Cloning and characterisation of mmc-1, a microfilarial-specific gene, from Brugia pahangi

International Journal for Parasitology 32 (2002) 415–424 www.parasitology-online.com

Cloning and characterisation of mmc-1, a microfilarial-specific gene, from Brugia pahangi Richard Emes a, Fiona Thompson a, Joyce Moore a, Xingxing Zang b, Eileen Devaney a,* a

b

Department of Veterinary Parasitology, University of Glasgow, Bearsden Road, Glasgow G61 1QH, UK Institute of Cell, Animal and Population Biology, Ashworth Laboratories, King’s Buildings, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, UK Received 24 October 2001; received in revised form 14 December 2001; accepted 14 December 2001

Abstract Nine differentially expressed genes were cloned from Brugia pahangi in a screen which sought to identify cDNAs that were differentially expressed between the microfilariae from the mammalian host and the mosquito vector. One gene (mmc-1), that was up-regulated in mammalian-derived microfilariae, was characterised in detail. RT-PCR analysis demonstrated that mmc-1 was specific to the microfilarial stage of the life cycle and was not transcribed by developing microfilariae in utero, but only following the release of the microfilariae from the adult female. Analysis of DNA from other filarial worms suggested that mmc-1 may be a Brugia-specific gene. Using serum samples from individuals exposed to Brugia malayi infection, it was shown that MMC-1 was specifically recognised by antibodies of the IgG3 subclass. mmc-1 has no homologues in the data bases and its function in the parasite is unknown. q 2002 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Differential screen; Stage-specific gene expression

1. Introduction The lymphatic filarial nematodes are tissue-dwelling parasites transmitted to humans by the bite of a mosquito vector. Three species, Wuchereria bancrofti, Brugia malayi and Brugia timori, cause disease in humans and it is estimated that over 128 million people are currently infected world wide (Michael and Bundy, 1997). The prevalence of this disease is testament to the highly evolved nature of the host–parasite relationship. The microfilaria of the lymphatic filariae is a specialised first stage larva evolved for life in the blood of the definitive host and for transmission to the mosquito. In many parts of the world, microfilariae exhibit a daily periodic cycle that maximises the numbers in the peripheral blood to coincide with the feeding habits of the local mosquito population (Hawking et al., 1964, 1966, 1981). The determining factor in this periodic behaviour is thought to be an ability to respond to the relative oxygen tension in venous and arteriole blood (Hawking et al., 1981). How they respond to such physico-chemical cues is not understood, although it is known that the microfilariae of * Corresponding author. Tel.: 144-141-330-6925; fax: 144-141-3305603. E-mail address: [email protected] (E. Devaney).

Brugia posses a differentiated nervous system with ciliated amphid sense organs (Laurence and Simpson, 1974). It is likely that the sensory system is still developing throughout the first larval stage as microfilariae specifically express a gene for a glia maturation factor (Bm-gMf-1) that promotes differentiation of glia and neurons (Liu et al., 1997). As the major reservoir of infection in an endemic community, the numbers of microfilariae can reach very high levels in the peripheral blood, where they exert a profound effect on the host immune response. Although all infected/exposed individuals suffer from some degree of antigen-specific immune suppression (Yazdanbakhsh et al., 1993), T cell proliferative responses are most impaired in microfilaraemic individuals (King and Nutman, 1991; Maizels et al., 1995; Sartono et al., 1999). Moreover, clearance of the microfilariae with ivermectin or with diethylcarbamazine (Kurniawan-Atmadja et al., 1995) is reported to restore T cell proliferative and IFN-g responses. IgG subclass responses to parasite antigen are similarly skewed in active infection, with IgG4 antibodies dominating the subclass response, particularly in microfilaraemic individuals (Hussain et al., 1987; Kurniawan et al., 1993). Out of necessity, most studies on immune responses in lymphatic filariasis have used complex extracts of adult parasites to stimulate peripheral blood mononuclear cells from infected individuals or in

0020-7519/02/$20.00 q 2002 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(02)00003-6

416

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

antibody assays. Hence, the read-out of the assay is the sum of a number of different responses to a variety of antigens, some of which may elicit contrasting immune responses. More recently, the increasing availability of cloned antigens has allowed immune responses to specific molecules to be studied (Trenholme et al., 1994; Yazdanbakhsh et al., 1995). In this paper, we describe the cloning and characterisation of a microfilaria-specific gene (Bp-mmc-1) and the IgG subclass response elicited by this protein in infected humans. 2. Materials and methods 2.1. Production of the microfilarial cDNA library A two-step PCR approach was used to produce the cDNA for construction of the library. Approximately 1 £ 10 6 microfilariae were purified from infected jirds by centrifugation over Lymphoprep (Sigma) (Devaney et al., 1992), washed extensively in Hanks’ Balanced Salt Solution (HBSS) and total RNA isolated using TRIzol (GibcoBRL). First strand cDNA was generated using an adapted oligo (dT) primer (Martin et al., 1995). Ten rounds of amplification were conducted using oligo dT and SL1 primers as follows: 948C, 1 min; 558C, 1 min; 728C, 5 min. The products from several such PCRs were mixed, size separated using a Sepharose 400 column (Pharmacia) and cDNA of $200 bp collected. These products were used in a further 20 cycles of PCR as described previously. Ten micrograms of cDNA was digested using EcoRI and XhoI, further size separated and then 150 ng of cDNA was ligated into the Uni-ZAP XR vector and packaged following the manufacturer’s protocol (Stratagene). The primary library had a titre of 3.3 £ 10 5 pfu and contained 94% recombinants, with an average insert size of approximately 550 bp.

