- Email: [email protected]
Cloning and analysis of the CYP1A promoter from the atlantic killifish (Fundulus heteroclitus)
MARINE ENVIRONMENTAL RESEARCH Marine Environmental Research 58 (2004) 119–124 www.elsevier.com/locate/marenvrev
Cloning and analysis of the CYP1A promoter from the atlantic killifish (Fundulus heteroclitus) Wade H. Powell a,b,*, Hilary G. Morrison c, E.Jennifer Weil c, Sibel I. Karchner a, Mitchell L. Sogin c, John J. Stegeman a, Mark E. Hahn a a
Woods Hole Oceanographic Institution, Woods Hole, MA, USA b Kenyon College, Gambier, Ohio, USA c Marine Biological Laboratory, Woods Hole, MA, USA
Abstract Enzymes in the cytochrome P450 gene family 1 (CYP1) catalyze the metabolic activation of numerous hydrocarbon carcinogens and various natural compounds. CYP1 family members have been identified in several vertebrates, including fish, amphibians, birds, and mammals, and are inducible by aromatic hydrocarbons acting through the aryl hydrocarbon receptor (AHR). Together with its heterodimeric partner ARNT, the ligand-bound AHR binds conserved xenobiotic response elements (XREs) near the promoter of CYP1A and other genes. However, some populations of the Atlantic killifish Fundulus heteroclitus inhabiting highly contaminated sites are refractory to CYP1A induction by aromatic hydrocarbons. To better understand the mechanisms underlying this phenomenon, we are characterizing the AHRCYP1A signaling pathway in this species. We report here the characterization of a genomic clone containing the 50 end of the wild-type F. heteroclitus CYP1A gene. The 50 coding sequence matches that of the F. heteroclitus CYP1A cDNA reported earlier [Comp. Biochem. Physiol. 121C (1998) 231]. Consistent with its inducibility by AHR agonists, the CYP1A gene contains three consensus XREs (50 CACGC30 ) within 1.6 kb of the putative transcriptional start site. When oligonucleotides containing each of these sites were analyzed in an electrophoretic mobility shift assay, one of these showed a strong, TCDD-inducible mobility shift in the presence of in vitro expressed mouse AHR protein. These sequence data and initial functional characterization provide a valuable tool for the study of genetic variations in
*
Corresponding author. Tel.: +1-740-427-5396; fax: +1-740-427-5741. E-mail address: [email protected] (W.H. Powell).
0141-1136/$ - see front matter Ó 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.marenvres.2004.03.005
120
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
CYP1A expression and activity in sensitive and resistant populations. These studies may ultimately shed light on the importance of P4501A activity in xenobiotic toxicity. Ó 2004 Elsevier Ltd. All rights reserved. Keywords: AH receptor; Biochemistry; CYP1A; Fundulus heteroclitus; Fish; Halogenated hydrocarbons; Hydrocarbons; Transcriptional regulation
Members of the CYP1A subfamily of cytochromes P450 have been identified in a wide range of vertebrates, including fish, amphibians, birds, and mammals. Induction of CYP1A expression results from exposure to numerous contaminants, including polynuclear aromatic hydrocarbons (PAHs) and halogenated aromatic hydrocarbons (HAHs) (Stegeman & Hahn, 1994). This process is regulated through the aryl hydrocarbon receptor (AHR) signaling pathway. Contaminant ligands bind the AHR in the cytosol, triggering its translocation to the nucleus, where in complex with the ARNT protein, it binds conserved xenobiotic response elements (XREs) near the promoter of CYP1A and other genes. Although the toxicity of these compounds likely depends upon AHR signaling, the role of CYP1A activity in the toxic mechanism is not firmly established for all AHR ligands. However, induction of CYP1A expression is widely used as a biomarker of exposure and a readily measured endpoint in studies of the mechanisms of AHR signaling (Hahn, 2002). The Atlantic killifish (Fundulus heteroclitus) is a well characterized marine fish model of aromatic hydrocarbon toxicology. These fish are ordinarily susceptible to both HAH and PAH toxicity, and several AHR signaling components have been identified, including cDNAs for two AHR proteins (Karchner, Powell, & Hahn, 1999), ARNT2 (Powell, Karchner, Bright, & Hahn, 1999), and CYP1A (Morrison, Weil, Karchner, Sogin, & Stegeman, 1998). However, some F. heteroclitus populations inhabiting highly