Cloning and Characterization of a Novel Nuclear Bcl-2 Family Protein, zfMcl-1a, in Zebrafish Embryo

Biochemical and Biophysical Research Communications 279, 725–731 (2000) doi:10.1006/bbrc.2000.3977, available online at http://www.idealibrary.com on

Cloning and Characterization of a Novel Nuclear Bcl-2 Family Protein, zfMcl-1a, in Zebrafish Embryo Ming-Chyuan Chen,* ,† Hong-Yi Gong,* Ching-Yi Cheng,* Jia-Pey Wang,* Jiann-Ruey Hong,* and Jen-Leih Wu* ,1 *Laboratory of Marine Molecular Biology and Biotechnology, Institute of Zoology, Academia Sinica, Taipei, Taiwan 115, Republic of China; and †Department of Planning and Research, National Museum of Marine Biology and Aquarium, Pingtung, Taiwan 944, Republic of China

Received November 10, 2000

The importance of the Bcl-2 family proteins in normal vertebrate embryogenesis is being recognized; however, their regulatory mechanism is poorly understood. To elucidate the embryonic roles of Bcl-2 family proteins, we cloned and characterized the first zebrafish Bcl-2 family protein, zfMcl-1a. Zebrafish Mcl-1a shows the highest homology to rat Mcl-1 and contains several conserved BH domains of the Bcl-2 family proteins. It also contains a nuclear localization signal (NLS). Using EGFP reporter analysis, we verified the nuclear localization of zfMcl-1a. Deletion of the NLS resulted in distribution of the fusion protein in the cytoplasm. Northern blot analysis indicated that zfMcl-1a mRNA is 1.5 kb and was expressed in oocytes and throughout embryonic development. Notably, the expression of zfMcl-1a transcript was significantly downregulated during gastrulation. These results suggest that zfMcl-1a is a novel nuclear Bcl-2 family protein and is likely to play an important role in zebrafish oogenesis and embryogenesis. © 2000 Academic Press Key Words: apoptosis; Bcl-2 family proteins; nuclear Mcl-1; zebrafish; embryogenesis.

Apoptosis is essential to normal embryonic development. In vertebrates, apoptosis functions in sculpturing organs, deleting unwanted structures, adjusting cell numbers and eliminating nonfunctional, harmful, abnormal, or misplaced cells (1, 2). Studies aiming to uncover the underlying molecular basis of apoptosis have identified many apoptotic genes from diverse organisms. Sequence comparison analysis and functional studies indicated that the molecules and regulation modes of apoptosis have been well preserved during The DNA sequence reported in this paper has been deposited to the GenBank under Accession No. AF302805. 1 To whom correspondence should be addressed. Fax: ⫹886 (2) 27824595. E-mail: [email protected].

evolution (3–5). Among these apoptotic regulators, the Bcl-2 family proteins are the best characterized. Recent gene-targeting studies in mice demonstrated that the Bcl-2 family proteins are key regulators in embryonic apoptosis, and they are essential to normal embryonic development (2, 6 –10). Bcl-2 family proteins occupy a key position in apoptotic signaling pathways linking various upstream cell death signals to a group of common downstream effectors (11, 12). This still growing protein family contains members of opposing activities, and is characterized structurally by the possession of at least one of the four conserved motifs (the Bcl-2 homology domains, BH1-4) (3, 13). The location of BH domains corresponds to ␣-helical segments of the molecule (3). Many Bcl-2 family proteins also contain a putative transmembrane domain (TM) at their C-termini, and at least to Bcl-2, the TM domain is critical for both its subcellular localization and apoptotic activity (3, 14, 15). Members of the Bcl-2 family have been divided into three subfamilies: the Bcl-2 subfamily, the Bax subfamily and the BH3-only subfamily (3). Proteins of the Bcl-2 subfamily are all anti-apoptotic. Their BH domains share higher homology to Bcl-2 protein than members in the other two subfamilies. Both the Bax and the BH3-only subfamilies are composed of proapoptotic proteins. As implied by its name, proteins of the BH3-only subfamily only contain a recognizable domain that shares significant sequence homology to the BH3 domain of Bcl-2 protein. High degree of homology in the BH domains foretells their importance. Mutagenesis analyses established a requirement for BH domains in protein-protein interaction both within and out of the Bcl-2 protein family and this BH-mediated interaction is critical for proteins of the Bcl-2 family to exert their function. For instance, BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax (16). BH 3 domain was shown to be essential for

