Cloning and characterization of a fish specific gelsolin family gene, ScinL, in olive flounder (Paralichthys olivaceus)

Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Cloning and characterization of a fish specific gelsolin family gene, ScinL, in olive flounder (Paralichthys olivaceus) Deokhwe Hur, Suhee Hong ⁎ Department of Marine Biotechnology, Gangneung Wonju National University, Gangneung 210–702, South Korea

a r t i c l e

i n f o

Article history: Received 4 October 2012 Received in revised form 7 November 2012 Accepted 7 November 2012 Available online 16 November 2012 Keywords: Scinderin-like Olive flounder Cloning Gene expression Benzo(a)pyrene

a b s t r a c t Scinderin like (ScinL) gene is a unique gelsolin family gene found only in fish. In this study ScinL gene was cloned in olive flounder for the first time and characterized its expression and function. Flounder ScinL cDNA consists of 2911 nucleotides encoding a putative protein of 720 amino acids (79.4 kDa). In phylogenetic analysis, flounder ScinL is closely related to ScinL of zebra fish, anableps, and fugu with the similarity of 51–72%. Fish ScinLs are positioned between gelsolin and scinderin of other species. Flounder ScinL protein has the highly conserved actin and PIP2 binding sites, Ca2+ coordination site, and a C-terminal latch helix preventing the activation of ScinL protein in the absence of Ca2+. Putative binding sites for NFAT and AP-1 were found in 5′ flanking region. Constitutive ScinL expression was found in most organs and the expression level was higher in gill, head kidney, trunk kidney, spleen and skin than muscle, stomach, intestine and brain. In Q-PCR analysis ScinL and CYP1A1 gene expression were significantly upregulated by BaP in head kidney in vivo and in vitro, and in macrophage cells. Upregulated ScinL expression by BaP was blocked by EGTA, indicating a calcium dependent regulation of ScinL expression. © 2012 Elsevier Inc. All rights reserved.

1. Introduction The gelsolin family is a group of actin binding proteins and consists of filament severing/depolymerising proteins including scinderin (adseverin), severin (framin or capG), flightless-I, villin, advillin, protovillin, supervillin and Entamoeba histolytica actin-binding protein homologue (EhABPH) (Harris et al., 1980; Wang and Bryan, 1981). They transform cytosol from the state of gel to sol by severing and capping actin filaments resulting in cell movement, secretion, cytokinesis and synaptic plasticity (Kwiatkowski, 1999). Gelsolin family shares common six domains (G1 to G6) (Way and Weeds, 1988) but also have structural differences, implicating differential function and expression patterns. For example, the villins possess the villin headpiece at the C-terminus which is not existed in gelsolin (Friederich et al., 1992; George et al., 2007). EhABPH from Entamoeba histolytica also has a coronona-like N-terminal region followed by gelsolin/villin domain but lacking G1 (Ebert et al., 2000). Moreover scinderin doesn't have c-terminal latch helix that exists in gelsolin (Yin, 1987). In fish a unique gelsolin family gene was found and named scinderin like (ScinL). It has recently been isolated in zebrafish (Jia et al., 2007), anableps (Anableps anableps, NCBI GenBank: AY227447.1), and fugu (Takifugu rubripes: CAF89482.1) and found to have high similarity with gelsolin and scinderin. ScinL gene was found only in fish to date. They have the conserved six domains of G1 to G6 like mammalian gelsolin family members. However, the deduced amino acid sequences ⁎ Corresponding author. E-mail address: [email protected] (S. Hong). 1096-4959/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpb.2012.11.002

shows the c-terminal latch helix of gelsolin which is missed in scinderins of other species including mammals, chicken, and xenopus. Jia et al. (2007) have reported that two zebra fish ScinL genes are involved in cornea crystallization. Since then there is no report concerning the expression and function of ScinL. However, it is thought that the function of ScinL protein might be similar to mammalian scinderin because of high homology between them. Mammalian scinderin has been studied and identified as a carcinogenic related gene in addition to immune and apoptotic relationships under polycyclic aromatic hydrocarbons (PAHs) pollution (Camilla and Katarina, 2001). It was revealed that the induced up-regulation of the scinderin gene expression is immune-specific and could be a critical target in TCDD-induced immunotoxicity by reorganization of cytoskeletal actin (Camilla and Katarina, 2001). It was also reported that overexpressed scinderin induced differentiation, maturation, and apoptosis of megakaryoblastic leukemia cells (Zunino et al., 2001). Moreover, Oberemm et al. (2005) reported that the increased scinderin expression by carcinogen injection could change cell structure of leukocyte. It was also demonstrated that human uterine RL95-2 cells had suffered the subcortical actin aggregation by benzo(a)pyrene (BaP) (McGarry et al., 2002). Thus it can be postulated that the excessively upregulated scinderin expression in immune cells may cause immune suppression by remodeling cytoskeletal actin filament in immune cells. The expression of gelsolin family by PAHs is related to the influx of Ca 2 + caused by PAHs. PAHs produce superoxide ions and other reactive oxygens (ROS) (Camilla and Katarina, 2001) and these ROS stimulate the Ca 2+-release channel from sarcoplasmic reticulum (Favero et al., 1995). The resulting elevated levels of intracellular Ca 2+ can