microfilariae through the insect midgut. The microfilariae were collected and cultured at 288C (5% CO2) in Grace’s insect medium for 16 h and were designated ‘vectorderived’ microfilariae. Duplicate filter lifts of 2 £ 10 4 pfu of the unamplified primary library were screened with cDNA probes from either mammalian or vector-derived microfilariae, radiolabelled to approximately equal activity (Martin et al., 1995). The hybridised filters were washed to high stringency (0.1 £ SSC, 0.1% SDS) and exposed to X-ray film. Clones which hybridised with greater intensity to one or other cDNA probe were picked and inserts excised from the lambda vector according to the manufacturer’s protocol (Stratagene). Clones of interest were sequenced on both strands using a LI-COR model 400 fluorescent sequencer. Differential expression was confirmed by reverse northern (Fryxell and Meyerowitz, 1987). Briefly, differentially hybridising phage were ‘tooth-picked’ from agar plates, liberated into SM buffer and amplified by PCR with flanking primer sequences (T3, T7). Equal quantities of diluted (1:100) PCR products were blotted in duplicate to form two identical Southern blots, which were differentially screened as before. 2.3. 3 0 Race To clone the full length transcript of mmc-1, a higher stringency PCR was employed on first stand cDNA synthesised using 2 mM of adapted oligo dT primer (GTCAGATCTACGCGTCGACCTCGAGT 17). PCR was carried out as follows: 30 cycles of 948C, 1 min; 628C, 1 min; 728C, 2 min using mmc-1 F1 see subsequently) and adapter primers. An amplicon of approximately 300 bp was sequenced and shown to be the true 3 0 end of the mmc-1 gene. 2.4. Northern and Southern blots

2.2. Screening of the microfilarial cDNA library The microfilarial cDNA library was screened using two separate probes and clones which hybridised with greater intensity to one or other cDNA probe were isolated for further analysis. For the preparation of the cDNA probes, microfilariae isolated from the peritoneal cavity of a jird, as described previously, were cultured for 16 h at 378C (5% CO2in air) in MEM containing 10% heat inactivated FCS (all Gibco-BRL). This population was designated the ‘mammalian-derived’ microfilariae. The second group of microfilariae were exsheathed by incubation in 1 mg/ml Pronase (Protease type XIV from Streptomyces griseus, Sigma) in HBSS for 10 min at room temperature. This procedure routinely produced .95% exsheathment, as determined by phase contrast light microscopy. Microfilariae were washed and resuspended in 2 ml Grace’s insect tissue culture medium (Gibco-BRL) and further purified by migration through an agarose pad (Greene and Schiller, 1979), which also mimics the migration of the exsheathed

Standard techniques were used for Northern and Southern blots (Sambrook et al., 1989). Two micrograms of total RNA isolated from approximately 1 £ 10 6 microfilariae or 200 mixed sex adults was used for the production of Northern blots. Twenty micrograms of high molecular weight genomic DNA isolated from 200 to 300 mixed sex adult Brugia pahangi was used for each Southern blot. Nucleic acids were transferred to nylon membrane before hybridising with radiolabelled gene-specific probes. The presence of mmc-1 in other filarial nematodes was investigated by genomic Southern blotting or by PCR. Ten micrograms of genomic DNA from B. pahangi, Acanthocheilonema viteae, Dirofilaria immitis, Onchocerca gibsoni, Litomosoides sigmondontis or Loa loa was digested using DdeI, separated on 0.8% agarose gels, hybridised at 508C and washed to low stringency (2 £ SSC, 0.1% SDS). As genomic DNA was not available from W. bancrofti, PCR was carried out on a W. bancrofti microfilarial library (SAW95SjL provided by the Filarial Genome Project Resource Centre, Smith College

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

Northampton, MA, USA) at low stringency (508C annealing temperature) using mmc-1 gene-specific primers. 2.5. Analysis of gene expression by semi-quantitative RTPCR Different life cycle stages of B. pahangi from the mammalian host were isolated from infected jirds on the appropriate days p.i., as described previously (Gomez-Escobar et al., 1998; Hunter et al., 1999). All material was frozen in liquid nitrogen prior to RNA isolation. To extract RNA from parasite stages in the mosquito (L1–infective L3), infected female mosquitoes were selected at the appropriate day post-feed and the thorax dissected. The thoraces were homogenised at 688C for 10 min in 250 ml lysis buffer (0.1 M Tris–HCl, 0.2 M NaCl, 2% SDS, 0.2 M EDTA) containing proteinase K (500 mg ml 21 final concentration) and 25 ml b-mercaptoethanol, prior to RNA extraction with TRIzol reagent (Gibco-BRL) at 688C. Semi-quantitative RT-PCR (Kawasaki and Wang, 1989) was used to determine the relative abundance of mmc-1 compared with the constitutively expressed control gene, b-tubulin (GenBank accession M36380, Guenette et al., 1991). Primers were designed to span an intron to allow cDNA to be distinguished from contaminating genomic DNA (b -tubF AATATGTGCCACGAGCAGTC, b -tubR CGGATACTCCTCACGAATTT, mmc-1F1 GCATTTAGTGCAACCATCGCTGATG, mmc-1R1 ACGTCGAAAGAGTAAACCAGCATCG). Preliminary experiments demonstrated that at 23 cycles of PCR, the reactions were in the exponential phase of amplification. Amplicons were separated on 2% agarose gels and transferred to nylon membranes, which were probed at high stringency with the corresponding gene-specific radiolabelled cDNA, mmc-1F1/mmc-1R1 (nucleotides 66–173). Blots were quantified by overlaying the developed autoradiograph with the Southern blot, excising a 0.5-cm square of the filter corresponding to the specific band and recording the b-emissions by scintillation counting. Relative expression at each stage was determined by calculating the ratio of mmc-1 (minus background counts) compared with the constitutively expressed b-tubulin gene (minus background counts). A similar method was used to examine mmc-1 expression in developing microfilariae in the adult female worm. Ten gravid females were cut into four approximately equal portions; head, mid I, mid II and tail. RNA was extracted from the individual portions and assayed for mmc-1 expression by RT-PCR. 2.6. Expression of Bp-mmc-1 in vitro Approximately 50 mixed sex adult parasites were isolated from an infected jird and incubated in 20 ml RPMI medium (Gibco-BRL) plus supplements (10% FCS, 1% glucose, 2 mM l-glutamine, 2.5 mM HEPES, 100 U/ml penicillin and 100 mg/ml streptomycin, all Gibco-BRL) (Devaney et al., 1992). At set time points, the microfilariae were