725

0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

proteins of the BH 3-only subfamily to both heterodimerize with anti-apoptotic Bcl-2 family members and exert their killing activity (17). BH 4 domain is essential to the heterodimerization between Bcl-2 and Bax, and disruption of this interaction abolishes the inhibitory effect of Bcl-2 on the killing activity of Bax (18). Finally, BH4 domain was speculated to play a regulatory role in apoptosis since it has been shown to serve as a docking site for several signaling molecules (19 –21). The expression of Bcl-2 family proteins is subject to multiple regulations. In various model systems, cytokines induce transcriptionally the expression of several antiapoptotic Bcl-2 family proteins (23–26). Posttranslational levels of regulation such as phosphorylation, degradation, and proteolytic cleavage have been shown to influence the activity of several Bcl-2 family proteins (27–31). Finally, subcellular localization serves another level of regulation on the activity of Bcl-2 family proteins. The proapoptotic protein Bim is sequestered to microtubules and kept inactive through the binding of LC8 dynein light chain (32), and Bax translocates from cytosol to mitochondria after cells received apoptotic stimuli (33). Members of the Bcl-2 family have also been shown to distribute to other subcellular compartments, such as endoplasmic reticulum (ER), nuclear membrane, and cytosol (28, 33, 34), but the significance of such localization is so far unclear. To further our understanding of the function and regulation of apoptosis in normal vertebrate embryonic development, we have chosen to study embryonic apoptosis in the zebrafish, Danio rerio, because it has high fecundity, large and transparent embryos, characters that will facilitate embryonic studies. Furthermore, recent observations indicate that zebrafish expresses a variety of apoptotic genes (35), and is capable of launching apoptotic response upon genetic insults (36) and cytotoxic treatments (37, 38). As the first step toward the above stated goal, here we report the cloning and characterization of the first zebrafish Bcl-2 family protein, zfMcl-1a.

al. (40) with modifications. The sense primers (NWG-1, AAC/ TTGGGGIA/CGIA/GTIGTIGC and NWG-2, AAC/TTGGGGIA/CGIA/ GTA/T/C/GGTA/T/C/GGC) were designed against the conserved BH1 domain (NWGRI/V/MVA). The antisense primers (GGW-1, TCA/ GAAIC/GCITCCCAICCICC and GGW-2, TCA/GAAIC/GCITCCCAA/ T/C/GCCA/T/C/GCC) were designed against the conserved BH2 domain (GGW/D/EA/GFE). Total RNA was extracted from dechorionated zebrafish embryos using Trizol reagent (Life Technologies) and then reverse transcribed by Superscript II reverse transcriptase (Life Technologies). Two micrograms of total RNA was used as template for first strand cDNA synthesis in a 20-␮l RT reaction primed with oligo(dT) 12–18 primer (Promega). The RT reaction was allowed to proceed for 2 h at 42°C, and then stopped by heating at 70°C for 15 min. One tenth of the RT products was used as template for PCR amplification of the target sequence. The PCR reaction was composed of 2 ␮l RT products, 5 ␮l 10⫻ buffer (Clontech), 25 pmol of each sense and antisense primers, 200 ␮M dNTPs (Promega), and 0.5 ␮l Advantage cDNA polymerase mix (Clontech) in a 50-␮l reaction volume. A “step down” thermal cycling strategy was used. Each thermal cycle was composed of a 20-s denaturation step at 94°C, a 30-s annealing step at decreasing temperature starting from 67 to 55°C at the speed of 3 degree every two cycles, and a 30-s extension step at 72°C. After an initial 2-min denaturation, PCR was allowed to proceed as programmed above. Once the annealing temperature has dropped to 55°C, the PCR was allowed to proceed for another 32 cycles with the same cycling parameters and a constant 55°C annealing temperature. The PCR was concluded by a final 3-min extension step. Five microliters of each PCR reaction was analyzed by electrophoresis, and agarose plugs containing products with size close to 180 bp were excised from the gel and directly used as template for another round of PCR amplification. The PCR products were eluted from agarose using QIAquick gel extraction system (Qiagen), blunted by Pfu DNA polymerase (Stratagene) at 72°C for 30 min, and subcloned using Zero Blunt TOPO PCR cloning system (Invitrogen). The cloned PCR products were sequenced by dye termination method using ABI PRISM 377 DNA sequencer (PE Biosystems), and scanned against the GenBank database by use of the BLAST program. One of them, denoted as ZM5-1, whose sequence closely resembled human Mcl-1 (human myeloid cell leukemia-1 (40), was used to clone longer cDNAs. A 24-h zebrafish embryo cDNA library (Stratagene) was screened using 32P-labeled ZM5-1 (rediprime II, Amersham Pharmacia Biotech) following standard procedures (41). Insert cDNAs were prepared by in vivo excision procedure according to the instruction of the manufacturer (Stratagene) and sequenced on both strands. The primary sequences of the cDNAs were analyzed using various computer programs, including BLAST (42), PESTfind (43), PSORT II (44), while its secondary structure was analyzed by using PHD program (45– 46). Multiple alignments were performed with CLUSTAL W version 1.6 (47). The graphic presentations were prepared with GenDoc (48).