90

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

activate a nuclear transcription factor of activated T cells (NFAT) (Crabtree and Olson, 2002). NFAT has been reported to stimulate some cytokines highly sensitive to intracellular levels of Ca 2+ (Latinis et al., 1997; Hogan et al., 2003). However only few studies have examined in fish concerning to the mechanism of PAHinduced immunotoxicity. Furthermore, gelsolin family proteins are not fully identified in fish. Especially, function of ScinL protein that has been found only in fish species and rarely studied on toxic or carcinogenic reagents. Activation of scinderin and gelsolin protein has also been known to be closely associated with influx of intracellular Ca 2+ (Sun et al., 1999). Gelsolin and scinderin can be divided into two parts of N-half (G1 to G3) and C-half (G4 to G6) (Way and Weeds, 1988; Sun et al., 1999). The N-half is involved in severing function by binding to actin filament through G2 site (Sun et al., 1999; Lin et al., 2000). The actin-binding site G2 is known to be critical for severing and capping actin filaments but is hidden until exposed by conformational change caused by binding of Ca 2 + (Sun et al., 1999). The G2 site can also be activated by pH change and caspase-3 enzyme (Lamb et al., 1992, 1993; Kothakota et al., 1997; Geng et al., 1998). Gelsolin has an additional regulatory element of C-terminal latch helix that further delays the activation of gelsolin (Lueck et al., 2000; Cheng et al., 2002). The opening of latch helix by binding of Ca 2+ allows exposing G2 in gelsolin (Crabtree and Olson, 2002). It was reported that deletion of 23 residues including the latch helix allowed gelsolin to sever in the absence of Ca 2+ (Lueck et al., 2000; Cheng et al., 2002). In this study, we have cloned ScinL gene in olive flounder and assessed its expression induced by BaP in head kidney cells in vivo and in vitro as well as elucidating the mechanism of BaP induced ScinL gene expression using a calcium chelator, EGTA (Ethylene glycol tetraacetic acid). 2. Materials and methods 2.1. Fish Olive flounder (Paralichthys olivaceus; mass around 100–200 g) were kept at the Marine Biology Center for Research and Education at Gangnung-Wonju National University (Gangnung, Korea) in circular 200 L tanks supplied with seawater at an ambient temperature of approximately 15 ± 1.2°°C with 12/12 h illumination and fed with a commercial pellet diet (Suhyupfeed, Korea). Fish were fed twice daily (9:00 and 17:00 h). During each feeding, feed was offered by hand four to five times until satiation was reached. 2.2. Cloning of ScinL gene cDNA 2.2.1. RNA extraction and first-strand cDNA synthesis Total RNA was extracted from flounder head kidney using Trizol reagent (Invitrogen, USA). RNA concentration was determined by optical density reading at 260 nm using NanoDrop (Thermo, USA), and integrity was verified by ethidium bromide staining of 28 S and 18 S ribosomal bands on a 1% agarose gel. For the cloning 4 μg of total RNA was reverse-transcribed into cDNA using FirstChoice RLM-RACE RT kit (Ambion). For gene expression study reverse transcription to cDNA was carried out as described by Laing et al. (1996). Briefly, 3 μg RNA in 13 μL DEPC-water was incubated with 1 μL of oligo (dT)12–18 (500 μg/ml, Promega) for 10 min at 70 °C. Then, 1 μL of Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega), 4 μL of 5X first strand buffer (Promega), and 1 μL of 10 mM dinucleoside triphosphate (dNTP) mix (Promega) were added and the mixture incubated at 42 °C for 1.5 h. The reaction was terminated by heating to 94 °C for 15 min and after cooling, 30 μL of DEPC water was added to make up the volume to 50 μL. The resulting cDNA was stored at − 20 °C.

2.2.2. Partial cloning of ScinL gene fragment To amplify the partial fragment of ScinL gene, a pair of oligodeoxynucleotide primers, ScinL-F1 and ScinL-R1 (Table 1), were designed based on the published ScinL cDNA sequences from other fish species. PCR was performed using 0.5 μL of cDNA product from 2.3.1 as a template and ScinL-F1/R1 primer pairs in a 20 μL mixture of 20 mM Tris–HCl (pH 8.4), 2 mM MgCl2, 200 mM each dNTPs, 0.5 M of each primer and 0.25 U Taq DNA Polymerase (TaKaRa, Japan). PCR condition was: 4 min initial denaturation at 94 °C, then 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 56 °C for 30 s and extension at 72 °C for 60 s, and 10 min final extension at 72 °C in a Px2 thermal cycler (Thermo, USA). PCR products were separated on 1% agarose gel by electrophoresis and the band of desired size was purified using QIAGEN Gel Extraction Kit (Qiagen, USA). The purified PCR product was cloned into pGEM T-easy vector (Promega, USA) and sequenced. 2.2.3. Rapid amplification of cDNA ends (RACE) To obtain the 3′ and 5′ end sequences, nested 3′-RACE and 5′-RACE PCR were performed using FirstChoice RLM-RACE RT kit (Ambion, USA). From the partial sequence, ScinL specific primers (ScinLDSO-F, Gel-F2, ScinLDSO-R, and ScinL-R2) were designed for 3′-RACE and 5′-RACE PCR. The first round of 3′RACE PCR reaction was carried out with 3′-RACE outer primer (Ambion, USA) and gene specific forward primer (ScinLDSO-F) using LA Taq DNA polymerase (TaKaRa, Japan). The first round PCR product was subjected to a nested PCR with 3'RACE inner primer (Ambion, USA) and ScinL gene specific inner primer (ScinL2-F). The 5′ sequences were obtained from 5′ RACE PCR using 5′ RACE outer primer and ScinLDSO-R or 5'RACE inner primer (Ambion, USA) and ScinL2-R for first and second round PCR, respectively. The nested PCR products of 5′ and 3′ RACE PCR were sequenced and a pair of gene-specific primers were designed to clone the full length of ScinL cDNA (ScinL full-F and ScinL full-R). PCR was carried out for amplifying the full-length sequences of ScinL cDNA. The primer sequences are listed in Table 1. We were not able to obtain the full genomic sequence. It seems to be too big to be cloned by ordinary methods. The genomic size of ScinL in zebrafish (ENSDARG00000091639) is known to be 12.7 kb (www.ensemble.org). 2.2.4. Sequence analysis Members of the gelsolin family were identified in the GenBank database using the Blast program. Multiple alignments of cDNA sequence were performed by Editseq and Megalign program (DNAStar, USA). Protein sequences were aligned using ClustalW. Phylogenetic trees were Table 1 Oligonucleotide primers used for ScinL gene cloning. Primer name