417

collected and the expression of mmc-1 tested by RT-PCR. Due to the limiting amounts of material available, the number of PCR cycles was increased to 28 cycles, which was still in the linear phase of amplification. 2.7. Expression of recombinant Bp-MMC-1 and raising of antisera The pMal protein fusion and purification system (New England Biolabs) was used to produce a fusion protein as described in the manufacturer’s protocol. Two PCR primers were designed to amplify the mmc-1 ORF, (MMC-1ExF1, GCCGGGATCCATGAAATATT and MMC-1ExR1, GCCGCTGCAGTCAACAACAG). The fusion protein was purified by affinity chromatography and the MMC-1 moiety was released by digestion with Factor Xa (New England Biolabs). Rabbits were immunised with MMC-1 recombinant protein purified from SDS polyacrylamide gels. In brief, cut recombinant MMC-1 was separated from Maltose Binding Protein by electrophoresis on 15% gels. The gels were lightly stained with Coomassie Blue, then destained and the bands corresponding to MMC-1 excised, rinsed extensively in ddH2O and frozen in liquid nitrogen. The frozen gel was pulverised in a pestle and mortar and used to immunise rabbits following standard procedures. 2.8. Western blotting of microfilariae ES products Microfilariae were cultured at a concentration of ,5 £ 10 5 per ml in RPMI (as described for adult worm culture), except without serum at 378C. To harvest the ES, microfilariae were pelleted by centrifugation and the spent medium spun through a 0.22 mm filter to remove any remaining worms. The ES products were analysed ‘neat’ or were concentrated 10-fold using a 3 kDa filter (Micron, YM3, Millepore) and run on a 15% SDS polyacrylamide gel. Gels were blotted following standard procedures and the blot probed with anti-MMC-1 serum at 1:1000, followed by peroxidase-labelled anti-rabbit IgG at 1:20,000. Bound antibody was detected using the Super Signal West Pico Chemiluminescent Substrate (Pierce). 2.9. Immunofluorescent localisation of MMC-1 in the microfilariae Microfilariae were fixed in 4% paraformaldehyde, washed and permeablised using a protocol designed for Caenorhabditis elegans (Miller and Shakes, 1995). Parasites were incubated overnight in permeabilisation buffer (5% b-mercaptoethanol, 1% Triton X-100 in 125 mM Tris–HCl, pH 6.9), washed three times in PBS and incubated for 4 h at 378C in a collagenase solution (115 digestion U/ml collagenase in 100 mM Tris–HCl, pH 7.5 containing 1 mM CaCl2) and then washed. Anti-MMC-1 antiserum or the pre-bleed at 1:100 dilution was added overnight at 48C, then the microfilariae were washed and incu-

418

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

bated in a 1:200 dilution of FITC-labelled goat anti-rabbit IgG. Labelled parasites were viewed with an Olympus BX60 UV microscope. 2.10. Recognition of Bp-MMC-1 by human infection serum The serum samples were obtained from the Renegat district of Sumatra, Indonesia, an area endemic for B. malayi. Samples were classed as either microfilariae positive, microfilariae negative (determined by the lack of circulating microfilariae by Nucleopore filtration of 1.0 ml of venous blood) and European normals. The same samples have been used in previous studies (Kurniawan et al., 1993; Yazdanbakhsh et al., 1993, Zang et al., 2000). Either the MMC-1 fusion protein or maltose binding protein alone was used to coat ELISA plates (200 ng/well diluted in 0.06 M carbonate buffer) and reacted against each serum in duplicate (1/100 dilution in PBS/0.05% Tween 20). Bound antibody was detected using subclass-specific mouse mAb followed by peroxidase-conjugated rabbit anti-mouse Ig. Reactions were developed using ABTS substrate (KPL Biotechnology) and the OD 405 nm read after 2 min. 3. Results 3.1. cDNAs isolated by differential screen From the initial screen of 2 £ 10 4 pfu of the primary library, 81 plaques which hybridised differentially to either probe were selected. Following the tertiary screen, 21 clones were picked, of which 17 hybridised more strongly to the mammalian microfilariae probe and four to the vector-derived microfilariae probe, corresponding to ,1 in 1000 differentially expressed cDNAs. Confirmation of the pattern of expression was obtained by reverse northern analysis (data not shown). Sequence analysis revealed that the 21 different clones represented nine separate cDNAs. These were named, in accordance with the suggested nomenclature for Brugia genes (Blaxter et al., 1997), and recorded in the GenBank public databases. Table 1 shows the results of the library screen and the cluster analysis of the homologous B. malayi ESTs. Bp-mmc-1 was the most abundant differentially expressed cDNA (isolated nine times out of a total of 2 £ 10 4 clones screened) and on this basis was selected for further study. Of the other clones picked, four were ribosomal protein genes, one was hsp90, one showed homology to an EST from the B. malayi data base, while the final two were novel with no similarity to any sequences in the data bases (summarised in Table 1). 3.2. Nucleotide and primary protein analysis of Bp-mmc-1 The original Bp-mmc-1 clone isolated was 297 bp in length and contained the nematode SL-1 sequence at the