contaminated sites are refractory to CYP1A induction by aromatic hydrocarbons and relatively resistant to contaminant-induced lethality (e.g., Nacci et al., 1999; Van Veld & Westbrook, 1995). To better understand the molecular mechanisms underlying this phenomenon, we are characterizing the AHR-CYP1A signaling pathway in sensitive and resistant populations. We report here the characterization of a genomic clone containing the 50 end of the F. heteroclitus CYP1A gene. The previously isolated CYP1A cDNA (Morrison et al., 1998) was labeled and used to probe a lambda FixII genomic library (provided by Dr. Dennis Powers, Hopkins Marine Station, Pacific Grove, CA) as described (Karchner et al., 1999), resulting in identification of a genomic clone of approximately 14 kbp. The clone was digested with a number of restriction enzymes to produce a 2.5-kbp fragment containing a 1625-bp upstream region (including a TATA box at position )31), the putative transcriptional start site (+1), a non-coding 50 exon (112 bp), a 320-bp intron, and a portion of a second exon, which contained codons for the initiating methionine and 154 additional amino acids (Fig. 1). This sequence has been deposited in GenBank Accession No. AY292501. The sequence was examined using the MatInspector program (Quandt, Frech, Karas, Wingender, & Werner, 1995), and three consensus xenobiotic responsive
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
121
Fig. 1. Upstream sequence of F. heteroclitus CYP1A genomic clone. Nucleotide numbers at left and right indicate relationship to the transcriptional start site (+1). Three XRE positions are boxed and labeled above, as is the consensus TATA box. Putative GRE sequences are underlined and labeled above. Additional labels above sequence indicate starting positions of exons and introns within the transcript and the deduced amino acid sequence of the encoded protein. Approximately, 400 bp of the reported sequence, all 30 to the last nucleotide, are not shown. GenBank Accession No. AY292501.
122
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
elements (XREs; 50 -CACGCNA-30 ) were identified and designated XRE3 (position )197), XRE2 ()737), and XRE1 ()197) (Fig. 1). Double-stranded oligonucleotides containing each XRE were analyzed in an electrophoretic mobility shift assay as previously described (Karchner et al., 1999) using F. heteroclitus ARNT2 and mouse AHR synthesized in vitro (TNT; Promega) (see Fig. 2). Dimers of these proteins were previously shown to exhibit robust activity in vitro (Powell et al., 1999). XRE1 supported a strong, TCDD-inducible band shift with an intensity exceeding that of an XRE-containing oligonucleotide derived from the mouse CYP1A1 gene. XRE3supported DNA binding to a lesser degree, while XRE2 exhibited no detectable DNA binding activity. The functional significance of these differences is unclear, and experiments using portions of this region coupled to a reporter gene will be required to determine the relative abilities of these elements to support AHR-regulated transcription, both individually and in various combinations. Additional regulatory regions within this DNA sequence may also affect the expression of F. heteroclitus CYP1A. Besides the XRE sequences, MatInspector analysis revealed a glucocorticoid response element (GRE) half-site ()1177), and three sites that differ from the consensus GRE at only one position ()1089, )596, and +282) The presence of GRE sequences is consistent with the potentiation of
Fig. 2. AHR:ARNT binding by XRE sequences from the F. heteroclitus CYP1A promoter. Gel shift assays were performed as described in Karchner et al. (1999), using mouse AHR and F. heteroclitus ARNT2 synthesized in vitro using rabbit reticulocyte lysates. Proteins were treated with DMSO (0.8% of total reaction volume; lanes 1, 3, 5, 7) or 20 nM TCDD (in DMSO; lanes 2, 4, 6, 8) and subsequently incubated with XRE oligonucleotide probes derived from the upstream regulatory region of mouse CYP1A1 (lanes 1, 2) or F. heteroclitus CYP1A (lanes 3–8). Probes were matched for mass and radioactivity in each reaction. An arrowhead indicates the position of TCDD-stimulated shifted bands. Nonspecifically shifted bands are indicated by a star. Probe sequences (50 ! 30 ): XRE1, AGGTACAAGCACGCAATTGCATCT; XRE2, TTGTAATGCACGCGAATTGTGTAC; XRE3, TCGCATCCTTTGTAATGCACGCGAATTGTG.