Sequence 5′-3′

Application

ScinL-F1 ScinL-R1 ScinL DSO-F ScinL-F2 ScinL DSO-R ScinL-R2 ScinL full-F

CCCGATTAGCTCCCACGGT CCTGATTTGCTCCCATGCC AGCTCCCACGGTCACTTCTTIIIIIGAGACTGTTAC ACTGGCAGCATCAGCATTCC TTGGTGTTCAGATTGGAGGCAIIIIICACGACCTC CCCTCCGCTGTGGATGATC AAAACTCCTACATCTACACCCTCCA

ScinL full-R

TTG CAA TCC TGG GAG TTT TAT TTA AAA

SCGW1 SCGW2 AP1 AP2 SCGW full F SCGW full R ScinL-XhoI-F

GGAGCAGAGACGCTGTTGGAGGGTGTAG AGAAGTGAACTCACAGTTTGCAAGATGAAT GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT GGGGTACCTCTCAACACTTATTCACAGAGGA GGCTCGAGCCCAGCCACATGTGTATGTTGT GGCTCGAGGGATGGTTTCTCATAAAG

ScinL-stop-R

CTGGAGTTTTGCGCTCAGAAA

Partial fragment Partial fragment 3′-RACE PCR 3′-RACE PCR 5′-RACE PCR 5′-RACE PCR Full-length cDNA cloning Full-length cDNA cloning Genome walking Genome walking Genome walking Genome walking Genome walking Genome walking Fusion protein production Fusion protein production

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98 Table 2 Oligonucleotide primers used for gene expression analysis. Gene

Accession No. Primer

Sequence (5′-3′)

Cytochrome p450 1A1

EF451958

Scinderin like

JX235336

Elongation factor-1 alpha

AB017183

TGGAGGAACACATCTGCAAAGA CACATTCCGCAGATCACGTT GAGCCTCCCCACCTGATGA GGTCTGCGACTGTCCACCTT CTCCACTGAGCCCCCTTACA GTCTCCGTGCCAACCAGAGA

CYP1A F CYP1A R ScinL1 F ScinL1 R EF1α F EF1α R

constructed using Phylip3.67. Seqboot, protdist, and consense were used to make unrooted 1000 times bootstrapped parsimony trees. Trees were drawn with Treeview, version 1.5 (Thompson et al., 1994). 2.3. Cloning of promoter region of flounder ScinL gene by genome walking The 5′ flanking region of the ScinL gene was isolated using the Universal Genome Walker Kit (Clontech, USA) according to the manufacturer's instruction. Four libraries were independently generated by cutting the genomic DNA extracted from flounder dorsal muscle with the restriction enzymes of DraI, EcoRV, PvuII, and StuI. To obtain the ScinL upstream region, two adjacent reverse primers were designed in the 5’ UTR region of the target gene (SCGW1 and SCGW2) and used in nested PCRs for each library in combination with the forward adaptor primers (AP1 and AP2). The resulting PCR products were cloned into pGEM T-easy vector (Invitrogen, USA), and sequenced in both directions using M13F and M13R primers. To verify the obtained sequences, PCR was performed using genomic DNA and primers of SCGW Full F and SCGW Full R designed within the 5’ flanking region and cDNA region, respectively (Table 1). The product was sequenced and identified transcription factor binding motifs using TFSEARCH version 1.3 and MatInspector version 6.2. 2.4. Tissue distribution of ScinL gene expression To analyze constitutive expression of ScinL gene, six olive flounder (200 g) were aneasthesized. Liver, head kidney, trunk kidney, spleen, intestine, stomach, gill, muscle, brain and skin were sampled aseptically. Samples were immediately frozen in liquid nitrogen and stored at − 80 °C until RNA extraction. ScinL gene expression was observed by RT-QPCR using ScinL1 primer set; EF1α was used as a reference gene (Table 2). 2.5. In vivo analysis of ScinL gene expression Eight olive flounder (200 g) in each group were anaesthetized with MS222 (Woogene B&G, Korea) and intraperitoneally injected with 200 μL of benzo(a)pyrene (BaP, Sigma USA) at the concentration of 50 mg/kg body mass. BaP was prepared as stock solution in DMSO. Control fish were injected with DMSO only. Two days and 7 days post-injection, head kidney was removed and immediately frozen in liquid nitrogen, followed by storage at −80 °C until RNA extraction. Total RNA was extracted by using Trizol reagent (Invitrogen, USA) and Q-PCR analysis was performed by the method mentioned above. 2.6. In vitro analysis of gene expression in primary head kidney cell and head kidney macrophage cells Since there is no immune cell line for olive flounder yet, leucocytes enriched head kidney cells were freshly prepared to analyze the ScinL gene expression. For this 4 healthy flounder (100 g) were anesthetized, killed by cutting spinal cord, and aseptically removing the head kidney. Head kidney was gently passed through sterile mesh (BD, USA) in a petri dish containing L-15 medium (Welgene, Korea) containing 100 U penicillin and 100 μg streptomycin/ml (Gibco). The head kidney