MATERIALS AND METHODS

EGFP reporter analysis of zfMcl-1a subcellular distribution. The expression construct encoding N-terminal EGFP-tagged zfMcl-1a was constructed in two steps. First, the coding sequence of zfMcl-1a was PCR-amplified from pzfMcl-1a (zfMcl-1a cDNA in pBluescript) using the sense primer, CGGAATTCTATGGCT TTGAGTTTGGATT (EcoRI site is underlined, the start codon of zfMcl-1a was in bolded letter) and the universal T7 primer (Promega). Then, after restriction digestion with EcoRI and KpnI, the PCR product was ligated with identically predigested pEGFP-C1 vector (Clontech) to create pEGFP-zfMcl-1a. The expression construct encoding fusion protein between EGFP and the zfMcl-1a variant with a deletion from aa 43 to 49 was constructed by a whole plasmid amplification strategy. First, the entire sequence of pEGFP-zfMcl-1a except for the region intended for deletion was PCR-amplified using the sense primer, CCGGGTACAAACGGCCTGAAG and the antisense primer, CGCCTCCTCCTCCTCAGTGTA. Then the linear PCR product was circularized by self-ligation to generate pEGFP-zfMcl-1⌬43– 49. Sequencing was performed to verify the intended deletion and the

Cells and fish. NIH3T3 cells were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml), streptomycin sulfate (100 ␮g/ml) at 37°C. ZFL cells were maintained in L15 supplemented with 10% FBS, penicillin (100 U/ml), streptomycin sulfate (100 ␮g/ml) at 28°C. Both types of cells were cultured in a humid incubator with 5% CO 2. The maintenance of adult zebrafish, generation of embryos, and determination of developmental stages of embryos are based on Westerfield (39). Cloning of zebrafish Mcl-1a cDNA and sequence analysis. To clone cDNAs for zebrafish Bcl-2 family proteins, degenerate RT-PCR (reverse transcription-polymerase chain reaction) was first conducted to generate short cDNA fragments coding for conserved protein regions among known Bcl-2 family proteins. Two pairs of degenerate primers were designed for the amplification based on Kiefer et

