- Email: [email protected]
Cloning and characterization of a cDNA encoding Xenopus laevis αo1 isoform of the Go protein
Gene 188 (1997) 137–141
Cloning and characterization of a cDNA encoding Xenopus laevis ao1 isoform of the Go protein Laurent Paquereau, Eric Devic, Yves Audigier * UMR 9925, Universite´ Toulouse-III, Baˆt, 4R3, 118 route de Narbonne, 31062-Toulouse, Cedex, France Received 29 August 1996; revised 23 October 1996; accepted 28 October 1996; Received by A. Bernardi
Abstract The mammalian gene encoding the a subunit of the Go protein generates by alternative splicing two isoforms, ao1 and ao2, which differ in their carboxy-terminal region. We report here the cloning of a Xenopus cDNA (XGao1) which encodes a protein corresponding to the mammalian ao1 isoform. In its 3∞ untranslated region, the transcript contains a repetitive motif made up of dinucleotide AT repeats. By RT-PCR amplification, we showed that XGao1 transcripts are both maternal and zygotic. As ao2 transcripts have been shown to be maternal and devoid of AT repeats, the repetitive motif could play a role in the differential expression of each isoform. Keywords: Recombinant DNA; Alternative splicing; Heterotrimeric GTP-binding proteins; Early embryogenesis
1. Introduction Heterotrimeric GTP-binding proteins belong to the GTPase superfamily, whose members use the property to bind and hydrolyze GTP for their diverse intracellular functions (Gilman, 1987; Neer, 1995). These proteins are made up of three distinct polypeptide chains called a, b and c (Gilman, 1987; Neer, 1995) and they couple a membrane receptor, which decodes an extracellular signal, to an intracellular effector, which generates a diffusible second messenger (Gilman, 1987; Neer, 1995). Since their early characterization, the techniques of molecular biology have revealed the large diversity of these subunits (Simon et al., 1991). At the present time, up to 20 a subunits have been identified (Simon et al., 1991), five different genes coding for a b subunit have been characterized ( Watson et al., 1994) and more than six c subunits have been cloned (Gautam et al., 1990; Cali et al., 1992). * Corresponding author. Tel. +33 61 558285; Fax +33 61 556507; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA; DEPC, diethyl pyrocarbonate; DTT, dithiothreitol; GTP, guanosine 5∞-triphosphate; kb, kilobase(s) or 1000 bp; ORF, open reading frame; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RT, reverse transcription; UV, ultraviolet.
This structural diversity is directly linked to the major role of these proteins, which is the specific coupling of a given receptor to a particular type of effector. All subunits contribute to the coupling specificity at the receptor/GTP-binding protein interface, whereas the a subunit is thought to play a larger role at the GTPbinding protein/effector interface (Gilman, 1987; Neer, 1995). Although the selective association with a bc complex can participate in the specificity of receptor coupling, the carboxy-terminal region of the a subunit could be directly involved in the interaction with the receptor (Sullivan et al., 1987; Conklin et al., 1993). Indeed, the structure of the Goa gene illustrates this relationship between the carboxy-terminal domain and the receptor coupling specificity: it produces, via the alternative splicing of the exon coding for the carboxyterminal domain, two protein isoforms named ao1 and ao2 (Hsu et al., 1990; Strathmann et al., 1990) which couple distinct receptors to the same effector ( Kleuss et al., 1991). In Xenopus, only the isoform corresponding to the ao2 subtype has been cloned from an oocyte library (Olate et al., 1989). We decided therefore to investigate whether an ao1 isoform was expressed during early embryogenesis.
0378-1119/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved PII S 03 7 8 -1 1 1 9 ( 9 6 ) 0 0 7 99 - 8
138
L. Paquereau et al. / Gene 188 (1997) 137–141
2. Experimental and discussion 2.1. Cloning and sequencing of the amphibian XGao1 cDNA Four positive bacteriophage plaques were identified from a Xenopus laevis cDNA library made at developmental stage 11 in lgt 10 ( Krieg and Melton, 1985) by screening with a Xenopus ao2 cDNA corresponding to the entire coding region, kindly provided by Drs. Pituello and Krieg. Sequencing of the inserts revealed that they corresponded to truncated cDNAs lacking the aminoterminal coding region. The 5∞ region was isolated by a PCR-based strategy using the 5∞ RACE method. Amplification of the 5∞ coding region was performed using standard procedures of 5∞ RACE-amplifinder kit (Clontech): RNA from stage 11 embryos was reversetranscribed with a specific P1 primer corresponding to nucleotides 892–919. The PCR amplification was then carried out with a primer containing the ATG codon and a specific P2 primer corresponding to nucleotides 819–852. An amplified 852 bp fragment was identified and found to overlap the nucleotide sequence of the inserts. The sequence given in Fig. 1 is the cumulative full-length cDNA resulting from the assembly of the overlapping regions obtained from the 5∞ RACE-amplified fragment and the largest insert which includes most of the coding sequence (72–1062) and the 3∞ untranslated region. 2.2. 3∞ untranslated region of the ao1 transcript As underlined in Fig. 1, the 3∞ untranslated region of the ao1 cDNA contains a particular motif, a long stretch composed of AT repeats, between positions 1147 and 1234. Interestingly, the two Drosophila spliced variants contain similar, albeit smaller, stretches of AT repeats between positions 1784 and 1848 ( Yoon et al., 1989; de Sousa et al., 1989). Previously cloned ao1 cDNAs from mammals (Hsu et al., 1990; Strathmann et al., 1990) do not exhibit a repetitive AT motif. However, in the hamster, a third splice variant encoding the ao1 isoform with a different 3∞ untranslated region also displays a repetitive motif, made up of another dinucleotide, AC instead of AT, between positions 1128 and 1163 (Bertrand et al., 1990). The presence of a repetitive motif in all these species suggests that it exerted an ancestral function. As the ao1 transcript contains a repetitive AT motif in its 3∞ untranslated region which is not found in the ao2 transcript, it is tempting to speculate that this particular sequence could play a role in the regulation of the expression of isoform transcripts. 2.3. Deduced protein sequence of the ao1 isoform Translation from the first ATG yields a putative protein 354 aa long. The deduced aa sequence contains
