Cloning and characterization of endolysin and holin from Streptomyces avermitilis bacteriophage phiSASD1 as potential novel antibiotic candidates

Journal Pre-proofs Cloning and characterization of endolysin and holin from Streptomyces avermitilis bacteriophage phiSASD1 as potential novel antibiotic candidates Nana Lu, Yanmei Sun, Qingqin Wang, Yi Qiu, Zhi Chen, Ying Wen, Shiwei Wang, Yuan Song PII: DOI: Reference:

S0141-8130(19)35228-6 https://doi.org/10.1016/j.ijbiomac.2019.10.065 BIOMAC 13559

To appear in:

International Journal of Biological Macromolecules

Received Date: Revised Date: Accepted Date:

8 July 2019 5 October 2019 6 October 2019

Please cite this article as: N. Lu, Y. Sun, Q. Wang, Y. Qiu, Z. Chen, Y. Wen, S. Wang, Y. Song, Cloning and characterization of endolysin and holin from Streptomyces avermitilis bacteriophage phiSASD1 as potential novel antibiotic candidates, International Journal of Biological Macromolecules (2019), doi: https://doi.org/ 10.1016/j.ijbiomac.2019.10.065

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 The Authors. Published by Elsevier B.V.

Cloning and characterization of endolysin and holin from Streptomyces avermitilis bacteriophage phiSASD1 as potential novel antibiotic candidates Nana Lua,1, Yanmei Sunb,1, Qingqin Wanga, Yi Qiu a,c, Zhi Chena, Ying Wena, Shiwei Wangb,*, Yuan Songa,* a

Key Laboratory of Soil Microbiology, Ministry of Agriculture, College of Biological

Sciences, China Agricultural University, Beijing, 100193, China b Key

Laboratory of Resources Biology and Biotechnology in Western China, Ministry

of Education, College of Life Science, Northwest University, Xi’an, ShaanXi, 710069, China c Zhongshan 1

School of Medicine, Sun Yat-Sen University, Guangzhou, China

These authors have equally contributed to work.

*Corresponding authors Shiwei Wang, Key Laboratory of Resources Biology and Biotechnology in Western China, Ministry of Education, College of Life Science, Northwest University, Xi’an, ShaanXi, 710069, China. Phone, +86-10-62731329. Email: [email protected]. Yuan Song, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District,

Beijing,

100193,

China.

Phone,

[email protected].

1

+86-10-62731329.

Email:

Abstract Bacteriophages (phages), or bacterial viruses, have recently received increasing attention, especially considering pan-drug-resistant bacteria, and studies on lytic bacteriophage proteins would help develop antibiotic candidates to treat these bacterial infections. We previously isolated and sequenced a Streptomyces avermitilis bacteriophage, phiSASD1. This study aimed to clone and express ORF40 and ORF19, previously predicted as endolysin (termed LytSD) and holin (termed HolSD), two crucial phage proteins involved in host lysis. The yield of LytSD was 17.2 mg per liter of culture, and the optimal lysis conditions were investigated. When applied exogenously, LytSD lysed 7/18 of the tested bacterial strains, including S. avermitilis, Bacillus subtilis, Staphylococcus aureus, Sarcina lutea, and Enterococcus faecalis. As regards HolSD, it resulted in growth inhibition of several tested strains and abrupt lysis of E. coli BL21 (DE3) pLysS; furthermore, it complemented the defective λ S allele of non-suppressing E. coli strains to produce phage plaques. Together, these results indicate the function of ORF40 and ORF19 of phage phiSASD1 and their potentials as novel antibiotics to inhibit or lyse pathogens.