726

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

absence of any secondary mutations in the coding sequence of zfMcl-1a for both constructs. For cell transfection, both newly confluent NIH3T3 and ZFL cells were seeded at 2 ⫻ 10 5 cells to each well of a 6-well culture plate one day before transfection was conducted. Five micrograms of either pEGFP, pEGFP-zfMcl-1a, or pEGFPzfMcl-1-⌬43-49 were introduced into these cells using Lipofectamine 2000 (Life Technologies). Fluorescence microscopy (Olympus) using FITC filter was employed to visualize the expression of the EGFP fusion proteins. Northern blot analysis of embryonic expression of the zfMcl-1a mRNA. Total RNA was isolated from embryos as described above. Total oocyte RNA was extracted from oocytes collected from one sacrificed mature female. Stages of embryonic development were determined based on the criteria of Westerfield (39). Ten micrograms of total RNA were analyzed for each selected developmental stages. Northern blotting was performed based on Sambrook et al. (41) except that the RNA samples were fractionated in 1% native agarose gel. Prehybridization was done in a blocking solution (6⫻ SSC, 5⫻ Denhardt’s solution, 100 ␮g/ml sheared and denatured calf thymus DNA, 0.5% SDS) at 68°C for 1 h. After prehybridization, hybridization was initiated by addition of denatured, 32P-labeled zfMcl-1a probe prepared with rediprime II. Hybridization was allowed to proceed for more than 16 h at 68°C, after which the membrane was washed three times at 60°C for a total of 2 h with wash solution (0.1⫻ SSC, 0.1% SDS). The blot was autoradiographed at ⫺80°C against Kodak film to visualize the expression of zfMcl-1a mRNA.

RESULTS AND DISCUSSION To isolate zebrafish Bcl-2 family members, we designed degenerate PCR primers to amplify the conserved polypeptide region between the BH1 and BH2 domains of the Bcl-2 family proteins. We used cDNA derived from zebrafish total embryonic RNA as PCR template to increase chances of identifying Bcl-2 family proteins involved in zebrafish embryonic apoptosis. Sequence analysis of the PCR-amplified cDNA fragments revealed significant sequence homology to known Bcl-2 family proteins. One of the cDNA fragments, ZM5-1 was most closely related to human Mcl-1. To isolate cognate full-length cDNA for ZM5-1, a commercial zebrafish embryonic cDNA library was probed with isotope-labeled ZM5-1. A total of twelve ZM5-1-positive plaques were isolated from one million of plaque formation units after three round of plaque purification. Insert cDNAs were obtained from purified phage particles by in vivo excision procedure and sequenced on both strands. The longest cDNA was 1253 bp and contained a single open reading frame of 768 bp (bases 9 to 776) encoding a polypeptide of 255 residues, an 8-bp 5⬘ untranslated region (UTR) and a 477-bp 3⬘ UTR (Fig. 1). The first start codon was located in a favored location (49) preceeded by an upstream in-frame stop codon. Initial BLASTP search of GenBank database identified rat Mcl-1 as its closest relative, and therefore this protein was denoted as zebrafish Mcl-1 like protein 1 (zfMLP1). Later during the preparation of this report, BLASTP search showed that zfMLP1 was identical to a recently deposited protein sequence, zebrafish Mcl-1a (35, 40). We therefore renamed zfMLP1 as zebrafish Mcl-1a (zfMcl-1a) to comply with this recent

FIG. 1. The nucleotide and deduced amino acid sequences of zfMcl-1a. The amino acid sequence is shown below the nucleotide sequence in single letter code. The translation and stop codons are marked as bolded M and asterisk (*), respectively. The putative nuclear localization signal (aa 43– 49) is boxed. Two PEST sequences (aa 26 – 44 and 61– 86) are underlined. The putative transmembrane sequence is labeled with dashed line. Two polyadenylation signals (nt 952–957 and 1205–1210) are double-underlined.

report. Primary sequence analyses of zfMcl-1a identified two PEST sequences (43), one putative nuclear localization signal (NLS) and one transmembrane sequence (TM) (44), and two consensus polyadenylation signals (Fig. 1). Secondary structure analysis using PHD program (45– 46) predicted that zfMcl-1a contained seven ␣-helices, and when combined with sequence alignment analysis, three BH domains (1 through 3) could be located to corresponding helix counterparts as in other Bcl-2 family proteins (Fig. 2A). Although a BH4 domain has been suggested to reside in the N-terminal region of mammalian Mcl-1 proteins (50), we did not find clear sequence homology to the BH4 domain of

727

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

728

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. Northern blotting analysis of zfMcl-1a gene expression at selected developmental stages. The results of zfMcl-1a and zEF1-␣ transcript expression are shown on the top and middle panels, respectively. The zfMcl-1a mRNA signals were a result of a 20-h exposure, and the zEF1-␣ mRNA signals were obtained after a 1.5-h exposure. The bottom panel showed the ethidium bromide-stained image of electrophoresed total RNA. The 28 and 18S rRNA bands are indicated with arrows. RNA size markers are indicated on the right. Developmental stage denotation: O, oocyte; C, cleavage; B, blastula; G, gastrula; Se, early somite (3–5 somites); Sl, late somite (⬃20 somites); P, pharyngula; H, hatching.