91

cells washed by centrifugation at 250 g at 4 °C for 10 min, resuspended in the same medium, and adjusted to 2 × 106 cells/mL. One milliliter of head kidney cell from each fish was added into a well of 24-well plate and incubated with 0.01, 0.1, 1, 10 μM of BaP dissolved in DMSO or only with DMSO for 6 h at 20 °C for the dose response. For the time course head kidney cells were incubated with 0.1 or 1 μM of BaP dissolved in DMSO or only with DMSO for 3, 6, 24, 48 h at 20 °C. The suboptimal doses to upregulate both ScinL and CYP1A1 expression were chosen for the time course. To analyze the mechanism of BaP induced gene expression, head kidney cells were incubated in the presence of 1 μM BaP with or without 4 μM EGTA (Sigma, USA) for 6 h. ScinL gene expression was also analyzed in head kidney macrophage cells. To isolate macrophage cells, head kidney cells were obtained from 4 fish. Five milliliter of head kidney cells from each fish in L-15 medium containing 0.1% FBS were added into 25 cm 2 flasks at 2 × 10 7 cells/mL and incubated at 20 °C. Unattached cells were washed away twice using the same medium at 2 h and 24 h. The medium was replaced with fresh L-15 medium containing 10% FBS and macrophage cells were incubated with 0.1 μM of BaP or DMSO only for 12, 24, and 48 h at 20 °C. Total RNA was extracted from each flask using TRIsure (Bioline, UK). 2.7. Q-PCR analysis Gene expression was analyzed by quantitative real-time PCR (Q-PCR) using the ABI 7900 HT real-time thermocycler (Applied Biosystems, USA). Gene-specific primers were chosen using Primer Express software (Applied Biosystems) and listed in Table 2. The primers were designed that at least one primer crossed an intron, so that genomic DNA could not be amplified under the PCR conditions used. The Q-PCR reaction was performed in 20 μL reaction containing 10 μL of SYBR Green Real time PCR Master Mix (TaKaRa, Japan), 0.4 mM of each forward and reverse primer, 500 nM ROX reference dye II and 2 μL of cDNA. Q-PCR was performed in duplicate using the following protocol: 60 s at 95 °C; the template was amplified for 40 cycles of denaturation for 15 s at 95 °C, annealing for 15 s at 58.5 °C and extension for 23 s at 72 °C. The linearity of the dissociation curve was analyzed using the ABI 7900 HT software and the mean cycle time of the linear part of the curve was represented cycle time (Ct). CYP1A1 and ScinL gene expression was analyzed with EF1α in the same plate and normalized to EF1α (NCBI GenBank accession No. AB017183) using the following equation: ΔCtGENE =CtGENE −CtEF1α. The fold change of target gene expression relative to control was calculated using the following equation: fold change=2ΔΔCtGENE, ΔΔCtGENE =ΔCtGENE of the control −ΔCtGENE of each sample. Values are mean fold change±SD. For in vitro analysis, common references containing equal molar amount of purified PCR products was used for quantification throughout. Serially diluted references were used for absolute quantification analysis. After normalization to the expression level of EF1α, fold change were calculated by dividing the ratio to EF1α by DMSO treatment sample in each time point. 2.8. Statistical analysis Q-PCR results were analyzed by the SPSS12.0 (SPSS Inc.). The arbitrary units after normalization to the expression level of EF1α with the lowest expression level in each fish defined as 1 was log2 transformed to improve the normality of data distribution (Wang et al., 2011). One way-analysis of variance (ANOVA) and the LSD post hoc test were used to analyze the expression data, with P b 0.05 between treatment groups and control groups considered significant. For the inhibition test independent samples T test (Levene's test) was used to see if there is any difference between BaP treated samples and BaP + EGTA or ANF treated samples in head kidney cells.

92

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

Fig. 1. Nucleotide and deduced amino acid sequences of flounder ScinL. Nucleotides are numbered from the first base at the 5′ end. Amino acids are numbered from the initiating methionine. The asterisk (*) indicates the stop codon. A possible mRNA instability motif (ATTTA) and two polyadenylation signals (ATTAAA, AATAAA) are underlined at the 3′ UTR.

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

3. Results 3.1. Cloning of ScinL gene in olive flounder From 3′ and 5′ RACE analysis, it was found that cDNA of flounder ScinL gene consists of 2911 nucleotide encoding a putative protein of 721 amino acids with a molecular mass of 79.5 kDa (Fig. 1). It has a 5′-UTR of 78 bp, an open reading frame of 2163 bp encoding 720 aa and a 3′-UTR of 708 bp. The 3′-UTR contains one ATTTA motif and two polyadenylation signals (ATTAAA, AATAAA).

3.2. Phylogenetic analysis of ScinL gene in olive flounder Phylogenetic relationship between the flounder ScinL and gelsolin family genes from other vertebrates was analyzed. Gelsolin family proteins with similar domain architecture were clustered together

93

in the phylogenetic tree. The flounder ScinL is closely related to ScinL from zebrafish, anableps, pufferfish and salmon and fish ScinLs are positioned between gelsolin and scinderin (Fig. 2). Fish ScinL are well conserved in different species and human Scinderin and gelsolin genes with the similarities between 34–63% (Table 3).