the five structural motifs common to the a subunits of heterotrimeric GTP-binding proteins (Bourne et al., 1991). Furthermore, alignment of the aa sequence with that of various a subunits revealed that it is most similar to the primary sequence of ao subunits. In the two amino-terminal thirds of the protein, it shares strong identity with the ao-like protein cloned by Olate et al. (1989), whereas it diverges from this protein in the carboxy-terminal third. Alignment of this aa sequence with that of ao1 isoforms from different species clearly reveals a strong conservation. It shares a high degree of identity, 96% with the hamster (Hsu et al., 1990) and 95% with the mouse sequence (Strathmann et al., 1990), but is more divergent (87% identity) from Drosophila isoforms ( Yoon et al., 1989; de Sousa et al., 1989). The newly cloned cDNA (XGao1) therefore codes for an ao-like protein which is the Xenopus homolog of the mammalian ao1 isoform. Sequence alignment with the ao-like protein cloned from oocytes (Olate et al., 1989) revealed their divergence in the carboxy-terminal region, suggesting that the Xenopus ao gene, like its mammalian counterpart (Hsu et al., 1990; Strathmann et al., 1990), generates by alternative splicing two carboxy-terminally divergent isoforms. 2.4. Expression of the ao1 transcript In order to evaluate the size of the ao1 transcript, we performed a Northern blot analysis with total RNAs isolated from staged embryos. In view of the lack of detectable signal, the size of XGao1 mRNA was determined in adult brain, known for its high content of ao transcripts (Strathmann et al., 1990), and estimated to be 3.8 kb ( Fig. 2). The low abundance levels of ao1 transcripts led us to use a RT-PCR assay for studying the temporal expression of XGao1 mRNA during early embryogenesis. As shown in Fig. 3, an amplified fragment of the expected size (335 bp) was present at all stages of early development. However, the amount of amplified fragments varied and significantly increased after stage 14 to reach high values at the late stages of larval development (stage 45). The ao1 transcripts are thus present before and after the midblastula transition. This pattern of expression is different from that of ao2 transcripts, which are present in oocyte stage VI and diminish gradually during early embryogenesis, reaching a very low level at the gastrula stage (On˜ate et al., 1992). It is noteworthy that the regulation of isoform transcripts has evolved from a transcriptional level of regulation in Drosophila via the use of alternative promoters ( Yoon et al., 1989; de Sousa et al., 1989) to a posttranscriptional level in vertebrates via the 3∞ untranslated region (Hsu et al., 1990; Strathmann et al., 1990; Bertrand et al., 1990). However, this variation of the splicing site would essentially affect the regulation rather than the function of the gene products. In fact, the two
L. Paquereau et al. / Gene 188 (1997) 137–141
139
Fig. 1. Nucleotide and deduced aa sequence of the ORF of XGao1 cDNA. The positions of the starting methionine and stop codon are designated by M and *. Numbers refer to the cDNA sequence (+1 corresponding to the ATG codon) and the derived aa sequence. The AT repeat motif in the 3∞ untranslated region is underlined. Sequence data have been deposited in the EMBL/GenBank data libraries under accession No. X87116. Methods: The Xenopus laevis cDNA library was made at developmental stage 11 in lgt 10 by Krieg and Melton (1985). This library was plated on Escherichia coli C600/hfla− at a density of 20 000–30 000 plaques per 140 mm plate. Recombinants were transferred to nitrocellulose filters (Hybond C, Amersham), denatured, baked for 2 h in vacuo at 80°C and prehybridized in 50% formamide, 5×SSC, 2×Denhardt’s solution, 0.1% SDS at 42°C for 3 h. Hybridization was carried out for 16 h at 42°C, in the same buffer containing 50 mg/ml snicated salmon sperm DNA with, as probe, 2×106 cpm per filter of the Xenopus ao2 cDNA corresponding to the entire coding region, kindly provided by Drs. Pituello and Krieg and randomly labeled with [a-32P]dCTP (Amersham, Les Ulis, France). The filters were washed in buffers of decreasing stringency down to 0.1×SSC, 0.1% SDS at 42°C and autoradiographed overnight. Positive clones were purified and subjected to secondary and tertiary screening. The selected clones were digested with EcoRI and subcloned in pIBI31 vector. The insert was then sequenced with a Sequenase II kit ( USB, Cleveland, USA). Amplification of the 5∞ coding region was performed using standard procedures of 5∞ RACE-amplifinder kit (Clontech, Palo Alto, USA). 2 mg RNA from stage 11 was reverse-transcribed with P1 primer CTTCTACGACGACGAATATA GGTTCGTG (892–919) and PCR amplification was carried out with ATGGGCTGCACACTGACACTGGGCG (1–21) and P2 primer GGACAAACGACTCTT CTAGTTCTTAAGCGGAGAC (819–852) during 45 cycles (94°C for 45 s; 60°C for 45 s; 72°C for 2 min).