Bcl-2 in zfMcl-1a, nor in other Mcl-1 proteins. However, the PHD program did predict with high confidence an ␣-helix, not corresponding to any BH domains, in the N-terminal half of zfMcl-1a protein (aa 85 through 95). The ␣-helix sequence of zfMcl-1a sequence was quite divergent from the rest of the Mcl-1 class proteins (Fig. 2B). Therefore, whether or not this region constitutes a functional element remains to be determined. Finally, compared with mammalian Mcl-1 proteins, zfMcl-1a has a very short N-terminal region, and was 40% identical to human Mcl-1, 39% to mouse Mcl-1, 39% to rat Mcl-1, and 36% to chicken Mcl-1 with expected higher sequence identity in BH domains (Fig. 2B). Overall, the above analyses suggested that zfMcl-1a is a novel member of the Mcl-1 protein class, and like other Bcl-2 family proteins, performs its apoptotic function through BH domain-mediated dimerization. Moreover, the analyses also suggested that zfMcl-1a activity might be regulated through mechanisms quite different from those for BH4 domainbearing Bcl-2 family proteins and even its class relatives. The embryonic expression pattern of zfMcl-1a transcript was analyzed by Northern blotting. As shown in Fig. 3, zebrafish mcl-1a was expressed as a single species of transcript of ⬃1.5 kb in size. This indicated that the cloned zfMcl-1a cDNA is near full length. Figure 3 also showed that zfMcl-1a mRNA was highly expressed

during zebrafish embryonic development and its detection in unfertilized eggs suggested a maternal origin. The amount of zfMcl-1a mRNA, as reflected by the specific signal intensity, was quite high during the very early stages of embryonic development, then it gradually decreased over time and dropped to the lowest level at the gastrula stage. Thereafter, the abundance of zfMcl-1a mRNA increased again, and remained at relatively constant levels until the hatching stage. It has been established that the genome of zebrafish embryo becomes activated after the MBT (midblastula transition, ⬃4 h postfertilization) to compensate for the loss of developmentally essential mRNAs of maternal origin. It is therefore important to note that the levels of zfMcl-1a mRNA remain low even at the gastrula stage. The low expression level of zfMcl-1a at the gastrula stage was not a result of general RNA degradation, since zebrafish elongation factor 1 ␣ mRNA was expressed at high level as expected (Fig. 3, middle panel), and both 18 and 28s rRNAs were intact as indicated by the sharp RNA bands (Fig. 3, bottom panel). The low expression of zfMcl-1a at gastrula stage suggests that it may be a candidate of negative regulator of apoptosis. Ikegami et al. showed that embryonic apoptosis abruptly becomes activated at gastrula stage in zebrafish (38). The authors suggested, among other possibilities, that a maternally supplied negative regulator might inhibit apoptosis induction during early embryonic development (38). It was further proposed that down-regulation of this negative regulator, for instance through RNA degradation and/or transcription suppression of the embryonic gene, would then allow the embryo to activate apoptosis pathways during the gastrula stage to remove damaged cells (38). Our observation that zebrafish Mcl-1a mRNA expression experienced a gradual down-regulation after fertilization through the gastrula stage, which correlates with the time course of the embryonic apoptosis, provides a possible basis for the molecular mechanism underlying this developmentally programmed embryonic apoptosis. More experiments are needed to determine the consequences of low zebrafish Mcl-1a mRNA levels on normal zebrafish embryonic development, and whether or not zfMcl-1a plays a role in the developmentally programmed embryonic apoptosis described above.