5 0 end. Sequence analysis revealed that the 3 0 end was missing and this was subsequently obtained by 3 0 RACE, as described in Section 2. The final clone was 434 bp long, consistent with the predicted size by Northern blot (see Fig. 1). The predicted ORF is 81 amino acids long encoding a peptide of 9345 Da with a theoretical isoelectric point (pI) of 4.46. Attempts to identify homologues of Bp-mmc-1 using either the nucleotide or translated peptide sequences produced no significant similarity other than to B. malayi ESTs (accession numbers AA228202, AA280479 and N41076). Comparison of mmc-1 with the longest length EST (AA228202) showed 97.1% identity at the nucleotide level and 95.1% identity at the amino acid level. 3.3. Northern and Southern blotting A single transcript of ,400 bp was detected in microfilariae by Northern blotting. Comparison of mammalianderived and vector-derived microfilariae showed a stronger signal from the mammalian-derived sample, consistent with the results of the differential screen. No signal was obtained from adult worm RNA, despite the fact that a significant percentage of adult female transcripts derive from microfilariae. For the Southern blot analysis, B. pahangi genomic DNA was digested with HindIII, EcoRI or DdeI, blotted and hybridised with a radiolabelled mmc-1 probe that contained a DdeI site (Fig. 2). This probe hybridised to a single band in genomic DNA digested with HindIII or EcoRI and to two bands of approximately 1 and 4 kb in the DdeI digest, suggesting that mmc-1 may be a single copy gene. A ‘Zooblot’ was carried out using DNA isolated from other filarial nematodes in order to determine whether related genes were present in other species of filariae. No hybridisation was observed to the DNA of D. immitis, O. gibsoni or A. viteae (data not shown). At low stringency, the probe hybridised to multiple bands in L. sigmondontis DNA and L. loa DNA, but when the blots were washed to higher stringency (508C, 2 £ 10 min, 1 £ SSC, 0.1% SDS), the hybridising bands were no longer visible. Finally, PCR was carried out on an aliquot of a W. bancrofti microfilariae library at low stringency (508C annealing temperature) using mmc-1 genespecific primers. No PCR products could be visualised by ethidium bromide staining or when the gel was blotted and hybridised with the Bp-mmc-1 cDNA probe (data not shown). These results suggest that mmc-1 is likely to be a Brugia-specific cDNA, but further analysis would be required to determine whether a distantly related gene is present in other species of filariae. 3.4. RT-PCR analysis of Bp-mmc-1 expression in vivo The relative abundance of mmc-1 was investigated at various time points in the Brugia life cycle by semi-quantitative RT-PCR. RNA was isolated from infected mosquitoes at 24 h, 3 days, 5 days and 8 days p.i., vector-derived L3, 24 h p.i. L3, 5 day p.i. L3, 10 day p.i. L4, adult worms and

Clone

Accession number

Homology

Expression pattern

No. of times isolated

Size (bp)

Bm cluster BMC

All ESTs

Mf

L2

L3

L4

Adult male

Adult female

recDNA35 recDNA20 recDNA57 Bp-hsp90 recDNA1 Bp-EE4 recDNA53 recDNA13 recDNA76

AJ277715 AJ277714 AJ277716 AJ005784 X95664 X91066 AJ277717 AJ277713 AJ277712

A1893523 Bm-rpl-15 Bm-rpl-36 Bp-hsp90 Bp-mmc-1 Bm-rpp-1 Bm-rpl-38 Novel Novel

M. mf M. mf M. mf M. mf M. mf V. mf V. mf V. mf V. mf

4 1 2 1 9 1 1 1 1

464 356 424 N/A 297 549 362 147 299

00124 00151 00060 05057 00480 00166 00157 – –

17 37 47 8 3 70 28

0 9 3 0 3 5 0

1 9 11 0 0 6 4

4 3 5 4 0 14 5

4 4 21 0 0 24 15

2 6 5 1 0 12 1

6 6 2 1 0 9 3

a

The left-hand-portion of the table shows the cDNAs isolated from the Brugia pahangi library in the differential screen. Clone name, accession number, homology, numbers of times isolated and size of the clone are shown. The expression pattern refers to the results of the differential screen – M.mf, up-regulated in mammalian-derived microfilariae; V.mf, up-regulated in vector-derived microfilariae; Rpl, large subunit ribosomal protein. The right-hand-portion of the table shows the abundance of corresponding ESTs from the Brugia malayi cluster database. Bm, Brugia malayi; –, no ESTs in theBrugia malayi data base.

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

Table 1 Library screen and the cluster analysis of the homologous B. malayi ESTs a

419

420

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

Fig. 3. mmc-1 life cycle panel semi-quantitative RT-PCR. First strand cDNA was amplified using either mmc-1F1 and mmc-1R1 primers (panel I) or b-tubF and b-tubR primers (panel II) under the following conditions: 23 cycles of 948C, 1 min; 628C, 1 min; 728C, 1 min. Amplified products were size separated on a 2% agarose gel and transferred to a nylon membrane. The resulting blots were probed with the corresponding genespecific probe under high stringency (658C, washed to 0.1 £ SSC 0.1% SDS) and exposed to autoradiographic film. Panel I: mmc-1 RT-PCR. Panel II: b-tubulin RT-PCR. A, mature microfilariae. B, uninfected mosquito thorax. C, mosquito thorax 24 h p.i. (microfilariae). D, mosquito thorax 3 days p.i. (sausage stage larvae, L1). E, mosquito thorax 5 days p.i. (L2). F, mosquito thorax 8 days p.i. (L3). G, pre-infective L3 isolated from mosquito into Grace’s medium. H, 24 h p.i., mammal (L3). I, 5 day p.i., mammal (L3). J, 10 day p.i., mammal (L4). K, adults worms. Fig. 1. Northern blot analysis of mmc-1. Two micrograms of each RNA was separated on a 1.5% agarose gel containing formamide and transferred to nylon membrane for hybridisation with a mmc-1 gene-specific probe. The blot was washed to high stringency at 658C down to 0.1 £ SSC, 0.1% SDS. The blot was then exposed to autoradiographic film for 24 h at 2708C. The approximate size of the mmc-1 transcript is 400 bp (marked I). A, in vitro cultured vector-derived microfilariae RNA. B, in vitro cultured mammalian-derived microfilariae RNA. C, mixed sex adult RNA.