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
123
TCDD- or b-naphthoflavone-induced CYP1A expression by glucocorticoids in the fish cell line, PLHC-1 (Celander, Bremer, Hahn, & Stegeman, 1997). Furthermore, XRE, GRE, or other regulatory elements might exist in regions upstream of this genomic fragment, possibly contributing to the regulation of CYP1A expression. This promoter sequence and initial functional characterization provide a valuable tool for probing the regulation of CYP1A expression at the molecular level, complementing previous efforts to understand the biochemistry of AHR and other proteins involved in this process (Karchner et al., 1999; Powell et al., 1999; Karchner, Franks, Powell, & Hahn, 2002). F. heteroclitus DNA used to construct the genomic library employed here was extracted from fish collected from a presumably uncontaminated site on the Maine (USA) coast. Thus, this study also provides a basis of comparison for the study of genetic variations in CYP1A expression in populations of F. heteroclitus that inhabit chronically contaminated sites and display contaminant resistance. Population-specific differences in the regulatory sequences and/or aspects of their methylation or chromatin packaging may have a role in the CYP1A refractory phenotype observed in fish occupying chronically contaminated environments. The degree to which inducibility of CYP1A is specifically targeted in the development of HAH resistance may have broader implications in understanding the role of this enzyme in mediating the toxicity of these compounds.
Acknowledgements We think Dr. Dennis Powers and Dr. Joel Sohn (Hopkins Marine Station, Pacific Grove, CA) for providing the F. heteroclitus genomic DNA library. This work was supported by the National Institute of Environmental Health: Superfund Basic Research Center at Boston University (5P42ES07381; M.E.H.) and F32ES05800 (W.H.P.). This is contribution number 10920 from the Woods Hole Oceanographic Institution. References Celander, M., Bremer, J., Hahn, M. E., & Stegeman, J. J. (1997). Glucocorticoid-xenobiotic interactions: Dexamethasone potentiation of cytochrome P4501A induction by b-naphthoflavone in a fish hepatoma cell line (PLHC-1). Environmental Toxicology and Chemistry, 16, 900–907. Hahn, M. E. (2002). Biomarkers and bioassays for detecting dioxin-like compounds in the marine environment. The Science of the Total Environment, 289, 49–69. Karchner, S. I., Franks, D. G., Powell, W. H., & Hahn, M. E. (2002). Regulatory interactions among three members of the vertebrate aryl hydrocarbon receptor family: AHR repressor, AHR1, and AHR2. Journal of Biological Chemistry, 277, 6949–6959. Karchner, S. I., Powell, W. H., & Hahn, M. E. (1999). Structural and functional characterization of two highly divergent aryl hydrocarbon receptors (AHR1 and AHR2) in the teleost Fundulus heteroclitus. Evidence for a novel class of ligand-binding basic helix-loop-helix Per-ARNT-Sim (bHLH-PAS) factors. Journal of Biological Chemistry, 274, 33814–33824. Morrison, H. G., Weil, E. J., Karchner, S. I., Sogin, M. L., & Stegeman, J. J. (1998). Molecular cloning of CYP1A from the estuarine fish Fundulus heteroclitus and phylogenetic analysis of CYP1A genes: Update with new sequences. Comparative Biochemistry and Physiology, 121C, 231–240.
124
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
Nacci, D., Coiro, L., Champlin, D., Jayaraman, S., McKinney, R., Gleason, T., Munns, W. R., Jr., Specker, J. L., & Cooper, K. (1999). Adaptation of wild populations of the estuarine fish Fundulus heteroclitus to persistent environmental contaminants. Marine Biology, 134, 9–17. Powell, W. H., Karchner, S. I., Bright, R., & Hahn, M. E. (1999). Functional diversity of vertebrate ARNT proteins: Identification of ARNT2 as the predominant form of ARNT in the marine teleost, Fundulus heteroclitus. Archives of Biochemistry and Biophysics, 361, 156–163. Quandt, K., Frech, K., Karas, H., Wingender, E., & Werner, T. (1995). Matind and MatInspector – new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research, 23, 4878–4884. Stegeman, J. J., & Hahn, M. E. (1994). Biochemistry and molecular biology of monooxygenases: Current perspectives on forms, functions, and regulation of cytochrome P450 in aquatic species. In D. C. Malins & G. K. Ostrander (Eds.), Aquatic toxicology: Molecular, biochemical and cellular perspectives (pp. 87–206). Boca Raton: CRC/Lewis. Van Veld, P. A., & Westbrook, D. J. (1995). Evidence for depression of cytochrome P4501A in a population of chemically resistant mummichog (Fundulus heteroclitus). Environmental Sciences, 3, 221– 234.