140
L. Paquereau et al. / Gene 188 (1997) 137–141
Fig. 2. Northern blot analysis for XGao1 mRNA. 10 mg of total RNA from adult brain were loaded and electrophoresed in a 1.2% denaturing-agarose gel containing 0.66 M formaldehyde. Positions of 28S and 18S RNA and the RNA ladder are indicated. Methods: Total RNA was extracted from brain by the addition of 900 ml RNA-B@ (Bioprobe, Montreuil-sous-bois, France). Phenol extraction was performed after addition of 100 ml chloroform. RNA was isolated by isopropanol precipitation of the aqueous layer and then dissolved in DEPC-treated water. The gel was blotted to nylon membranes (Hybond N, Amersham) and UV crosslinked using standard protocols. Randomly labeled ao1 cDNA probe corresponding to the entire coding sequence (specific activity: 0.5–1 109 cpm/mg) was hybridized overnight to the blots at 42°C. Blots were washed down to 0.1×SSC, 0.1% SDS stringency at 42°C and exposed to X-ray film with intensifying screens at −70°C.
vertebrate ao isoforms diverge in the carboxy-terminal region known to contain the receptor-binding domain (Cali et al., 1992; Sullivan et al., 1987), whereas the Drosophila isoforms diverge in the amino-terminal region known to contain the bc-binding domain ( Fung and Nash, 1983; Journot et al., 1991). Although two different functional domains are exchanged between isoforms, the effect on the receptor coupling specificity
Fig. 3. Measurement of XGao1 mRNA levels by RT-PCR amplification. Total RNA was isolated from unfertilized eggs (0) or embryos at the indicated stages and reverse-transcribed. The cDNAs were amplified by the PCR methodology in the presence of specific primers. Amplified fragments were loaded on a 1.5% agarose gel. Positions of DNA ladder markers and the size of the amplified fragment are indicated. Methods: Fertilized embryos were obtained as previously described (Newport and Kirschner, 1982). Staging was established according to the tables of Nieuwkoop and Faber (1967). cDNA was synthesized in a 20 ml reaction containing 5 mg of total RNA isolated at different developmental stages. The RNA was denatured for 10 min at 70°C in the presence of 1 mM ao1 reverse specific primer P1 (see Fig. 1) and cooled on ice for 1 min. Reverse transcription was performed at room temperature for 10 min and then at 42°C for 50 min after addition of 2 ml 10×synthesis buffer, 2 ml 0.1 M DTT, 1 ml 10 mM dNTPs and 200 U RT SuperScript IITM (Gibco BRL, Cergy Pontoise, France). The reaction was terminated by a shift to 70°C for 15 min and the samples were then incubated at 37°C for 20 min after addition of 2 U of E. coli RNase H. 1 ml cDNA was used as a template in a 25 ml amplification mixture containing 200 mM dNTPs, 1 U HiTAQ polymerase (Bioprobe, Montreuil-sous-bois, France) and 0.5 mM of each primer. During the 30 cycles of the reaction, the denaturing, annealing and extension steps were optimized for 30 s at 94°C, 60°C and 72°C, respectively. Sequence of forward and reverse primers were respectively: CAGGATATCCTGAGAACCAG (517–536) and P2 primer (see Fig. 1).
might be similar. This assumption is based on experiments performed on GH3 cells, in which it was demonstrated that different bc subunits are associated with a particular ao isoform in the differential coupling of the M4-muscarinic receptor and the somatostatin receptor to calcium channels ( Kleuss et al., 1992, 1993). In the context of an evolutionary change which essentially transferred the regulation between isoforms from the promoter region of the gene to the 3∞ untranslated region of the transcript, the AT repeat motif, which did not play a differential role in Drosophila, began to exert its isoform-restricted function only in vertebrates.
3. Conclusions (1) We have isolated a XGao1 cDNA encoding a 354 aa protein. (2) The 3∞ untranslated region contains a repetitive AT motif which is not found in the ao2 isoform. A similar repetitive motif is also observed in ao1 splice variants from mammalian species. (3) The XGao1 ORF contains the five homology boxes found in all GTP-binding proteins. Furthermore, it is highly homologous to the ao1 isoform of the Go protein cloned from various mammalian species and has an identical size. Thus XGao1 cDNA codes for the amphibian ao1 isoform of the Go protein. (4) Oocytes and embryos express a maternal and a zygotic transcript. This expression pattern differs from that of the mRNA coding for the ao2 isoform which is only maternal. This differential expression might be linked to the different structural properties observed in the 3∞ untranslated region of ao splice variants.
Acknowledgement We thank Dr. Pituello and Dr. Krieg for kindly providing the complete Xenopus ao2 cDNA. We also thank Prof. J. Smith for critical reading of the manuscript. This work was supported by an ATIPE grant from CNRS and a grant from ARC to Y.A.
