hippel-Lindau disease. Genes Chromosomes Cancer 3, 256±262. Latif, F., et al., 1993. Identi®cation of the von Hippel-Lindau disease tumor suppressor gene. Science 260, 1317±1320. Latif, F., Tory, K., Modi, W.S., Graziano, S.L., Gamble, G., Douglas, J., Heppell-Parton, A.C., Rabbitts, P.H., Zbar, B., Lerman, M.I., 1992. Molecular characterization of a large homozygous deletion in the small cell lung cancer cell line U2020: a strategy for cloning the putative tumor suppressor gene. Genes Chromosomes Cancer 5, 119±127. Lott, S.T., Lovell, M., Naylor, S.L., Killary, A.M., 1998. Physical and functional mapping of a tumor suppressor locus for renal cell carcinoma within chromosome 3p12. Cancer Res. 58, 3533±3537. Lubinski, J., Hadaczek, P., Podolski, J., Toloczko, A., Sikorski, A., McCue, P., Druck, T., Huebner, K., 1994. Common regions of deletion in chromosome regions 3p12 and 3p14.2 in primary clear cell renal cell carcinomas. Cancer Res. 54, 3710±3713. Ong, S.T., Fong, K.M., Bader, S.A., Minna, J.D., Le Beau, M.M., McKeithan, T.W., Rassool, F.V., 1997. Precise localization of the FHIT gene to the common fragile site at 3p14.2 (FRA3B) and characterization of homozygous deletions within FRA3B that affect FHIT transcription in tumor cell lines. Genes Chromosomes Cancer 20, 16± 23. Sanchez, Y., el-Naggar, A., Pathak, S., Killary, A.M., 1994. A tumor suppressor locus within 3p14-p12 mediates rapid cell death of renal cell carcinoma in vivo. Proc. Natl. Acad. Sci. USA 91, 3383±3387. Sekido, Y., Ahmadian, M., Wistuba, I.I., Latif, F., Bader, S., Wie, M.H., Duh, F.M., Gazdar, A.F., Lerman, M.I., Minna, J.D., 1998. Cloning of a breast cancer homozygous deletion junction narrows the region of search for a 3p21.3 tumor suppressor gene. Oncogene 16, 3151±3157. Tisch®eld, Y.A., 1997. Loss of heterozygsity or: How I learned to stop worrying and love mitotic recombination. Am. J. Hum. Genet. 61, 995±999. van der Hout, A.H., van der Vlies, P., Wijmenga, C., Li, F.P., Oosterhuis, J.W., Buys, C.H.C.M., 1991. The region of common allelic losses in sporadic renal cell carcinoma is bordered by the loci D3S2 and THRB. Genomics 11, 537±542. Wei, M.H., Latif, F., Bader, S., Kashuba, V., Chen, J.Y., Duh, F.M., Sekido, Y., Lee, C.C., Geil, L., Kuzmin, I., Zabarovsky, E., Klein, G., Zbar, B., Minna, J.D., Lerman, M.I., 1996. Construction of a 600-kilobase cosmid clone contig and generation of a transcriptional map surrounding the lung cancer tumor suppressor gene (TSG) locus on human chromosome 3p21.3: progress toward the isolation of a lung cancer TSG. Cancer Res. 56, 1487±1492. Williams, M.E., Feldman, D.H., McCue, A.F., Brenner, R., Velicelebi, G., Ellis, S.B., Harpold, M.M., 1992. Structure and functional expression of alpha 1, alpha 2, and beta subunits of a novel human neuronal calcium channel subtype. Neuron 8, 71±84. Yamakawa, K., Morita, R., Takahashi, E., Hori, T., Ishikawa, J., Nakamura, Y., 1991. A detailed deletion mapping of the short arm of chromosome 3 in sporadic renal cell carcinoma. Cancer Res. 51, 4707±4711. Yamakawa, K., Takahashi, T., Horio, Y., Murata, Y., Takahashi, E., Hibi, K., Yokoyama, S., Ueda, R., Takahashi, T., Nakamura, Y., 1993. Frequent homozygous deletions in lung cancer cell lines detected by a DNA marker located at 3p21.3-p22. Oncogene 8, 327±330.