microfilariae. Fig. 3 shows a representative Southern blot of PCR products which clearly shows that Bp-mmc-1 is a gene that is essentially expressed only in the microfilariae stage of the life cycle. This experiment was repeated three times with identical results. As adult female worms contain microfilariae at all stages

Fig. 2. Southern blot analysis of mmc-1. Twenty micrograms of high molecular weight DNA was isolated from mixed sex adult B. pahangi and digested with HindIII (lane A), DdeI (lane B) and EcoRI (lane C). l HindIII markers and l PstI markers were run on the gel. The gel was blotted and the blot probed with an a- 32P-labelled mmc-1 fragment and washed at 508C as follows: 3 £ 10 min, 1 £ SSC, 0.1% SDS. The resulting autoradiograph was exposed for 72 h.

of development, attempts were made to detect low-level mmc-1 expression in developing microfilariae. RNA was extracted from the head, mid I, mid II and tail sections of gravid female B. pahangi and assayed for mmc-1 expression by RT-PCR. As intrauterine development is relatively synchronous, the head section contained the most mature microfilariae prior to release, which were elongate and free swimming, sections mid I and mid II contained progressively less mature microfilariae (coiled microfilariae and pretzel stages) and the tail section contained fertilised oocytes and oogonia (Rogers et al., 1976; Delves et al., 1989). The Southern blot (from one of two representative experiments) shown in Fig. 4 demonstrates that mmc-1 could not be detected in the sections of female worm, even in the head section which contains the most mature microfilariae. High levels of expression of mmc-1 are only seen following release of the microfilariae.

Fig. 4. mmc-1 is not expressed in developing microfilariae in utero. Adult female B. pahangi were dissected into four approximately equal sections, head, mid I, mid II and tail. First strand cDNA from each of the sections and from mature microfilariae (.3 months infection of jird) was amplified using mmc-1 and b-tubulin gene-specific primer pairs as follows, 28 cycles of 948C, 1 min; 628C, 1 min; 728C, 1 min. Amplified products were size separated on a 2% agarose gel and transferred to nylon membrane. The resulting blots were probed with the corresponding gene-specific probe under high stringency (658C, washed to 0.1 £ SSC 0.1% SDS) and exposed to autoradiographic film. Panel I: mmc-1 amplified cDNA. Panel II: btubulin amplified cDNA. A, adult female section head. B, adult female section mid I. C, adult female section mid II. D, adult female section tail. E, mature microfilariae. F, adult female. G, adult male.

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

3.5. RT-PCR analysis of Bp-mmc-1 expression in newly released microfilariae The results described previously suggest that mmc-1 is not expressed during microfilariae development, but only upon release from the adult female worm. In order to determine whether this was indeed the case, adult female worms were cultured in vitro, the released microfilariae collected at 6, 18, 24 and 72 h of culture and analysed for mmc-1 expression. These experiments demonstrated that mmc-1 could be detected in microfilariae as early as 6 h post-release (data not shown). It was not possible to examine earlier time points due to the small numbers of microfilariae released. In an attempt to identify possible signals that might trigger expression of mmc-1 upon release of the microfilariae from the adult female worm, additional experiments were carried out in which mmc-1 expression was monitored in microfilariae released from adult females cultured in medium 1/ 2FCS or 1/2glucose. No effect was noted on mmc-1 expression in the released microfilariae, although it was notable that adult female worms cultured in glucose-free medium released many fewer microfilariae than those cultured in medium containing glucose (data not shown). Likewise, culture of microfilariae at various temperatures (28, 37 or 418C) did not effect Bp-mmc-1 expression (data not shown).

421

microfilariae in vitro, ES was collected from cultured microfilariae and analysed by Western blotting. However, no signal was obtained from the microfilariae ES products suggesting that MMC-1 was not secreted by the microfilariae, or if secreted, it is at levels below the detection of the chemiluminescent system used. 3.7. Recognition of Bp-MMC-1 by human infection serum As the results described previously indicated that Bp-mmc1 is a Brugia-specific gene only expressed in the microfilariae stage, it was of interest to determine whether it was differentially recognised by B. malayi infection serum from individuals of different clinical status. For this purpose, MMC-1 was expressed as a fusion protein with maltose binding protein and antibody responses to the fusion protein or to maltose binding protein alone were assessed by ELISA in individuals who were microfilaraemic, amicrofilaraemic or European control subjects. The only antibody subclass to exceed the threshold level (calculated as the mean of European normal control values 1 3 SD, Zang et al., 2000) was IgG3, which was elevated in both groups of exposed individuals, irrespective of the presence of microfilariae (P ¼ 0:01 ANOVA). There was no significant IgG2 or IgG4 response to Bp-MMC-1 in any subject (Fig. 6).