References Bertrand, P., Sanford, J., Rudolph, U., Codina, J. and Birnbaumer, L. (1990) At least three alternatively spliced mRNAs encoding two a subunits of the Go GTP-binding protein can be expressed in a single tissue. J. Biol. Chem. 265, 18576–18580. Bourne, H.R., Sanders, D.A. and McCormick, F. (1991) The GTPase superfamily: conserved structure and molecular mechanism. Nature 349, 117–126. Cali, J.J., Balcueva, E.A., Rybalkin, I. and Robishaw, J.D. (1992) Selective tissue distribution of G protein c subunits, including a new
L. Paquereau et al. / Gene 188 (1997) 137–141 form of the c subunits identified by cDNA cloning. J. Biol. Chem. 267, 24023–24027. Conklin, B.R., Farfel, Z., Lustig, K.D., Julius, D. and Bourne, H.R. (1993) Substitution of three amino acids switches receptor specificty of Gqa to that of Gia. Nature 363, 274–276. de Sousa, S.M., Hoveland, L.L., Yarfitz, S. and Hurley, J.B. (1989) The Drosophila Goa-like protein gene produces multiple transcripts and is expressed in the nervous system and in ovaries. J. Biol. Chem. 264, 18544–18551. Fung, B.K.-K. and Nash, C.R. (1983) Characterization of transducin from bovine retinal rod outer segments. II. Evidence for distinct binding sites and conformational changes revealed by limited proteolysis with trypsin. J. Biol. Chem. 258, 10503–10510. Gautam, N., Northup, J., Tamir, H. and Simon, M.I. (1990) G protein diversity is increased by associations with a variety of c subunits. Proc. Natl. Acad. Sci. USA 87, 7973–7977. Gilman, A.G. (1987) G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56, 615–649. Hsu, W.H., Rudolph, U., Sanford, J., Bertrand, P., Olate, J., Nelson, C., Moss, L.G., Boyd, A.E., Codina, J. and Birnbaumer, L. (1990) Molecular cloning of a novel splice variant of the a subunit of the mammalian Go protein. J. Biol. Chem. 265, 11220–11226. Journot, L., Pantaloni, C., Bockaert, J., and Audigier, Y. (1991) Deletion within the amino-terminal region of Gsa impairs its ability to interact with bc subunits and to activate adenylylcyclase. J. Biol. Chem. 266, 9009–9015. Kleuss, C., Hescheler, J., Ewel, C., Rosenthal, W., Schultz, G. and Wittig, B. (1991) Assignment of G-protein subtypes to specific receptors inducing inhibition of calcium currents. Nature 353, 43–48. Kleuss, C., Scheru¨bl, H., Hescheler, J., Schultz, G. and Wittig, B. (1992) Different b subunits determine G-protein interaction with transmembrane receptors. Nature 358, 424–426. Kleuss, C., Scheru¨bl, H., Hescheler, J., Schultz, G. and Wittig, B. (1993) Selectivity in signal transduction determined by c subunits of heterotrimeric G proteins. Science 259, 832–834.
141
Krieg, P.A. and Melton, D.A. (1985) Developmental regulation of a gastrula-specific gene injected into fertilized Xenopus eggs. EMBO J. 4, 3463–3471. Neer, E.J. (1995) Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80, 249–257. Newport, J. and Kirschner, M. (1982) A major developmental transition in early Xenopus embryos. I. Characterization and timing of cellular changes at the midblastula stage. Cell. 30, 675–686. Nieuwkoop, P. and Faber, J. (1967) Normal Table of Xenopus laevis (Daudin), 2nd ed. North Holland Publ. Co., Amsterdam. Olate, J., Jorquera, H., Purcell, P., Codina, J., Birnbaumer, L. and Allende, J.E. (1989) Molecular cloning and sequence determination of a cDNA coding for the a subunit of a Go-type protein of Xenopus laevis oocytes. FEBS Lett. 244, 188–192. On˜ate, A., Herrera, L., Antonelli, M., Birnbaumer, L. and Olate, J. (1992) Xenopus laevis oocyte Ga subunits mRNAs. Detection and quantitation during oogenesis and early embryogenesis by competitive reverse PCR. FEBS Lett. 313, 213–219. Simon, M.I., Strathmann, M.P. and Gautam, N. (1991) Diversity of G proteins in signal transduction. Science 252, 802–808. Strathmann, M.P., Wilkie, T.M. and Simon, M.I. (1990) Alternative splicing produces transcripts encoding two forms of the a subunit of GTP-binding protein Go. Proc. Natl. Acad. Sci. USA 87, 6477–6481. Sullivan, K.A., Miller, R.T., Masters, S.B., Beiderman, B., Heideman, W. and Bourne, H.R. (1987) Identification of receptor contact site involved in receptor-G protein coupling. Nature 330, 758–760. Watson, A.J., Katz, A. and Simon, M.I. (1994) A fifth member of the mammalian G-protein b-subunit family. J. Biol. Chem. 269, 22150–22156. Yoon, J., Shortridge, R.D., Bloomquist, B.T., Schneuly, S., Perdew, M.H. and Pak, W.L. (1989) Molecular characterization of Drosophila gene encoding Goa subunit homolog. J. Biol. Chem. 264, 18536–18543.