FIG. 2. (A) Predicted secondary structure of zfMcl-1a protein. The primary sequence of zfMcl-1a protein is shown in single letter code. Domain structures are boxed and labeled with bolded letters on the top. Amino acid residues predicted to form helices are indicated with (H) below the primary sequence and the seven predicted helices (␣ 1–7) are labeled with bolded letters. The asterisk (*) on the bottom row indicated the high confidence levels of the PHD prediction. (B) Alignment of the amino acid sequences of the Mcl-1 class proteins. BH domains are underlined and indicated below in bolded letters. Amino acid residues identical between class members are indicated in black ground, while residues conserved in most of the members are presented in gray background. GenBank Accession Nos.: human Mcl-1, AF118124; mouse Mcl-1, U35623; rat Mcl-1, AF115380; chicken Mcl-1, AF120210; and zebrafish Mcl-1a, AF231016 and AF302805. 729

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 4. EGFP reporter analysis of zfMcl-1a intracellular localization. Fluorescent images were taken directly from the transfected zebrafish liver cell lines (ZFL cells) in culturing dishes without prior processing. (A, A⬘) ZLE cells transfected with pEGFP-C1. (B, B⬘) ZFL cells transfected with pEGFP-zfMcl-1a. (C, C⬘) ZFL cells transfected with pEGFP-zfMcl-1⌬43– 49. A, B, and C are phase contrast images. A⬘, B⬘, and C⬘ are EGFP fluorescent images.

To obtain clues on how zfMcl-1a functions during zebrafish embryogenesis, we set out to determine the subcellular localization pattern for zfMcl-1a. As described early on, the PSORT II program has predicted a putative NLS (aa 43 through 49) in zfMcl-1a protein sequence (Fig. 1). Since an intranuclear localization has not previously been described for any Bcl-2 family proteins, we were interested to find out whether zfMcl-1a is indeed a nuclear protein. To do so, an expression plasmid, pGFP-zfMcl-1a expressing EGFPzfMLP1 fusion protein was constructed and then introduced into both mammalian (NIH3T3) and zebrafish (ZFL) cultured cells by liposome-mediated transfection. The intracellular location of the fusion protein in living cells was then directly monitored by fluorescence microscopy. As shown in Figs. 4B and 4B⬘, ZFL cells transfected with pEGFP-zfMcl-1a displayed a clear nuclear EGFP fluorescence with minor cytosolic EGFP fluorescence. However, ZFL cells transfected with pEGFP-C1 displayed a ubiquitous intracellular EGFP fluorescence (Figs. 4A and 4A⬘). Similar observations were also made in NIH3T3 cells (unpublished results). Therefore, zfMcl-1a is indeed a nuclear protein. We then tested whether the PSORT-predicted NLS (aa 43– 49) is a prerequisite of zfMcl-1a nuclear localization by introducing an aa 43– 49 deleted EGFP-

zfMcl-1a variant into cultured cells, and then determine the intracellular location of the EGFP-zfMcl-1a variant by monitoring EGFP fluorescence. As shown in Figs. 4C and 4C⬘, ZFL cells transfected with pEGFPzfMcl-1⌬43– 49 expressed predominantly cytosolic EGFP fluorescence with very faint nuclear EGFP fluorescence. Clearly, aa 43– 49 were essential to the nuclear translocation of zebrafish Mcl-1a. As far as we are aware, zfMcl-1a is the first Bcl-2 family protein with nuclear translocation. More experiments are needed to understand the biological meaning of this unique localization of zfMcl-1a. In conclusion, we have cloned and characterized a novel member of the Mcl-1 class of the Bcl-2 family from the zebrafish, Danio rerio. This protein, denoted as zfMcl-1a, was unique in the following aspects. First, compared with other Mcl-1 proteins, zfMcl-1a has a very short N-terminal region. Second, although it probably does not have a BH4 domain, it contains a predicted ␣ helix at aa 85–95, which might define another functional element in zfMcl-1a. And finally, zfMcl-1a is the only known nuclear Bcl-2 family protein. Together with the embryonic expression pattern of zfMcl1 mRNA, our data suggested that zfMcl1 is likely to be an important apoptotic regulator during normal zebrafish embryonic development. Further experiments

730

Vol. 279, No. 2, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

are underway to determine the role of zfMcl-1a in zebrafish embryogenesis. 23.