Cloning and analysis of the CYP1A promoter from the atlantic killifish (Fundulus heteroclitus) Wade H. Powell a,b,*, Hilary G. Morrison c, E.Jennifer Weil c, Sibel I. Karchner a, Mitchell L. Sogin c, John J. Stegeman a, Mark E. Hahn a a
Woods Hole Oceanographic Institution, Woods Hole, MA, USA b Kenyon College, Gambier, Ohio, USA c Marine Biological Laboratory, Woods Hole, MA, USA
Abstract Enzymes in the cytochrome P450 gene family 1 (CYP1) catalyze the metabolic activation of numerous hydrocarbon carcinogens and various natural compounds. CYP1 family members have been identified in several vertebrates, including fish, amphibians, birds, and mammals, and are inducible by aromatic hydrocarbons acting through the aryl hydrocarbon receptor (AHR). Together with its heterodimeric partner ARNT, the ligand-bound AHR binds conserved xenobiotic response elements (XREs) near the promoter of CYP1A and other genes. However, some populations of the Atlantic killifish Fundulus heteroclitus inhabiting highly contaminated sites are refractory to CYP1A induction by aromatic hydrocarbons. To better understand the mechanisms underlying this phenomenon, we are characterizing the AHRCYP1A signaling pathway in this species. We report here the characterization of a genomic clone containing the 50 end of the wild-type F. heteroclitus CYP1A gene. The 50 coding sequence matches that of the F. heteroclitus CYP1A cDNA reported earlier [Comp. Biochem. Physiol. 121C (1998) 231]. Consistent with its inducibility by AHR agonists, the CYP1A gene contains three consensus XREs (50 CACGC30 ) within 1.6 kb of the putative transcriptional start site. When oligonucleotides containing each of these sites were analyzed in an electrophoretic mobility shift assay, one of these showed a strong, TCDD-inducible mobility shift in the presence of in vitro expressed mouse AHR protein. These sequence data and initial functional characterization provide a valuable tool for the study of genetic variations in
*
Corresponding author. Tel.: +1-740-427-5396; fax: +1-740-427-5741. E-mail address: [email protected] (W.H. Powell).
0141-1136/$ - see front matter Ó 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.marenvres.2004.03.005
120
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
CYP1A expression and activity in sensitive and resistant populations. These studies may ultimately shed light on the importance of P4501A activity in xenobiotic toxicity. Ó 2004 Elsevier Ltd. All rights reserved. Keywords: AH receptor; Biochemistry; CYP1A; Fundulus heteroclitus; Fish; Halogenated hydrocarbons; Hydrocarbons; Transcriptional regulation
Members of the CYP1A subfamily of cytochromes P450 have been identified in a wide range of vertebrates, including fish, amphibians, birds, and mammals. Induction of CYP1A expression results from exposure to numerous contaminants, including polynuclear aromatic hydrocarbons (PAHs) and halogenated aromatic hydrocarbons (HAHs) (Stegeman & Hahn, 1994). This process is regulated through the aryl hydrocarbon receptor (AHR) signaling pathway. Contaminant ligands bind the AHR in the cytosol, triggering its translocation to the nucleus, where in complex with the ARNT protein, it binds conserved xenobiotic response elements (XREs) near the promoter of CYP1A and other genes. Although the toxicity of these compounds likely depends upon AHR signaling, the role of CYP1A activity in the toxic mechanism is not firmly established for all AHR ligands. However, induction of CYP1A expression is widely used as a biomarker of exposure and a readily measured endpoint in studies of the mechanisms of AHR signaling (Hahn, 2002). The Atlantic killifish (Fundulus heteroclitus) is a well characterized marine fish model of aromatic hydrocarbon toxicology. These fish are ordinarily susceptible to both HAH and PAH toxicity, and several AHR signaling components have been identified, including cDNAs for two AHR proteins (Karchner, Powell, & Hahn, 1999), ARNT2 (Powell, Karchner, Bright, & Hahn, 1999), and CYP1A (Morrison, Weil, Karchner, Sogin, & Stegeman, 1998). However, some F. heteroclitus populations inhabiting highly contaminated sites are refractory to CYP1A induction by aromatic hydrocarbons and relatively resistant to contaminant-induced