Cloning and characterization of a cDNA encoding Xenopus laevis ao1 isoform of the Go protein Laurent Paquereau, Eric Devic, Yves Audigier * UMR 9925, Universite´ Toulouse-III, Baˆt, 4R3, 118 route de Narbonne, 31062-Toulouse, Cedex, France Received 29 August 1996; revised 23 October 1996; accepted 28 October 1996; Received by A. Bernardi
Abstract The mammalian gene encoding the a subunit of the Go protein generates by alternative splicing two isoforms, ao1 and ao2, which differ in their carboxy-terminal region. We report here the cloning of a Xenopus cDNA (XGao1) which encodes a protein corresponding to the mammalian ao1 isoform. In its 3∞ untranslated region, the transcript contains a repetitive motif made up of dinucleotide AT repeats. By RT-PCR amplification, we showed that XGao1 transcripts are both maternal and zygotic. As ao2 transcripts have been shown to be maternal and devoid of AT repeats, the repetitive motif could play a role in the differential expression of each isoform. Keywords: Recombinant DNA; Alternative splicing; Heterotrimeric GTP-binding proteins; Early embryogenesis
1. Introduction Heterotrimeric GTP-binding proteins belong to the GTPase superfamily, whose members use the property to bind and hydrolyze GTP for their diverse intracellular functions (Gilman, 1987; Neer, 1995). These proteins are made up of three distinct polypeptide chains called a, b and c (Gilman, 1987; Neer, 1995) and they couple a membrane receptor, which decodes an extracellular signal, to an intracellular effector, which generates a diffusible second messenger (Gilman, 1987; Neer, 1995). Since their early characterization, the techniques of molecular biology have revealed the large diversity of these subunits (Simon et al., 1991). At the present time, up to 20 a subunits have been identified (Simon et al., 1991), five different genes coding for a b subunit have been characterized ( Watson et al., 1994) and more than six c subunits have been cloned (Gautam et al., 1990; Cali et al., 1992). * Corresponding author. Tel. +33 61 558285; Fax +33 61 556507; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA; DEPC, diethyl pyrocarbonate; DTT, dithiothreitol; GTP, guanosine 5∞-triphosphate; kb, kilobase(s) or 1000 bp; ORF, open reading frame; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RT, reverse transcription; UV, ultraviolet.
This structural diversity is directly linked to the major role of these proteins, which is the specific coupling of a given receptor to a particular type of effector. All subunits contribute to the coupling specificity at the receptor/GTP-binding protein interface, whereas the a subunit is thought to play a larger role at the GTPbinding protein/effector interface (Gilman, 1987; Neer, 1995). Although the selective association with a bc complex can participate in the specificity of receptor coupling, the carboxy-terminal region of the a subunit could be directly involved in the interaction with the receptor (Sullivan et al., 1987; Conklin et al., 1993). Indeed, the structure of the Goa gene illustrates this relationship between the carboxy-terminal domain and the receptor coupling specificity: it produces, via the alternative splicing of the exon coding for the carboxyterminal domain, two protein isoforms named ao1 and ao2 (Hsu et al., 1990; Strathmann et al., 1990) which couple distinct receptors to the same effector ( Kleuss et al., 1991). In Xenopus, only the isoform corresponding to the ao2 subtype has been cloned from an oocyte library (Olate et al., 1989). We decided therefore to investigate whether an ao1 isoform was expressed during early embryogenesis.
0378-1119/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved PII S 03 7 8 -1 1 1 9 ( 9 6 ) 0 0 7 99 - 8
138
L. Paquereau et al. / Gene 188 (1997) 137–141
2. Experimental and discussion 2.1. Cloning and sequencing of the amphibian XGao1 cDNA Four positive bacteriophage plaques were identified from a Xenopus laevis cDNA library made at developmental stage 11 in lgt 10 ( Krieg and Melton, 1985) by screening with a Xenopus ao2 cDNA corresponding to the entire coding region, kindly provided by Drs. Pituello and Krieg. Sequencing of the inserts revealed that they corresponded to truncated cDNAs lacking the aminoterminal coding region. The 5∞ region was isolated by a PCR-based strategy using the 5∞ RACE method. Amplification of the 5∞ coding region was performed using standard procedures of 5∞ RACE-amplifinder kit (Clontech): RNA from stage 11 embryos was reversetranscribed with a specific P1 primer corresponding to nucleotides 892–919. The PCR amplification was then carried out with a primer containing the ATG codon and a specific P2 primer corresponding to nucleotides 819–852. An amplified 852 bp fragment was identified and found to overlap the nucleotide sequence of the inserts. The sequence given in Fig. 1 is the cumulative full-length cDNA resulting from the assembly of the overlapping regions obtained from the 5∞ RACE-amplified fragment and the largest insert which includes most of the coding sequence (72–1062) and the 3∞ untranslated region. 2.2. 3∞ untranslated region of the ao1 transcript As underlined in Fig. 1, the 3∞ untranslated region of the ao1 cDNA contains a particular motif, a long stretch composed of AT repeats, between positions 1147 and 1234. Interestingly, the two Drosophila spliced variants contain similar, albeit smaller, stretches of AT repeats between positions 1784 and 1848 ( Yoon et al., 1989; de Sousa et al., 1989). Previously cloned ao1 cDNAs from mammals (Hsu et al., 1990; Strathmann et al., 1990) do not exhibit a repetitive AT motif. However, in the hamster, a third splice variant encoding the ao1 isoform with a different 3∞ untranslated region also displays a repetitive motif, made up of another dinucleotide, AC instead of AT, between positions 1128 and 1163 (Bertrand et al., 1990). The presence of a repetitive motif in all these species suggests that it exerted an ancestral function. As the ao1 transcript contains a repetitive AT motif in its 3∞ untranslated region which is not found in the ao2 transcript, it is tempting to speculate that this particular sequence could play a role in the regulation of the expression of isoform transcripts. 2.3. Deduced protein sequence of the ao1 isoform Translation from the first ATG yields a putative protein 354 aa long. The deduced aa sequence contains