ACKNOWLEDGMENTS The authors are grateful to Dr. A. F. Knowles (San Diego State University, CA) and Dr. C.-F. Weng (National Dong Hwa University, Taiwan, ROC) for their comments on the manuscript, Ms. C.-C. Lin for the DNA sequencing work at Academia Sinica, Ms. M.-H. Wu for her secretarial assistance, and J.-F. Lin for his assistance on format converting. We also thank all colleagues in the Laboratory of Marine Biology and Marine Biotechnology, Institute of Zoology, Academia Sinica, for their assistance and suggestions. This work was supported by a grant from the National Science Council (NSC89-2311B-001-055), Taiwan, R. O. C., to Dr. Jen-Lieh Wu.

24.

REFERENCES

28.

1. Jacobson, M. D., Weil, M., and Raff, M. C. (1997) Cell 88, 347– 354. 2. Vaux, D. L., and Korsmeyer, S. J. (1999) Cell 96, 245–254. 3. Adams, J. M., and Cory, S. (1998) Science 281, 1322–1326. 4. Korsmeyer, S. J. (1999) Cancer Res. 59, 1693S–1700S. 5. Tsujimoto, Y., and Shimizu, S. (2000) FEBS Lett. 466, 6 –10. 6. Veis, D. J., Sorenson, C. M., Shutter, J. R., and Korsmeyer, S. J. (1993) Cell 75, 229 –240. 7. Motoyama, N., Wang, F. P., Roth, K. A., Sawa, H., Nakayama, K., Nakayama, K., Negishi, I., Senju, S., Zhang, Q., Fujii, S., and Loh, D. Y. (1995) Science 267, 1506 –1510. 8. Print, C. G., Loveland, K. L., Gibson, L., Meehan, T., Stylianou, A., Wreford, N., de Kretser, D., Metcalf, D., Kontgen, F., Adams, J. M., and Cory, S. (1998) Proc. Natl. Acad. Sci. USA 95, 12323– 12431. 9. Ross, A. J., Waymire, K. G., Moss, J. E., Parlow, A. F., Skinner, M. K., Russell, L. D., and MacGregor, G. R. (1998) Nat. Genet. 18, 251–256. 10. Knudson, C. M., Tung, K., Tourtellotte, W. G., Brown, G., and Korsmeyer, S. J. (1995) Science 270, 96 –99. 11. Green, D. R., and Reed, J. C. (1998) Science 281, 1309 –1312. 12. Dragovich, T., Rudin, C. M., and Thompson, C. B. (1998) Oncogene 17, 3207–3213. 13. McDonnell, J. M., Fushman, D., Milliman, C. L., Korsmeyer, S. J., and Cowburn, D. (1999) Cell 96, 625– 634. 14. Nguyen, M., Branton, P. E., Walton, P. A., Oltvai, Z. N., Korsmeyer, S. J., and Shore, G. C. (1994) J. Biol. Chem. 269, 16521– 16524. 15. Nguyen, M., Millar, D. G., Yong, V. W., Korsmeyer, S. J., and Shore, G. C. (1993) J. Biol. Chem. 268, 25265–25268. 16. Yin, X. M., Oltvai, Z. N., and Korsmeyer, S. J. (1994) Nature 369, 321–323. 17. Kelekar, A., Chang, B. S., Harlan, J. E., Fesik, S. W., and Thompson, C. B. (1997) Mol. Cell Biol. 17, 7040 –7046. 18. Hirotani, M., Zhang, Y., Fujita, N., Naito, M., and Tsuruo, T. (1999) J. Biol. Chem. 274, 20415–20420. 19. Wang, H. G., and Reed, J. C. (1998) Biofactors 8, 13–16. 20. Wang, H. G., Takayama, S., Rapp, U. R., and Reed, J. C. (1996) Proc. Natl. Acad. Sci. USA 93, 7063–7068. 21. Shibasaki, F., Kondo, E., Akagi, T., and McKeon, F. (1997) Nature 386, 728 –731. 22. Sattler, M., Liang, H., Nettesheim, D., Meadows, R. P., Harlan,

29.