3.3. Identification of functional motifs of ScinL by alignment with human gelsolin and scinderin The putative flounder ScinL protein consists of the conserved 6 segments from G1 to G6 of gelsolin family. Two actin-binding sites and one PIP2 (phosphatidyl inositol biphosphate 2) binding site are conserved in segment 1 and 2 (Fig. 3A). Ca 2+ coordination site of the five aspartic acid residues involved in type 2 metal-ion coordination are conserved at the positions of 42, 162, 422, 542, and 548. In addition, Asp85 and Asp464 involved in type 1 Ca 2+ coordination

Fig. 2. Phylogenetic tree. Phylogenetic relationship between the flounder ScinL and gelsolin family genes from other vertebrates were analyzed by constructing A Neighbor-Joining phylogenetic tree based on the analysis of amino acid within PHYLIP Version 3.67. Numbers in the tree are GI No in the NCBI database. Scientific names are shortened as follows: Danre (Danio rerio); Tetni (Tetraodon nigroviridis); Xenla (Xenopus laevis); Xentr (Xenopus tropicalis); Ratno (Rattus norvegicus); Macmu (Macaca mulatta); Homsa (Homo sapiens); Bosta (Bos taurus); Musmu (Mus musculus); Canfa (Canis lupus familiaris); Galga (Gallus gallus); Pantr (Pan troglodytes); Halro (Halocynthia roretzi); Parol (Paralichthys olivaceus); Salsa (Salmo salar), Dicdi (Dictyostelium discoideum).

94

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

Table 3 Identities (%) of nucleotide sequences between fish ScinL genes and human scinderin and gelsolin genes.

ScinL_Parol ScinL_Anaan ScinL_Danre ScinL_Tetni ScinL_Salsa GSN_Homsa Scin_Homsa

ScinL_Parol

ScinL_Anaan

ScinL_Danre

ScinL_Tetni

ScinL_Salsa

GSN_Homsa

57.9 72.0 51.0 63.1 56.4 56.4

55.6 36.7 45.5 47.6 48.6

45.8 56.5 57.2 56.0

34.6 39.3 39.4

42.1 41.2

58.9

Abbr.: Parol, Paralichthys olivaceus; Anaan, Anableps anableps; Danre, Danio rerio; Tetni, Tetraodon nigroviridis; Salsa, Salmo salar; Homsa, Homo sapiens; ScinL, scinderin like gene; GSN, gelsolin; Scin, scinderin.

Fig. 3. Identification of functional motifs of ScinL. A. Alignment of ScinL with human gelsolin and scinderin. G1 to G6 segments, actin binding helix (brown), PIP2 binding site (grey), aspartic acids involved in type 2 metal ion coordination (yellow), and aspartic acids involved in type 1-calcium ion coordination (blue) are conserved. B. Alignment of the C-termini sequences of gelsolin, scinderin and ScinL from different species. The C-terminal latch helix was found in gelsolin and ScinL and underlined. Residues necessary to maintain calcium regulation are in red. The GenBank gene ID and species name of these proteins are in Fig. 2. C. Schematic model for activation of C-termini latch helix by binding of Ca2+.

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

are also conserved (Fig. 3A). Once Ca 2+ binds to these sites gelsolin family proteins can be activated by exposing the binding site for actin and PIP2 and starts to depolymerise cytoskeletal actin filaments. Alignment of C-terminal sequences of scinderin, gelsolin and ScinL shows that gelsolin and ScinL except scinderin have C-terminal latch helix (Fig. 3B). This C-termini latch helix is known to play a crucial role in delaying the activation of gelsolin (Fig. 3C).

95

3.5. Tissue distribution of ScinL gene expression ScinL gene was constitutively expressed in most tissues in olive flounder but the expression levels were varied in different tissues as it was higher in gill (41.3 times), spleen (25.9 times), head kidney (16.2 times), trunk kidney (13.2 times) and skin (27.1 times) than in muscle (1 times), stomach (7.2 times), intestine (4.5 times), liver (2.7 times) and brain (2.4 times) (Fig. 5).

3.4. Cloning and analysis of 5′ flanking region of flounder ScinL 3.6. Expression of ScinL by BaP To understand the transcriptional regulation of the flounder ScinL, the 5′ flanking region of the gene was identified. In the genome walking experiment the longest PCR product of 1300 bp was obtained from PvuII Genome Walker Library and sequenced (Fig. 4A). Consequently TATA-box was positioned at − 31 to −23, and CAAT-box was found at − 59 to − 52 (Fig. 4B). Furthermore, sequence analysis of MatInspector and TFSEARCH revealed some putative transcription factor-binding sites including NFAT, AP-1 (activating protein-1) or c-Ets-1 on the 5′ flanking region (Fig. 4B).

In vivo experiment revealed that ScinL gene expression was significantly increased in head kidney by 50 mg/kg B.W. of BaP along with cytochrome P450 1A1 (CYP1A1) gene (Fig. 6). CYP1A1 gene was chosen because it is induced by BaP and other PAHs via the AhR pathway. The expression level was 2.7 and 1.6 times higher than DMSO treatment group at 2 and 7 day, respectively. CYP1A1 gene expression level in BaP group was about 20 and 15 times higher than in control group at day 2 and day 7, respectively (Fig. 6).

Fig. 4. Identification of transcription factor binding site on 5′ flanking region of ScinL. Transcription factor binding sites were predicted by MatInspector and TFSEARCH. Consensus elements of transcription factor binding sites, CAAT box and TATA box are underlined. The transcription start site (+1, TSS) is boxed and sequence in bold type denotes nucleic acid residues are exon region. Sequences related to the TATA box (−31 to −23) and the CAAT box (−59 to −52) were found upstream of TSS.