the five structural motifs common to the a subunits of heterotrimeric GTP-binding proteins (Bourne et al., 1991). Furthermore, alignment of the aa sequence with that of various a subunits revealed that it is most similar to the primary sequence of ao subunits. In the two amino-terminal thirds of the protein, it shares strong identity with the ao-like protein cloned by Olate et al. (1989), whereas it diverges from this protein in the carboxy-terminal third. Alignment of this aa sequence with that of ao1 isoforms from different species clearly reveals a strong conservation. It shares a high degree of identity, 96% with the hamster (Hsu et al., 1990) and 95% with the mouse sequence (Strathmann et al., 1990), but is more divergent (87% identity) from Drosophila isoforms ( Yoon et al., 1989; de Sousa et al., 1989). The newly cloned cDNA (XGao1) therefore codes for an ao-like protein which is the Xenopus homolog of the mammalian ao1 isoform. Sequence alignment with the ao-like protein cloned from oocytes (Olate et al., 1989) revealed their divergence in the carboxy-terminal region, suggesting that the Xenopus ao gene, like its mammalian counterpart (Hsu et al., 1990; Strathmann et al., 1990), generates by alternative splicing two carboxy-terminally divergent isoforms. 2.4. Expression of the ao1 transcript In order to evaluate the size of the ao1 transcript, we performed a Northern blot analysis with total RNAs isolated from staged embryos. In view of the lack of detectable signal, the size of XGao1 mRNA was determined in adult brain, known for its high content of ao transcripts (Strathmann et al., 1990), and estimated to be 3.8 kb ( Fig. 2). The low abundance levels of ao1 transcripts led us to use a RT-PCR assay for studying the temporal expression of XGao1 mRNA during early embryogenesis. As shown in Fig. 3, an amplified fragment of the expected size (335 bp) was present at all stages of early development. However, the amount of amplified fragments varied and significantly increased after stage 14 to reach high values at the late stages of larval development (stage 45). The ao1 transcripts are thus present before and after the midblastula transition. This pattern of expression is different from that of ao2 transcripts, which are present in oocyte stage VI and diminish gradually during early embryogenesis, reaching a very low level at the gastrula stage (On˜ate et al., 1992). It is noteworthy that the regulation of isoform transcripts has evolved from a transcriptional level of regulation in Drosophila via the use of alternative promoters ( Yoon et al., 1989; de Sousa et al., 1989) to a posttranscriptional level in vertebrates via the 3∞ untranslated region (Hsu et al., 1990; Strathmann et al., 1990; Bertrand et al., 1990). However, this variation of the splicing site would essentially affect the regulation rather than the function of the gene products. In fact, the two
L. Paquereau et al. / Gene 188 (1997) 137–141
139
Fig. 1. Nucleotide and deduced aa sequence of the ORF of XGao1 cDNA. The positions of the starting methionine and stop codon are designated by M and *. Numbers refer to the cDNA sequence (+1 corresponding to the ATG codon) and the derived aa sequence. The AT repeat motif in the 3∞ untranslated region is underlined. Sequence data have been deposited in the EMBL/GenBank data libraries under accession No. X87116. Methods: The Xenopus laevis cDNA library was made at developmental stage 11 in lgt 10 by Krieg and Melton (1985). This library was plated on Escherichia coli C600/hfla− at a density of 20 000–30 000 plaques per 140 mm plate. Recombinants were transferred to nitrocellulose filters (Hybond C, Amersham), denatured, baked for 2 h in vacuo at 80°C and prehybridized in 50% formamide, 5×SSC, 2×Denhardt’s solution, 0.1% SDS at 42°C for 3 h. Hybridization was carried out for 16 h at 42°C, in the same buffer containing 50 mg/ml snicated salmon sperm DNA with, as probe, 2×106 cpm per filter of the Xenopus ao2 cDNA corresponding to the entire coding region, kindly provided by Drs. Pituello and Krieg and randomly labeled with [a-32P]dCTP (Amersham, Les Ulis, France). The filters were washed in buffers of decreasing stringency down to 0.1×SSC, 0.1% SDS at 42°C and autoradiographed overnight. Positive clones were purified and subjected to secondary and tertiary screening. The selected clones were digested with EcoRI and subcloned in pIBI31 vector. The insert was then sequenced with a Sequenase II kit ( USB, Cleveland, USA). Amplification of the 5∞ coding region was performed using standard procedures of 5∞ RACE-amplifinder kit (Clontech, Palo Alto, USA). 2 mg RNA from stage 11 was reverse-transcribed with P1 primer CTTCTACGACGACGAATATA GGTTCGTG (892–919) and PCR amplification was carried out with ATGGGCTGCACACTGACACTGGGCG (1–21) and P2 primer GGACAAACGACTCTT CTAGTTCTTAAGCGGAGAC (819–852) during 45 cycles (94°C for 45 s; 60°C for 45 s; 72°C for 2 min).