3.6. MMC-1 is an internal antigen

4. Discussion

When intact microfilariae were stained with the antiserum raised to MMC-1 followed by a second FITC-labelled conjugate, no labelling associated with the sheath or the cuticle was observed (Fig. 5A). However, permeabilisation resulted in staining throughout the body of the worm (Fig. 5B). No staining was observed with the pre-bleed. In an attempt to determine whether MMC-1 was released by

The aim of this study was to identify cDNAs which were differentially expressed between the microfilariae in the bloodstream of the mammalian host and the mosquito vector. Because of the difficulties inherent in obtaining sufficient parasite material at early time points following infection of the vector (small size of the microfilariae, intracellular localisation, abundance of mosquito tissue, etc), we used an in

Fig. 5. MMC-1 is an internal antigen. (a) B. pahangi microfilariae were fixed as described in Section 2, but not permeabilised. Microfilariae were labelled with anti-MMC-1 antiserum at 1:100 dilution overnight at 48C, then washed and incubated in a 1:200 dilution of FITC-labelled goat anti-rabbit IgG. Labelled parasites were viewed with an Olympus BX60 UV microscope. (b) Prior to immunostaining, microfilariae were incubated overnight in permeabilisation buffer (5% b-mercaptoethanol, 1% Triton X-100 in 125 mM Tris–HCl, pH 6.9), washed three times in PBS and incubated for 4 h at 378C in a collagenase solution (115 digestion U/ml collagenase in 100 mM Tris–HCl; pH 7.5 containing 1 mM CaCl2) and then washed. Anti-MMC-1 antiserum at 1:100 dilution was added overnight at 48C, then the microfilariae were washed and incubated in a 1:200 dilution of FITC-labelled goat anti-rabbit IgG.

422

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

Fig. 6. MMC-1 is preferentially recognised by IgG3 antibodies in human Brugia malayi infection. The levels of IgG1, IgG2, IgG3 and IgG4 to the MMC-1 fusion protein or to maltose binding protein alone were assessed by ELISA. Serum was analysed from 13 microfilariae1ve or 15 microfilariae2ve subjects or six European control subjects. The results are expressed as mean values ^SD of net OD readings for each group (MMC-1 fusion protein minus MBP alone). Horizontal bars show the threshold level for each subclass defined as the mean of European controls plus three times the SD of the mean.

vitro culture system to produce a population of ‘vectorderived’ microfilariae. This system attempted to mimic some of the conditions to which microfilariae are exposed during the process of infection of the mosquito vector (exsheathment, migration, lowered temperature). Nine independent cDNAs were isolated in the differential screen, of which five were preferentially recognised by the mammalian microfilariae probe and four by the vector-derived microfilariae probe. Analysis of the B. malayi EST dataset demonstrated that most of the cDNAs cloned in the differential screen were expressed in life cycle stages other than the microfilariae. However, the screening protocol used in our study was not aimed at detecting microfilarial-specific genes, rather cDNAs that were differentially expressed between the microfilariae in its two different hosts. Of the genes cloned, mmc-1 was the most abundant and was selected for further study. Subsequent analysis demonstrated that mmc-1 was likely to be a single copy gene that may be specific to the genus Brugia. Consequently, it was not possible to correlate the presence of mmc-1 to specific features of the filarial life cycle such as blood or skin-dwelling microfilariae or the presence or absence of a sheath. One of the most interesting features of mmc-1 was its restriction to the microfilariae stage of the life. Repeated RT-PCR experiments failed to detect any transcripts in other life cycle stages or even in the adult female which contains microfilariae at all stages of development. The RT-PCR analysis of the sectioned adult females showed that mmc-1 expression either follows or is concomitant with the release of the microfilariae from the uterus, as it is not present at significant levels in developing microfilariae (Fig. 4), but is detectable in microfilariae within 6 h of release. Varying the incubation temperature or components

of the culture media did not affect the expression of mmc-1 in microfilariae. Therefore, some factor other than temperature, serum or glucose to which the microfilariae are exposed in the bloodstream may be responsible for triggering expression. Alternatively, the release of microfilariae from the vulva may provide mechanical stimulation for initiation of mmc-1 expression or the adult female worm may actively suppress mmc-1 expression in microfilariae in utero. Analysis of the promoter region of mmc-1 may identify specific elements that control its expression pattern. The mmc-1 cDNA encodes a small peptide consisting of 81 amino acids that has a predicted cleavable signal sequence at the 5 0 end (amino acids 1–17). MMC-1 is therefore potentially a secreted protein, and as such may interact with the host environment. However, no evidence was obtained that MMC-1 is secreted by microfilariae cultured in vitro by immunoblot of ES products. Immunofluoresence analysis demonstrated that MMC-1 was an internal protein distributed throughout the body of the worm. At this level of analysis it was not possible to identify specific tissues/cells which expressed MMC-1. Staining was not, however, observed on the microfilariae sheath or the cuticle and was only seen in permeablised worms. Because mmc-1 was specific to the microfilariae and this life cycle stage is associated with an extraordinary bias in IgG subclass responses in infected humans, we tested whether MMC-1 was specifically recognised by human serum from an endemic area. This analysis demonstrated that MMC-1 was preferentially recognised by antibodies of the IgG3 subclass in all endemic individuals, whether or not they were microfilaraemic. It is not immediately apparent why amicrofilaraemic individuals should have antibodies to MMC-1, a microfilarial-specific protein. However, it is noteworthy that the same amicrofilaraemic individuals have elevated levels of antibodies to crude extracts of B. malayi adult worms and microfilariae (Zang et al., 2000). These individuals may previously have been microfilariae positive and have residual antibodies to MMC-1. Alternatively, MMC-1 may be recognised by the immune system only following the clearance of microfilariae, when internal antigens not usually exposed to the immune system may be released. It is interesting to note that elevated levels of IgG3 antibodies to whole worm antigen are often associated with pathology in lymphatic filariasis (Maizels et al., 1995). Further studies will be required using serum from patients with a range of clinical manifestations before any association between recognition of MMC-1 and clinical status can be substantiated. Sequence analysis of mmc-1 revealed no homologues of novel or predicted function, and so the predicted amino acid sequence was analysed using tools available to identify domain or motif signatures (SMART http://smart.emblheidelberg.de/, Pfam http://www.sanger.ac.uk/Software/ Pfam/index.shtml and InterPro http://www.ebi.ac.uk/interpro/). This analysis also confirmed mmc-1 as a novel gene without predicted function. Despite its internal localisation