96

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

Fig. 5. Tissue distribution of ScinL gene expression in olive flounder. Total RNA was extracted from various tissues in flounder including liver, head kidney, trunk kidney, spleen, intestine, stomach, gill, muscle, brain, and skin, using Trizol and RT-QPCR analysis was performed. Arbitrary units are ScinL expression in each tissue relative to the lowest expression in muscle. The results are presented as mean + SEM from 6 fish.

In vitro experiment revealed that ScinL gene expression was upregulated by BaP in dose dependent manner. Significant upregulation was found in the samples treated with 0.1 and 1 μM of BaP and the expression was the highest at 1 μM of BaP (Fig. 7A-1). CYP1A1 gene expression was also upregulated by BaP in dose dependent manner and also highest expression was found at 1 μM of BaP (Fig. 7B-1). CYP1A1 gene expression was significantly upregulated by all tested doses of BaP. In time course the expression level of ScinL and CYP1A1 was highest at 6 h and declined after then (Fig. 7A, B-2). ScinL gene expression induced by BaP was blocked by EGTA but CYP1A1 gene expression was inhibited by ANF not by EGTA (Fig. 7A, B-3). In macrophage cells a significant upregulation of ScinL gene expression was delayed until 48 h (Fig. 7A, B-4) but the significant upregulation of CYP1A1 gene expression was found only at 12 h. 4. Discussion In this study, a ScinL gene was cloned for the first time in olive flounder and found to be constitutively expressed in most tissues in olive flounder. This is in agreement with Svensson and Lundberg (2001) who reported that scinderin is present in all tissues in mouse, although at low concentrations. Lueck et al. (1998) also demonstrated that scinderin was highly expressed in mouse kidney and intestine at all stages of development and in human fetal and adult kidney while gelsolin was expressed much more widely in both murine and human tissues. However in fish ScinL expression was hardly studied except Jia et al. (2007) reported that the constitutive

Fig. 6. In vivo analysis of ScinL gene expression by BaP treatment. Olive flounder was intraperitoneally injected with 200 μL of BaP (10 mg/kg of BW) dissolved in DMSO or DMSO only and head kidney was taken 2 days and 7 days later. Total RNA was extracted using Trizol and reverse transcribed. Q-PCR was carried out and relative gene expression to reference gene i.e. EF1α was represented by fold change to control group at each time point. The results are presented as mean± SEM from 8 fish. Asterisks * represent significance at 95% confidence level by LSD post hoc test in ANOVA using SPSS 12.0 (P b 0.05).

expression of ScinLb gene in brain, cornea, heart and lens and ScinLa gene in cornea and lens in zebra fish. In this study ScinL expression was higher in the immune tissues like gill, head kidney, trunk kidney, spleen, and skin than other tissues. Since there is only little information about ScinL expression to date, further study is needed to understand tissue distribution of ScinL expression in various fish species. In gene expression study Q-PCR analysis revealed that ScinL gene expression was highly increased by BaP treatment in head kidney, a major immune organ in bony fish in vitro and in vivo. Previous mammalian studies also showed an induced scinderin gene expression by 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) in mouse thymus and the specific up-regulation of the scinderin gene expression in immune organs and the induction of scinderin gene expression was dose- and timedependent in parallel with the induction of CYP1A1 (Svensson and Lundberg, 2001). Ito et al. (2006) also reported that diesel exhaust particles, TCDD and BaP upregulated several genes including CYP1A1, CYP1b1, TCDD-inducible poly (ADP-ribose) polymerase, and scinderin. The present study also showed co-upregulation of ScinL and CYP1A1 gene expression by BaP. Even though ScinL gene expression was co-upregulated with CYP1A1 in flounder, the activation pathways for each gene might be different. BaP is known to induce gene expression by activating AhR (Backlund and Ingelman-Sundberg, 2005) and NFAT pathway (Crabtree and Olson, 2002). PAHs increase intracellular concentration of Ca2+ (Tannheimer et al., 1997; Le Ferrec et al., 2002) to activate NFAT (Crabtree and Olson, 2002). Since the ScinL expression was blocked by EGTA but not by ANF in flounder, it is supposed that ScinL gene expression was mainly induced via NFAT pathway. CYP1A1 gene expression is known to be induced by AhR pathway and was inhibited by ANF but not by EGTA in this study. Moreover, in the promoter analysis, putative binding sites for NFAT and AP-1 were found in flounder ScinL 5’ flanking region. NFAT and AP-1 are known to co-regulate gene expressions of interleukins, TNFα, IFNγ, granulocyte–macrophage colony- stimulating factor, Fas ligand, CD25, and COX-2 by increased intracellular calcium level (Macian et al., 2001). In addition to the gene expression the function of ScinL protein might be affected by intracellular Ca 2+ concentration since it was found in the multiple alignments of deduced amino acid sequences that flounder ScinL has the highly conserved Ca 2+ coordination sites and C-terminal latch helix structure. Flounder ScinL has the conserved five aspartic acid residues involved in type 2 metal ion coordination and two aspartic acids involved in type 1 Ca 2+ coordination. These Ca 2 + coordination sites are well known as a main location of Ca 2+ binding positions that activate gelsolin family proteins (Yu et al., 1990). Moreover, C-terminal latch helix is known for calcium dependent function that the closed claw-like structure delays the activation