Keywords: Streptomyces avermitilis; Bacteriophage phiSASD1; Antibiotics; Holin; Endolysin; Lysis

2

1. Introduction

In recent decades, with the rise of bacterial antibiotic resistance, bacteriophages (phages), that infect and kill bacteria, are attracting more and more attention, and researches have begun to use phages or some lytic enzyme from phages to treat these infections [1-3]. However, although phage therapy has many potential applications in human medicine, veterinary health, and agriculture, the use of phages for antibacterial agents has limitations due to narrow host specificity and the potential development of phage resistance [4, 5]. In contrast, lytic enzymes from phages have many advantages. Besides broader substrate range and different physicochemical property, the application of lytic enzymes from phages does not lead to resistance development [6]. Endolysin and holin, two vital phage proteins involved in its host lysis, are the most commonly used lytic enzymes. Endolysins can hydrolyze bacterial peptidoglycan after phage replication to release new phage particles from host cells [7, 8]. In general, endolysins are classified into five groups based on their specificity, including muramidases, glucosidases, amidases, endopeptidases, and carboxypeptidases, which can degrade cell wall from different bacteria [6]. Recent research has shown that endolysin application is a practical approach to control bacterial infections, including multidrug-resistant strains, and therefore endolysins are candidates for active antibacterial agents [9-13]. Beside endolysin, another essential small hydrophobic protein to control host lysis is called holin, which coordinately acts with endolysin to result in well-timed, rapid host cell lysis [14]. Holin can regulate the timing of phage infection cycles and lyse 3

host cells at the optimal timepoint; hence, it is also referred to as “the clock to control phage infection” [15]. It is known that holins do not share sequence similarity, but they do have some common characteristics. Firstly, most holins are encoded by the gene adjacent to the endolysin gene. Secondly, at least one hydrophobic transmembrane domain (TMD) is present in all holins. Thirdly, holins have a highly charged, hydrophilic, C-terminal domain. By identifying these characteristics, it is possible to predict putative holins [16]. Moreover, holins have been studied as potential therapeutics in experimental model systems [17, 18]. Although some endolysins and holins from pathogen phages have been used to control antibiotic-resistant bacteria as antibacterial compounds, to date, only few studies on endolysins and holins from Streptomyces phages have been reported [19-22]. In a previous study, we isolated and sequenced a S. avermitilis phage phiSASD1 [23]. Its forty-three open reading frames (ORFs) were identified, and ORF40 and ORF19 were predicted as endolysin (termed LytSD) and holin (termed HolSD), respectively. However, their function was not studied. In this study, the endolysin and holin genes both were cloned and expressed in Escherichia coli. Their biochemical properties of the produced proteins were characterized, and their function during bacterial lysis process was investigated. In addition, the antimicrobial activity of endolysin against different bacteria was analyzed. These data would help elucidate their fundamental biological function and emphasize their potential as novel antibiotic candidates.

4

2. Materials and methods

2.1. Bioinformatics analysis

The amino acid sequences of LytSD and HolSD of phage phiSASD1 were used as queries

to

search

the

non-redundant

database

using

BLASTP

[24].

ExPASy-Protparam tool (http://www.expasy.ch/tools/Protparam) was used to predict molecular weight and isoelectric point of LytSD and HolSD. A domain search was performed against the Pfam database [25] and the NCBI’s Conserved Domain Database [26]. Sequence alignments were generated using CLUSTAL W (http://www.ch.embnet.org/software/C-ustalW.htmL). Tertiary structure analysis was conducted using Swiss-Model online servers (http://swissmodel.expasy.org) [27]. TMHMM (http://www.cbs.dtu.dk/services/TMHMM/) was used to predict the transmembrane

helices

of

HolSD.

SignalP

4.0

(http://www.cbs.dtu.dk/services/SignalP/) was used to predict signal peptide.

2.2. Bacterial and phage culture

Bacterial strains used herein are listed in Supplementary Table 1. E. coli JM109 was used for cloning experiments and plasmid isolation, and E. coli BL21 (DE3) (Novagen, Germany) was used to produce recombinant proteins. Bacterial strains Streptomyces spp. were cultured in accordance with previously reported methods [23]. Other bacteria were cultivated in Luria–Bertani (LB) broth or agar at 37 ℃ [28]. Phage phiSASD1 was propagated using the host strain S. avermitilis ATCC31267 5

using the method of Wang et al [23].