140
L. Paquereau et al. / Gene 188 (1997) 137–141
Fig. 2. Northern blot analysis for XGao1 mRNA. 10 mg of total RNA from adult brain were loaded and electrophoresed in a 1.2% denaturing-agarose gel containing 0.66 M formaldehyde. Positions of 28S and 18S RNA and the RNA ladder are indicated. Methods: Total RNA was extracted from brain by the addition of 900 ml RNA-B@ (Bioprobe, Montreuil-sous-bois, France). Phenol extraction was performed after addition of 100 ml chloroform. RNA was isolated by isopropanol precipitation of the aqueous layer and then dissolved in DEPC-treated water. The gel was blotted to nylon membranes (Hybond N, Amersham) and UV crosslinked using standard protocols. Randomly labeled ao1 cDNA probe corresponding to the entire coding sequence (specific activity: 0.5–1 109 cpm/mg) was hybridized overnight to the blots at 42°C. Blots were washed down to 0.1×SSC, 0.1% SDS stringency at 42°C and exposed to X-ray film with intensifying screens at −70°C.
vertebrate ao isoforms diverge in the carboxy-terminal region known to contain the receptor-binding domain (Cali et al., 1992; Sullivan et al., 1987), whereas the Drosophila isoforms diverge in the amino-terminal region known to contain the bc-binding domain ( Fung and Nash, 1983; Journot et al., 1991). Although two different functional domains are exchanged between isoforms, the effect on the receptor coupling specificity
Fig. 3. Measurement of XGao1 mRNA levels by RT-PCR amplification. Total RNA was isolated from unfertilized eggs (0) or embryos at the indicated stages and reverse-transcribed. The cDNAs were amplified by the PCR methodology in the presence of specific primers. Amplified fragments were loaded on a 1.5% agarose gel. Positions of DNA ladder markers and the size of the amplified fragment are indicated. Methods: Fertilized embryos were obtained as previously described (Newport and Kirschner, 1982). Staging was established according to the tables of Nieuwkoop and Faber (1967). cDNA was synthesized in a 20 ml reaction containing 5 mg of total RNA isolated at different developmental stages. The RNA was denatured for 10 min at 70°C in the presence of 1 mM ao1 reverse specific primer P1 (see Fig. 1) and cooled on ice for 1 min. Reverse transcription was performed at room temperature for 10 min and then at 42°C for 50 min after addition of 2 ml 10×synthesis buffer, 2 ml 0.1 M DTT, 1 ml 10 mM dNTPs and 200 U RT SuperScript IITM (Gibco BRL, Cergy Pontoise, France). The reaction was terminated by a shift to 70°C for 15 min and the samples were then incubated at 37°C for 20 min after addition of 2 U of E. coli RNase H. 1 ml cDNA was used as a template in a 25 ml amplification mixture containing 200 mM dNTPs, 1 U HiTAQ polymerase (Bioprobe, Montreuil-sous-bois, France) and 0.5 mM of each primer. During the 30 cycles of the reaction, the denaturing, annealing and extension steps were optimized for 30 s at 94°C, 60°C and 72°C, respectively. Sequence of forward and reverse primers were respectively: CAGGATATCCTGAGAACCAG (517–536) and P2 primer (see Fig. 1).
might be similar. This assumption is based on experiments performed on GH3 cells, in which it was demonstrated that different bc subunits are associated with a particular ao isoform in the differential coupling of the M4-muscarinic receptor and the somatostatin receptor to calcium channels ( Kleuss et al., 1992, 1993). In the context of an evolutionary change which essentially transferred the regulation between isoforms from the promoter region of the gene to the 3∞ untranslated region of the transcript, the AT repeat motif, which did not play a differential role in Drosophila, began to exert its isoform-restricted function only in vertebrates.
3. Conclusions (1) We have isolated a XGao1 cDNA encoding a 354 aa protein. (2) The 3∞ untranslated region contains a repetitive AT motif which is not found in the ao2 isoform. A similar repetitive motif is also observed in ao1 splice variants from mammalian species. (3) The XGao1 ORF contains the five homology boxes found in all GTP-binding proteins. Furthermore, it is highly homologous to the ao1 isoform of the Go protein cloned from various mammalian species and has an identical size. Thus XGao1 cDNA codes for the amphibian ao1 isoform of the Go protein. (4) Oocytes and embryos express a maternal and a zygotic transcript. This expression pattern differs from that of the mRNA coding for the ao2 isoform which is only maternal. This differential expression might be linked to the different structural properties observed in the 3∞ untranslated region of ao splice variants.
Acknowledgement We thank Dr. Pituello and Dr. Krieg for kindly providing the complete Xenopus ao2 cDNA. We also thank Prof. J. Smith for critical reading of the manuscript. This work was supported by an ATIPE grant from CNRS and a grant from ARC to Y.A.