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

97

Fig. 7. In vitro analysis of ScinL and CYP1A1 gene expression upon BaP treatment. Primary head kidney cells were treated with BaP at the concentrations of 0.01, 0.1, 1, 10 μM for 6 h at 20 °C (A, B-1) or at 0.1, 1 μM for 3, 6, 24, 48 h (A, B-2). For inhibition test head kidney cells were treated with 1 μM of BaP for 6, 24 h with or without 1 μM of ANF or 4 μM of EGTA. Macrophage cells were treated with 0.1 μM for 12, 24, 48 h at 20 °C (A, B-4). Control was treated with only DMSO at each time point. Total RNA was extracted using Trizol and reverse transcribed. Q-PCR was carried out and ScinL (A pannel) and CYP1A (B pannel) gene expression relative EF1α was represented by fold change to control group at each time point or to BaP treated group for inhibition test. The results are presented as mean ± SEM from 4 fish. Asterisks * represent significance at 95% confidence level by LSD post hoc test in ANOVA using SPSS 12.0 (P b 0.05). For the inhibition test independent samples T test (Levene's test) was used to see if there is difference between BaP treated samples and BaP + EGTA or ANF treated samples.

of gelsolin (Lueck et al., 2000) but can be opened by Ca2+ binding, exposing active sites to actin (Cheng et al., 2002). In mammals, fragmentation of epithelial cells by BaP has been reported in rat (Andrysik et al., 2007). It has been also demonstrated that overexpressed scinderin induced differentiation, maturation, and apoptosis in megakaryoblastic leukemia cells (Zunino et al., 2001). Thus it can be proposed that the most feasible mechanism of the immunotoxicity of PAHs is that intracellular Ca2+ influx increases NFAT mediated gene expression and

then produce and activate ScinL proteins, resulting in cell structural deformation or functional disorder that may include immune suppression, immunotoxicity or apoptosis. In conclusion we have cloned ScinL gene in olive flounder for the first time and characterized its expression and function. We have found that the constitutive ScinL expression was higher in immune organs like gill, head kidney, trunk kidney, spleen and skin than muscle, stomach, intestine and brain. Indeed the sequence analysis and

98

D. Hur, S. Hong / Comparative Biochemistry and Physiology, Part B 164 (2013) 89–98

gene expression study have proposed that the expression and function of flounder ScinL protein can be upregulated by Ca 2+ influx caused by BaP treatment. Acknowledgement This work was supported by the Korea Research Foundation (KRF) grant funded by the Korean government (MEST) (no. 2009–0072332). References Andrysik, Z., Vondracek, J., Machala, M., Krcmar, P., Svihalkova-Sindlerova, L., Kranz, A., 2007. The aryl hydrocarbon receptor-dependent deregulation of cell cycle control induced by polycyclic aromatic hydrocarbons in rat liver epithelial cells. Mutat. Res. 615, 87–97. Backlund, M., Ingelman-Sundberg, M., 2005. Regulation of aryl hydrocarbon receptor signal transduction by protein tyrosine kinases. Cell. Signal. 17, 39–48. Camilla, S., Katarina, L., 2001. Immune-specific up-regulation of adseverin gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Mol. Pharmacol. 60, 135–142. Cheng, F., Shen, J., Luo, X., Jiang, H., Chen, K., 2002. Steered molecular dynamics simulation on the “tail helix latch” hypothesis in the gelsolin activation process. Biophys. J. 83, 753–762. Crabtree, G.R., Olson, E.N., 2002. NFAT signaling: choreographing the social lives of cells. Cell 109, S67–S79. Ebert, F., Guillen, N., Leippe, M., Tannich, E., 2000. Molecular cloning and cellular localization of an unusual bipartite Entamoeba histolytica polypeptide with similarity to actin binding proteins. Mol. Biochem. Parasitol. 111, 459–464. Favero, T.G., Zable, A.C., Abramson, J.J., 1995. Hydrogen peroxide stimulates the Ca2+ release channel from skeletal muscle sarcoplasmic reticulum. J. Biol. Chem. 270, 25557–25563. Friederich, E., Vancompernolle, K., Huet, C., Goethals, M., Finidori, J., Vandekerckhove, J., Louvard, D., 1992. An actin-binding site containing a conserved motif of charged amino acid residues is essential for the morphogenic effect of villin. Cell 70, 81–92. Geng, Y.J., Azuma, T., Tang, J.T., Hartwig, J.H., Muszynski, M., Wu, Q., Libby, P., Kwiatkowski, D.J., 1998. Caspase-3-induced gelsolin fragmentation contributes to actin cytoskeletal collapse, nucleolysis, and apoptosis of vascular smooth muscle cells exposed to proiflammatory cytokines. Eur. J. Cell Biol. 77, 294–302. George, S.P., Wang, Y., Mathew, S., Kamalakkannan, S., Khurana, S., 2007. Dimerization and actin-bundling properties of villin and its role in the assembly of epithelial cell brush borders. J. Biol. Chem. 282, 26528–26541. Harris, H.E., Bamburg, J.R., Weeds, A.G., 1980. Actin filament disassembly in blood plasma. FEBS Lett. 123, 49–53. Hogan, P.G., Chen, L., Nardone, J., Rao, A., 2003. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes 17, 2205–2232. Ito, T., Nagai, H., Lin, T.M., Peterson, R.E., Tohyama, C., Kobayashi, T., Nohara, K., 2006. Organic chemicals adsorbed onto diesel exhaust particles directly alter the differentiation of fetal thymocytes through arylhydro carbon receptor but not oxidative stress responses. J. Immunotoxicol. 3, 21–30. Jia, S., Omelchenko, M., Garland, D., Vasiliou, V., Kanungo, J., Spencer, M., Wolf, Y., Koonin, E., Piatigorsky, J., 2007. Duplicated gelsolin family genes in zebrafish: a novel scinderin-like gene (scinla) encodes the major corneal crystallin. FASEB J. 21 (12), 3318–3328. Kothakota, S., Azuma, T., Reinhard, C., Klippel, A., Tang, J., Chu, K., McGarry, T.J., Kirschner, M.W., Koths, K., Kwiatkowski, D.J., Williams, L.T., 1997. Caspase-3 generated fragment of gelsolin: effector of morphological change in apoptosis. Science 278, 294–298. Kwiatkowski, D.J., 1999. Functions of gelsolin: motility, signaling, apoptosis, cancer. Curr. Opin. Cell Biol. 11, 103–108.