2.3. DNA manipulation and cloning

Purified genomic DNA of phage phiSASD1 was used as a template for polymerase chain reaction (PCR) with corresponding primers (Table 1), using high-fidelity DNA polymerase on a T-Gradient thermal cycler (Whatman Biometra, Germany). PCR products were purified using a PCR Purification Kit (Novagen, Germany) and digested with appropriate restriction enzymes (Table 1). Next, the fragments containing the lytSD gene were ligated into the expression vector pET28a+ (Novagen, Germany) and pColdⅡ (TaKaRa, Japan), respectively. The resulting plasmid was designated as pET-SDlysin and pColdII-endolysin, respectively; the fragments containing the holSD gene were ligated into the expression vector pGEX-4T-1 (GE Healthcare, USA), and the resulting plasmid was designated as GST-holin. Transformants were selected on LB agar supplemented with 50 μg/mL kanamycin and/or 100 μg/mL ampicillin (Sangon Biotech, China). The constructed plasmids pColdII-endolysin and GST-holin were transformed into competent E. coli BL21 (DE3) for expression, respectively. All cloned fragments were verified via sequencing analysis (Biomed, China).

2.4. Protein production and purification of recombinant LytSD/HolSD of phage phiSASD1

E. coli BL21 (DE3) strain, harboring the plasmid pColdII-endolysin/GST-holin, 6

was grown overnight in LB medium containing 100 μg/mL ampicillin at 37 °C. The culture was diluted into a fresh medium and grown to the mid-exponential phase at 37 °C. Expression of the recombinant LytSD was induced with 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and the culture was harvested after incubation for an additional 24 h at 15 ℃. Expression of recombinant HolSD was induced with 0.2 mM IPTG, followed by incubation at 30 ℃ and samples were collected at 0, 30, 60, 90, 120, 150, and 180 min after induction. Next, the bacterial cell pellet was centrifuged at 15, 000 × g for 15 min and resuspended in a lysis buffer (0.5 M NaCl, 20 mM NaH2PO4, pH 7.4). The cell lysate was further disrupted via freeze-thawing (liquid nitrogen/37 ℃) and sonication (50 cycles of 30-s pulses with 30-s intervals). The recombinant protein was purified using Ni2+-NTA column with a washing buffer (0.5 M NaCl, 20 mM NaH2PO4, pH 7.4) with protein-dependent imidazole concentrations. The concentrated protein was further purified using HiLoad 16/60 superdex 75 (GE Healthcare) gel filtration columns to eliminate salt ions and residual imidazole. The purity of the recombinant protein was assessed via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins bands were visualized with Coomassie brilliant blue R-250 (Biorad, USA) [29]. Protein concentrations were determined spectrophotometrically at 280 nm after dialyzing against phosphate-buffered saline buffer (PBS, pH 7.4).

2.5. Western blotting analysis

Western blotting was performed on purified pColdII-endolysin to detect the 7

production of LytSD. Cultures of E. coli BL21 (DE3) (pColdII) were collected as a negative control after 24 h induction at 15 °C. Proteins separated via SDS-PAGE were analyzed using western blotting. In brief, after electro-transferring proteins on a nitrocellulose membrane, the His-Tag sequence was identified via an immunoreaction with a monoclonal anti-His-Tag antibody (Novagen) and goat anti-mouse IgG-alkaline phosphatase conjugate (Novagen) as the secondary antibody.

2.6. Co-expression of holSD and lytSD in E. coli

The constructed plasmids pET-SDlysin and GST-holin were transformed together into competent E. coli BL21 (DE3) cells and grown in LB medium containing 100 μg/mL of ampicillin and 50 μg/mL kanamycin at 37 °C overnight. Strains were diluted (1:100) with fresh medium and cultured to an OD600 of 0.6. Next, they were treated with 0.2 mM IPTG at 30 °C, and OD600 values were measured every 10 min for 120 min. The E. coli BL21 (DE3) strains harboring plasmid combinations pET-28a+GST-holin and plasmid combinations pETSDlysin+pGEX-4T-1 were used as controls.