25.

26.

27.

30. 31. 32. 33. 34.

35. 36. 37. 38. 39. 40. 41.

42. 43. 44. 45. 46. 47. 48. 49. 50.

731

J. E., Eberstadt, M., Yoon, H. S., Shuker, S. B., Chang, B. S., Minn, A. J., Thompson, C. B., and Fesik, S. W. (1997) Science 275, 983–986. Pugazhenthi, S., Nesterova, A., Sable, C., Heidenreich, K. A., Boxer, L. M., Heasley, L. E., and Reusch, J. E. (2000) J. Biol. Chem. 275, 10761–10766. Aronica, M. A., Goenka, S., and Boothby, M. (2000) Cytokine 12, 578 –587. Pugazhenthi, S., Miller, E., Sable, C., Young, P., Heidenreich, K. A., Boxer, L. M., and Reusch, J. E. (1999) J. Biol. Chem. 274, 27529 –27535. Tamatani, M., Che, Y. H., Matsuzaki, H., Ogawa, S., Okado, H., Miyake, S., Mizuno, T., and Tohyama, M. (1999) J. Biol. Chem. 274, 8531– 8538. Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S. J. (1996) Cell 87, 619 – 628. Yang, T., Kozopas, K. M., and Craig, R. W. (1995) J. Cell Biol. 128, 1173–1184. Chao, J. R., Wang, J. M., Lee, S. F., Peng, H. W., Lin, Y. H., Chou, C. H., Li, J. C., Huang, H. M., Chou, C. K., Kuo, M. L., Yen, J. J., and Yang-Yen, H. F. (1998) Mol. Cell Biol. 18, 4883– 4898. Yang, T., Buchan, H. L., Townsend, K. J., and Craig, R. W. (1996) J. Cell Physiol. 166, 523–536. Slee, E. A., Keogh, S. A., and Martin, S. J. (2000) Cell Death Differ. 7, 556 –565. Puthalakath, H., Huang, D. C., O’Reilly, L. A., King, S. M., and Strasser, A. (1999) Mol. Cell 3, 287–296. Khaled, A. R., Kim, K., Hofmeister, R., Muegge, K., and Durum, S. K. (1999) Proc. Natl. Acad. Sci. USA 96, 14476 –14481. Hale, A. J., Smith, C. A., Sutherland, L. C., Stoneman, V. E. A., Longthorne, V. L., Culhane, A. C., and Williams, G. T. (1996) Eur. J. Biochem. 236, 1–26. Inohara, N., and Nunez, G. (2000) Cell Death Differ. 7, 509 –510. Rodriguez, M., and Driever, W. (1997) Biochem. Cell Biol. 75, 579 – 600. Ikegami, R., Zhang, J., Rivera-Bennetts, A. K., and Yager, T. D. (1997) Zygote 5, 329 –350. Ikegami, R., Hunter, P., and Yager, T. D. (1999) Dev. Biol. 209, 409 – 433. Westerfield, M. (1994) The Zebrafish Book, 3rd ed., University of Oregon Press, Eugene, OR. Kozopas, K. M., Yang, T., Buchan, H. I., Zhou, P., and Craig, R. W. (1993) Proc. Natl. Acad. Sci. USA 90, 3516 –3520. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403– 410. Rechsteiner, M., and Rogers, S. W. (1996) Trends Biochem. Sci. 21, 267–271. Nakai, K., and Horton, P. (1999) Trends Biochem. Sci. 24, 34 –35. Rost, B., and Sander, C. (1993) J. Mol. Biol. 232, 584 –599. Rost, B., and Sander, C. (1994) Proteins 19, 55–77. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673– 4680. Nicholas, K. B., and Nicholas, H. B., Jr. (1997) Distributed by the author, cris.com/⬃ketchup/genedoc.shtml (internet). Kozak, M. (1987) Nucleic Acids Res. 15, 8125– 8148. Okita, H., Umezawa, A., Suzuki, A., and Hata, J. (1998) Biochim. Biophys. Acta 1398, 335–341.