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

throughout the worm, mmc-1 seems unlikely to encode a structural or house-keeping protein, which would be expected to be conserved. The pattern of expression of mmc-1 is consistent with a role in the mammalian host rather than in the mosquito vector. It is known that microfilariae require a period of approximately 3 days to acquire mosquito infectivity (Fuhrman et al., 1987) but the timing of expression of mmc-1 (6 h post-release) is not consistent with a role in infection of the vector. The present restriction of mmc-1 to the genus Brugia suggests a specific function but further studies will be required to rule out the possibility that mmc1 has no homologue in the closely related genus Wuchereria. Assigning potential functions to parasite-specific genes that have no identified homologues is an increasing problem; for example 38% of B. malayi ESTs are unique to Brugia (Burglin et al., 1998; Williams and Johnston, 1999; Williams et al., 2000). mmc-1 adds to a growing list of genes that are specific to the microfilariae stage (see http://nema.cap.ed. ac.uk/nematodeESTs/ Brugia/brugia.php for cluster analysis). The absence of homologous genes, even within the completed C. elegans genome suggests either that the parasite-specific genes have arisen de novo following the diversification of the class Chromadorea, or have rapidly diverged from a common ancestral form, rendering homologues undetectable using the current data. These will be questions to address as more EST data become available from Brugia. It is possible that the evolutionary pressures of the parasitic niche promotes rapid evolution of genes such as mmc-1, making the detection of homologues within non-parasitic species problematic. To identify the role of such transcripts in parasitic organisms various functional genomics techniques (two hybrid analysis, RNA interference) or in silico methods, such as cluster analysis of coexpressed genes, will be required (Lawson, 1999; Bhattacharya et al., 2000). In addition, comparative analysis of the 5 0 upstream regions of microfilariae-specific genes may identify recognisable motifs that control their stage-specific expression.

Acknowledgements This study was funded by grants from the Wellcome Trust and the MRC. R.E. was supported by a PhD studentship from the MRC. We would like to acknowledge the technical support of Isla Wheatley and we thank Mark Blaxter and David Guiliano (University of Edinburgh) for the EST cluster analysis and Steven Williams (Smith College) for provision of the W. bancrofti microfilariae cDNA library. Thanks also to the following who contributed genomic DNA from other filarial parasites: Claude Maina (NEB), Jan Bradley (University of Nottingham), William Harnett (Strathclyde University), Judith Allen and Laetitia LeGoff (University of Edinburgh) and Jean-Paul Akue (CIRMF, Gabon) and to Maria Yazdanbakhsh (University of Leiden) for provision of the serum samples.

423

References Bhattacharya, A., Bhattacharya, S., Joshi, A., Ramachandran, S., Ramaswamy, R., 2000. Identification of parasitic genes by computational methods. Parasitol. Today 16, 127–31. Blaxter, M.L., Guiliano, D.B., Scott, A.L., Williams, S.A., 1997. A unified nomenclature for filarial genes. Parasitol. Today 13, 416–7. Burglin, T.R., Lobos, E., Blaxter, M.L., 1998. Caenorhabditis elegans as a model for parasitic nematodes. Int. J. Parasitol. 28, 395–411. Delves, C.J., Rees, H.H., Howells, R.E., 1989. Egg production in Brugia pahangi (Nematoda: Filarioidea). Parasitology 98, 105–13. Devaney, E., Egan, A., Lewis, E., Warbrick, E.V., Jecock, R.M., 1992. The expression of small heat shock proteins in the microfilaria of Brugia pahangi and their possible role in development. Mol. Biochem. Parasitol. 56, 209–18. Fryxell, K.J., Meyerowitz, E.M., 1987. An opsin gene that is expressed only in the R7 photoreceptor cell of Drosophila. EMBO J. 6, 443–51. Fuhrman, J.A., Urioste, S.S., Hamill, B., Spielman, A., Piessens, W.F., 1987. Functional and antigenic maturation of Brugia malayi microfilariae. Am. J. Trop. Med. Hyg. 36, 70–74. Gomez-Escobar, N., Lewis, E., Maizels, R.M., 1998. A novel member of the transforming growth factor-beta (TGF-beta) superfamily from the filarial nematodes Brugia malayi and B. pahangi. Exp. Parasitol. 88, 200–9. Greene, B.M., Schiller, E.L., 1979. A technique for purification of microfilariae of O. volvulus. J. Parasitol. 65, 861–4. Guenette, S., Pritchard, R.K., Klein, R.D., Matlashewski, G., 1991. Characterisation of a B-tubulin gene and B-tubulin gene products of Brugia pahangi. Mol. Biochem. Parasitol. 44, 153–64. Hawking, F., Adams, W.E., Worms, M.J., 1964. The periodicity of microfilariae. VII. The effect of parasympathetic stimulants upon the distribution of microfilariae. Trans. R. Soc. Trop. Med. Hyg. 57, 178–94. Hawking, F., Pattanayak, S., Sharma, H.L., 1966. The periodicity of microfilariae. XI. The effect of body temperature and other stimuli upon the cycles of Wuchereria bancrofti, Brugia malayi, B. ceylonensis and Dirofilaria repens. Trans. R. Soc. Trop. Med. Hyg. 60, 497–513. Hawking, F., Jennings, T., Louis, F.J., Tuira, E., 1981. The mechanisms which effect the periodic cycle of Pacific Wuchereria bancrofti microfilariae. J. Helminthol. 55, 95–100. Hunter, S.J., Martin, S.A.M., Thompson, F.J., Tetley, L., Devaney, E., 1999. The isolation of differentially expressed cDNA clones from the filarial nematode Brugia pahangi. Parasitology 119, 189–98. Hussain, R., Groel, M., Ottessen, E.A., 1987. IgG antibody subclasses in human filariasis: differential subclass recognition of parasite antigens correlates with different clinical manifestations of infection. J. Immunol. 139, 2794–8. Kawasaki, E.S., Wang, A.M., 1989. Detection of gene expression. In: Erlich, H.A. (Ed.). PCR Technology: Principles and Applications for DNA Amplification, Stockton Press, New York, NY, pp. 89–97. King, C.L., Nutman, T.B., 1991. Regulation of the immune response in lymphatic filariasis and onchocerciasis. Immunol. Today 12, A54–8. Kurniawan, A., Yazdanbakhsh, M., Ree, R.V., Aalberse, R., Selkirk, M.E., Partono, F., Maizels, R.M., 1993. Differential expression of IgE and IgG4 specific antibody responses in asymptomatic and chronic human filariasis. J. Immunol. 150, 3941–50. Kurniawan-Atmadja, A., Atkinson, R., Sartono, E., Partono, F., Yazdanbakhsh, M., Maizels, R., 1995. Differential decline in filarial-specific IgG1, IgG4 and IgE antibodies in Brugia malayi-infected patients after diethylcarbamazine chemotherapy. J. Infect. Dis. 172, 1567–72. Laurence, B.R., Simpson, M.G., 1974. The ultrastructure of the microfilaria of Brugia nematoda: Filarioidea. Int. J. Parasitol. 4, 523–36. Lawson, D., 1999. Data mining parasite genomes: haystack searching with a computer. Parasitology 118, S15–8. Liu, L.X., Yu, H., Weller, P.F., Shi, A., Debnath, I., 1997. Structure and expression of a novel filarial gene for glia maturation factor. Gene 186, 1–5.