lethality (e.g., Nacci et al., 1999; Van Veld & Westbrook, 1995). To better understand the molecular mechanisms underlying this phenomenon, we are characterizing the AHR-CYP1A signaling pathway in sensitive and resistant populations. We report here the characterization of a genomic clone containing the 50 end of the F. heteroclitus CYP1A gene. The previously isolated CYP1A cDNA (Morrison et al., 1998) was labeled and used to probe a lambda FixII genomic library (provided by Dr. Dennis Powers, Hopkins Marine Station, Pacific Grove, CA) as described (Karchner et al., 1999), resulting in identification of a genomic clone of approximately 14 kbp. The clone was digested with a number of restriction enzymes to produce a 2.5-kbp fragment containing a 1625-bp upstream region (including a TATA box at position )31), the putative transcriptional start site (+1), a non-coding 50 exon (112 bp), a 320-bp intron, and a portion of a second exon, which contained codons for the initiating methionine and 154 additional amino acids (Fig. 1). This sequence has been deposited in GenBank Accession No. AY292501. The sequence was examined using the MatInspector program (Quandt, Frech, Karas, Wingender, & Werner, 1995), and three consensus xenobiotic responsive
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
121
Fig. 1. Upstream sequence of F. heteroclitus CYP1A genomic clone. Nucleotide numbers at left and right indicate relationship to the transcriptional start site (+1). Three XRE positions are boxed and labeled above, as is the consensus TATA box. Putative GRE sequences are underlined and labeled above. Additional labels above sequence indicate starting positions of exons and introns within the transcript and the deduced amino acid sequence of the encoded protein. Approximately, 400 bp of the reported sequence, all 30 to the last nucleotide, are not shown. GenBank Accession No. AY292501.
122
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
elements (XREs; 50 -CACGCNA-30 ) were identified and designated XRE3 (position )197), XRE2 ()737), and XRE1 ()197) (Fig. 1). Double-stranded oligonucleotides containing each XRE were analyzed in an electrophoretic mobility shift assay as previously described (Karchner et al., 1999) using F. heteroclitus ARNT2 and mouse AHR synthesized in vitro (TNT; Promega) (see Fig. 2). Dimers of these proteins were previously shown to exhibit robust activity in vitro (Powell et al., 1999). XRE1 supported a strong, TCDD-inducible band shift with an intensity exceeding that of an XRE-containing oligonucleotide derived from the mouse CYP1A1 gene. XRE3supported DNA binding to a lesser degree, while XRE2 exhibited no detectable DNA binding activity. The functional significance of these differences is unclear, and experiments using portions of this region coupled to a reporter gene will be required to determine the relative abilities of these elements to support AHR-regulated transcription, both individually and in various combinations. Additional regulatory regions within this DNA sequence may also affect the expression of F. heteroclitus CYP1A. Besides the XRE sequences, MatInspector analysis revealed a glucocorticoid response element (GRE) half-site ()1177), and three sites that differ from the consensus GRE at only one position ()1089, )596, and +282) The presence of GRE sequences is consistent with the potentiation of
Fig. 2. AHR:ARNT binding by XRE sequences from the F. heteroclitus CYP1A promoter. Gel shift assays were performed as described in Karchner et al. (1999), using mouse AHR and F. heteroclitus ARNT2 synthesized in vitro using rabbit reticulocyte lysates. Proteins were treated with DMSO (0.8% of total reaction volume; lanes 1, 3, 5, 7) or 20 nM TCDD (in DMSO; lanes 2, 4, 6, 8) and subsequently incubated with XRE oligonucleotide probes derived from the upstream regulatory region of mouse CYP1A1 (lanes 1, 2) or F. heteroclitus CYP1A (lanes 3–8). Probes were matched for mass and radioactivity in each reaction. An arrowhead indicates the position of TCDD-stimulated shifted bands. Nonspecifically shifted bands are indicated by a star. Probe sequences (50 ! 30 ): XRE1, AGGTACAAGCACGCAATTGCATCT; XRE2, TTGTAATGCACGCGAATTGTGTAC; XRE3, TCGCATCCTTTGTAATGCACGCGAATTGTG.