Laing, K.J., Grabowski, P.S., Belosevic, M., Secombes, C.J., 1996. A partial sequence for nitric oxide synthase from a goldfish (Carassius auratus) macrophage cell line. Immunol. Cell Biol. 74, 374. Lamb, J., Allen, P.G., Tuan, B., Nakayama, T., Janmey, P.A., 1992. Low pH activates gelsolin in the absence of calcium. Mol. Biol. Cell 3, 41. Lamb, J.A., Allen, P.G., Tuan, B.Y., Janmey, P.A., 1993. Modulation of gelsolin function — activation at low pH overrides Ca2+ requirement. J. Biol. Chem. 268, 8999–9004. Latinis, K.M., Norian, L.A., Eliason, S.L., Koretzky, G.A., 1997. Two NFAT transcription factor binding sites participate in the regulation of CD95 (Fas) ligand Expression in activated Human T Cells. J. Biol. Chem. 272, 31427–31434. Le Ferrec, E., Lagadic-Gossmann, D., Rauch, C., Bardiau, C., Maheo, K., Massiere, F., Le Vee, M., Guillouzo, A., Morel, F., 2002. Transcriptional induction of CYP1A1 by oltipraz in human Caco-2 cells is aryl hydrocarbon receptor- and calciumdependent. J. Biol. Chem. 277, 24780–24787. Lin, K.M., Mejillano, M., Yin, H.L., 2000. Ca2+ regulation of gelsolin by its C-terminal tail. J. Biol. Chem. 275, 36158–36163. Lueck, A., Brown, D., Kwiatkowski, D.J., 1998. The actin-binding proteins adseverin and gelsolin are both highly expressed but differentially localized in kidney and intestine. J. Cell Sci. 111, 3633–3643. Lueck, A., Yin, H.L., Kwiatkowski, D.J., Allen, P.G., 2000. Calcium regulation of gelsolin and adseverin: a natural test of the helix latch hypothesis. Biochemistry 39, 5274–5279. Macian, F., Lopez-Rodriguez, C., Rao, A., 2001. Partners in transcription: NFAT and AP-1. Oncogene 20, 2476–2489. McGarry, M.A., Charles, G.D., Medrano, T., Bubb, M.R., Grant, M.B., Campbell-Thompson, M., Shiverick, K.T., 2002. Benzo(a)pyrene, but not 2,3,7,8-tetrachlorodibenzo-p-dioxin, alters cell adhesion proteins in human uterine RL95-2 cells. Biochem. Biophys. Res. Commun. 294, 101–107. Oberemm, A., Meckert, C., Brandenburger, L., Herzig, A., Lindner, Y., Kalenberg, K., Krause, E., Ittrich, C., Kopp-Schneider, A., Stahlmann, R., 2005. Differential signatures of protein expression in marmoset liver and thymus induced by singledose TCDD treatment. Toxicology 206, 33–48. Sun, H.Q., Yamamoto, M., Mejillano, M., Yin, H.L., 1999. Gelsolin, a multifunctional actin regulatory protein. J. Biol. Chem. 274, 33179–33182. Svensson, C., Lundberg, K., 2001. Immune-specific up-regulation of adseverin gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Mol. Pharmacol. 60, 135–142. Tannheimer, S.L., Barton, S.L., Ethier, S.P., Burchiel, S.W., 1997. Carcinogenic poly-cyclic aromatic hydrocarbons increase intracellular Ca2+ and cell proliferation in primary human mammary epithelial cells. Carcinogenesis 18, 1177–1182. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Wang, L.L., Bryan, J., 1981. Isolation of calcium-dependent platelet proteins that interact with actin. Cell 25, 637–649. Wang, T., Huang, W., Costa, M.M., Secombes, C.J., 2011. The gamma-chain cytokine/receptor system in fish: more ligands and receptors. Fish Shellfish Immunol. 31, 673–687. Way, M., Weeds, A.G., 1988. Nucleotide sequence of pig plasma gelsolin. Comparison of protein sequence with human gelsolin and other actin-severing proteins shows strong homologies and evidence for large internal repeats. J. Mol. Biol. 203, 1127–1133. Yin, H.L., 1987. Gelsolin: calcium- and polyphosphoinositide regulated actin-modulating protein. BioEssays 7, 176–179. Yu, F.X., Johnston, P.A., Sudhof, T.C., Yin, H.L., 1990. gCap39, a calcium ion- and polyphosphoinositide-regulated actin capping protein. Science 250, 1413–1415. Zunino, R., Li, Q., Rose, S.D., Romero-Benitez, M.M., Lejen, T., Brandan, N.C., 2001. Expression of scinderin in megakaryoblastic leukemia cells induces differentiation, maturation, and apoptosis with release of platelet like particles and inhibits proliferation and tumorigenesis. Blood 98, 2210–2219.