424

R. Emes et al. / International Journal for Parasitology 32 (2002) 415–424

Maizels, R.M., Sartono, E., Kurniawan, A., Partrono, F., Selkirk, M.E., Yazdanbakhsh, M., 1995. T-cell activation and the balance of antibody isotypes in human lymphatic filariasis. Parasitol. Today 11, 50–56. Martin, S.A.M., Thompson, F.J., Devaney, E., 1995. The construction of spliced leader cDNA libraries from the filarial nematode Brugia pahangi. Mol. Biochem. Parasitol. 70, 241–5. Michael, E., Bundy, D.A.P., 1997. Global mapping of lymphatic filariasis. Parasitol. Today 13, 472–6. Miller, D.M., Shakes, D.C., 1995. Immunofluorescence microscopy. In: Epstein, H.F., Shakes, D.C. (Eds.). Methods in Cell Biology Caenorhabditis elegans: Modern Biological Analysis of an Organism, Academic Press, London, pp. 365–90. Rogers, R., Ellis, D.S., Denham, D.A., 1976. Studies with Brugia pahangi 14. Intrauterine development of the microfilaria and a comparison with other species. J. Helminthol. 50, 251–7. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, Cold Spring Harbor Press, Cold Spring Harbor NY, USA. Sartono, E., Lopriore, C., Kruize, Y.C.M., Kurniawan-Atmadja, A., Maizels, R.M., Yazdanbakhsh, M., 1999. Reversal in microfilarial density and T cell responses in human lymphatic filariasis. Parasite Immunol. 21, 565–71. Trenholme, K.R., Tree, T.I.M., Gillespie, A.J., Guderian, R., Maizels, R.M., Bradley, J.E., 1994. Heterogeneity of IgG responses to cloned

Onchocerca volvulus antigens in microfiladermia positive individuals from Esmeraldas Province. Ecuador Parasite Immunol. 16, 201–9. Williams, S.A., Johnston, D.A., 1999. Helminth genome analysis: the current status of the filarial and schistosome genome projects. Parasitology 118, S19–38. Williams, S.A., Lizotte-Waniewski, M.R., Foster, J., Guiliano, D., Daub, J., Scott, A.L., Slatko, B., Blaxter, M.L., 2000. The filarial genome project: analysis of the nuclear, mitochondrial and endosymbiont genomes of Brugia malayi. Int. J. Parasitol. 30, 411–9. Yazdanbakhsh, M., Paxton, W.A., Kruize, Y.C., Sartono, E., Kurniawan, A., Wout, A.v.h., Selkirk, M.E., Partono, F., Maizels, R.M., 1993. T cell responsiveness correlates differentially with antibody isotype levels in clinical and asymtomatic filariasis. J. Infect. Dis. 167, 925–31. Yazdanbakhsh, M., Paxton, W.A., Brandenburg, A., Ree, R.V., Lens, M., Partono, F., Maizels, R.M., Selkirk, M.E., 1995. Differential antibody isotype reactivity to specific antigens in lymphatic filariasis: gp15/400 preferentially induced immunoglobulin E (IgE), IgG4 and IgG2. Infect. Immunol. 63, 3772–9. Zang, X., Atmadja, A.K., Gray, P., Allen, J.E., Gray, C.A., Lawrence, R.A., Yazdanbakhsh, M., Maizels, R.M., 2000. The serpin secreted by Brugia malayi microfilariae, Bm-SPN-2, elicits strong, but short-lived, immune responses in mice and humans. J. Immunol. 165, 5161–9.