References Bertrand, P., Sanford, J., Rudolph, U., Codina, J. and Birnbaumer, L. (1990) At least three alternatively spliced mRNAs encoding two a subunits of the Go GTP-binding protein can be expressed in a single tissue. J. Biol. Chem. 265, 18576–18580. Bourne, H.R., Sanders, D.A. and McCormick, F. (1991) The GTPase superfamily: conserved structure and molecular mechanism. Nature 349, 117–126. Cali, J.J., Balcueva, E.A., Rybalkin, I. and Robishaw, J.D. (1992) Selective tissue distribution of G protein c subunits, including a new
L. Paquereau et al. / Gene 188 (1997) 137–141 form of the c subunits identified by cDNA cloning. J. Biol. Chem. 267, 24023–24027. Conklin, B.R., Farfel, Z., Lustig, K.D., Julius, D. and Bourne, H.R. (1993) Substitution of three amino acids switches receptor specificty of Gqa to that of Gia. Nature 363, 274–276. de Sousa, S.M., Hoveland, L.L., Yarfitz, S. and Hurley, J.B. (1989) The Drosophila Goa-like protein gene produces multiple transcripts and is expressed in the nervous system and in ovaries. J. Biol. Chem. 264, 18544–18551. Fung, B.K.-K. and Nash, C.R. (1983) Characterization of transducin from bovine retinal rod outer segments. II. Evidence for distinct binding sites and conformational changes revealed by limited proteolysis with trypsin. J. Biol. Chem. 258, 10503–10510. Gautam, N., Northup, J., Tamir, H. and Simon, M.I. (1990) G protein diversity is increased by associations with a variety of c subunits. Proc. Natl. Acad. Sci. USA 87, 7973–7977. Gilman, A.G. (1987) G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56, 615–649. Hsu, W.H., Rudolph, U., Sanford, J., Bertrand, P., Olate, J., Nelson, C., Moss, L.G., Boyd, A.E., Codina, J. and Birnbaumer, L. (1990) Molecular cloning of a novel splice variant of the a subunit of the mammalian Go protein. J. Biol. Chem. 265, 11220–11226. Journot, L., Pantaloni, C., Bockaert, J., and Audigier, Y. (1991) Deletion within the amino-terminal region of Gsa impairs its ability to interact with bc subunits and to activate adenylylcyclase. J. Biol. Chem. 266, 9009–9015. Kleuss, C., Hescheler, J., Ewel, C., Rosenthal, W., Schultz, G. and Wittig, B. (1991) Assignment of G-protein subtypes to specific receptors inducing inhibition of calcium currents. Nature 353, 43–48. Kleuss, C., Scheru¨bl, H., Hescheler, J., Schultz, G. and Wittig, B. (1992) Different b subunits determine G-protein interaction with transmembrane receptors. Nature 358, 424–426. Kleuss, C., Scheru¨bl, H., Hescheler, J., Schultz, G. and Wittig, B. (1993) Selectivity in signal transduction determined by c subunits of heterotrimeric G proteins. Science 259, 832–834.
141
Krieg, P.A. and Melton, D.A. (1985) Developmental regulation of a gastrula-specific gene injected into fertilized Xenopus eggs. EMBO J. 4, 3463–3471. Neer, E.J. (1995) Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80, 249–257. Newport, J. and Kirschner, M. (1982) A major developmental transition in early Xenopus embryos. I. Characterization and timing of cellular changes at the midblastula stage. Cell. 30, 675–686. Nieuwkoop, P. and Faber, J. (1967) Normal Table of Xenopus laevis (Daudin), 2nd ed. North Holland Publ. Co., Amsterdam. Olate, J., Jorquera, H., Purcell, P., Codina, J., Birnbaumer, L. and Allende, J.E. (1989) Molecular cloning and sequence determination of a cDNA coding for the a subunit of a Go-type protein of Xenopus laevis oocytes. FEBS Lett. 244, 188–192. On˜ate, A., Herrera, L., Antonelli, M., Birnbaumer, L. and Olate, J. (1992) Xenopus laevis oocyte Ga subunits mRNAs. Detection and quantitation during oogenesis and early embryogenesis by competitive reverse PCR. FEBS Lett. 313, 213–219. Simon, M.I., Strathmann, M.P. and Gautam, N. (1991) Diversity of G proteins in signal transduction. Science 252, 802–808. Strathmann, M.P., Wilkie, T.M. and Simon, M.I. (1990) Alternative splicing produces transcripts encoding two forms of the a subunit of GTP-binding protein Go. Proc. Natl. Acad. Sci. USA 87, 6477–6481. Sullivan, K.A., Miller, R.T., Masters, S.B., Beiderman, B., Heideman, W. and Bourne, H.R. (1987) Identification of receptor contact site involved in receptor-G protein coupling. Nature 330, 758–760. Watson, A.J., Katz, A. and Simon, M.I. (1994) A fifth member of the mammalian G-protein b-subunit family. J. Biol. Chem. 269, 22150–22156. Yoon, J., Shortridge, R.D., Bloomquist, B.T., Schneuly, S., Perdew, M.H. and Pak, W.L. (1989) Molecular characterization of Drosophila gene encoding Goa subunit homolog. J. Biol. Chem. 264, 18536–18543.