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
123
TCDD- or b-naphthoflavone-induced CYP1A expression by glucocorticoids in the fish cell line, PLHC-1 (Celander, Bremer, Hahn, & Stegeman, 1997). Furthermore, XRE, GRE, or other regulatory elements might exist in regions upstream of this genomic fragment, possibly contributing to the regulation of CYP1A expression. This promoter sequence and initial functional characterization provide a valuable tool for probing the regulation of CYP1A expression at the molecular level, complementing previous efforts to understand the biochemistry of AHR and other proteins involved in this process (Karchner et al., 1999; Powell et al., 1999; Karchner, Franks, Powell, & Hahn, 2002). F. heteroclitus DNA used to construct the genomic library employed here was extracted from fish collected from a presumably uncontaminated site on the Maine (USA) coast. Thus, this study also provides a basis of comparison for the study of genetic variations in CYP1A expression in populations of F. heteroclitus that inhabit chronically contaminated sites and display contaminant resistance. Population-specific differences in the regulatory sequences and/or aspects of their methylation or chromatin packaging may have a role in the CYP1A refractory phenotype observed in fish occupying chronically contaminated environments. The degree to which inducibility of CYP1A is specifically targeted in the development of HAH resistance may have broader implications in understanding the role of this enzyme in mediating the toxicity of these compounds.
Acknowledgements We think Dr. Dennis Powers and Dr. Joel Sohn (Hopkins Marine Station, Pacific Grove, CA) for providing the F. heteroclitus genomic DNA library. This work was supported by the National Institute of Environmental Health: Superfund Basic Research Center at Boston University (5P42ES07381; M.E.H.) and F32ES05800 (W.H.P.). This is contribution number 10920 from the Woods Hole Oceanographic Institution. References Celander, M., Bremer, J., Hahn, M. E., & Stegeman, J. J. (1997). Glucocorticoid-xenobiotic interactions: Dexamethasone potentiation of cytochrome P4501A induction by b-naphthoflavone in a fish hepatoma cell line (PLHC-1). Environmental Toxicology and Chemistry, 16, 900–907. Hahn, M. E. (2002). Biomarkers and bioassays for detecting dioxin-like compounds in the marine environment. The Science of the Total Environment, 289, 49–69. Karchner, S. I., Franks, D. G., Powell, W. H., & Hahn, M. E. (2002). Regulatory interactions among three members of the vertebrate aryl hydrocarbon receptor family: AHR repressor, AHR1, and AHR2. Journal of Biological Chemistry, 277, 6949–6959. Karchner, S. I., Powell, W. H., & Hahn, M. E. (1999). Structural and functional characterization of two highly divergent aryl hydrocarbon receptors (AHR1 and AHR2) in the teleost Fundulus heteroclitus. Evidence for a novel class of ligand-binding basic helix-loop-helix Per-ARNT-Sim (bHLH-PAS) factors. Journal of Biological Chemistry, 274, 33814–33824. Morrison, H. G., Weil, E. J., Karchner, S. I., Sogin, M. L., & Stegeman, J. J. (1998). Molecular cloning of CYP1A from the estuarine fish Fundulus heteroclitus and phylogenetic analysis of CYP1A genes: Update with new sequences. Comparative Biochemistry and Physiology, 121C, 231–240.
124
W.H. Powell et al. / Marine Environmental Research 58 (2004) 119–124
Nacci, D., Coiro, L., Champlin, D., Jayaraman, S., McKinney, R., Gleason, T., Munns, W. R., Jr., Specker, J. L., & Cooper, K. (1999). Adaptation of wild populations of the estuarine fish Fundulus heteroclitus to persistent environmental contaminants. Marine Biology, 134, 9–17. Powell, W. H., Karchner, S. I., Bright, R., & Hahn, M. E. (1999). Functional diversity of vertebrate ARNT proteins: Identification of ARNT2 as the predominant form of ARNT in the marine teleost, Fundulus heteroclitus. Archives of Biochemistry and Biophysics, 361, 156–163. Quandt, K., Frech, K., Karas, H., Wingender, E., & Werner, T. (1995). Matind and MatInspector – new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research, 23, 4878–4884. Stegeman, J. J., & Hahn, M. E. (1994). Biochemistry and molecular biology of monooxygenases: Current perspectives on forms, functions, and regulation of cytochrome P450 in aquatic species. In D. C. Malins & G. K. Ostrander (Eds.), Aquatic toxicology: Molecular, biochemical and cellular perspectives (pp. 87–206). Boca Raton: CRC/Lewis. Van Veld, P. A., & Westbrook, D. J. (1995). Evidence for depression of cytochrome P4501A in a population of chemically resistant mummichog (Fundulus heteroclitus). Environmental Sciences, 3, 221– 234.