2.7. Effect of HolSD on bacterial growth

To examine the effect of HolSD on the growth of different E. coli strains, the constructed plasmid GST-holin was transformed into competent E. coli JM109, TOP10, DH5α, Rosseta (DE3), and BL21 (DE3) pLysS in LB broth containing 100 μg/mL ampicillin at 37 °C overnight. Strains were diluted (1:100) in fresh medium 8

and cultured to an OD600 of 0.6. Next, they were treated with 0.2 mM IPTG at 30 °C, and OD600 values were measured at various times. Controls were set and treated as above, except that IPTG was not added. Besides, we examined the survival rate of HolSD on the E. coli BL21 (DE3) pLysS, which was the most sensitive to GST-holin among these strains. In brief, samples collected at different times were diluted to 10-5, and then 100 μL samples were plated on LB agar, and cultured at 37 °C for 24 h. Finally, the number of surviving bacteria was counted. E. coli BL21 (DE3) pLysS with the empty vector plasmid pGEX-4T-1 was set as a control, and the strain with GST-holin and without IPTG induction was also set as a control.

2.8. Transmission electron microscopy (TEM) observation of bacteria

E. coli BL21 (DE3) pLysS carrying either the plasmid pGEX-4T-1 or GST-holin was grown in LB broth containing 100 μg/mL ampicillin at 37 ℃. When the OD600 of the culture reached 0.4–0.6, IPTG was added to a final concentration of 0.2 mM, and the growth temperature was adjusted to 30 ℃. After 90 min of induction, culture samples were collected every 30 min and centrifuged at 5,000 × g for 3 min to pellet cells. The pellets were re-suspended in 2.5% glutaraldehyde in 0.1 M PBS (pH 7.4), and cells were fixed at 4 °C for 30 min and centrifuged at 5,000 × g for 1 min. Thin sections of the cells were applied on carbon-coated grids and negatively stained with 1% uranyl acetate. Micrographs were taken with a Hitachi H-7650 electron microscope, operating at 80 kV at magnifications ranging from 8,000× to 20,000×.

2.9. Complementation of λ Sam7 lysis function 9

Complementation of λ Sam7 lysis function was assessed using the method of Shi et al [16]. In brief, the constructed plasmid GST-holin was transformed into competent E. coli BL21 (DE3) pLysS and BL21 (DE3). Next, they were inoculated and cultured to an OD600 of ~ 0.6 in LB broth with 100 μg/mL ampicillin at 37 ℃. A culture of 200 μL of E. coli BL21 (DE3) pLysS/BL21 (DE3) was infected at 37 ℃ for 15 min with 10 μL phage λ Sam7 (106 plaque-forming units/mL). E. coli BL21 (DE3) pLysS/BL21 (DE3) cells and phages were mixed with 5 mL soft agar containing 0.2 mM IPTG and 100 μg/mL ampicillin, which was then poured immediately onto LB-Amp plates. Cultures were maintained at 37 ℃, and the number of plaques was determined after overnight incubation. E. coli BL21 (DE3) pLysS and BL21 (DE3) transformed into the empty vector plasmid pGEX-4T-1 and E. coli LE392 were used as controls. Before culturing, freshly cultured E. coli LE392 was gently resuspended and diluted to an OD600 of 0.5 with 10 mM MgSO4 after centrifugation at 5,000 × g for 10 min at 25 ℃. The medium was not supplemented with antibiotics when culturing E. coli LE392.

2.10. LytSD stability assay

Enzymatic stability of LytSD was assessed using the turbidity reduction method as previously described [30]. Enzymatic activity of LytSD was determined by measuring OD600 decrease of cells after LytSD addition. In brief, S. aureus was cultured to the exponential phase. Cells were harvested and resuspended in the reaction buffer (50 mM Tris-HCl, pH 8.0) to adjust OD600 to 0.8–1.0. The LytSD solution (10 μL, 1.08 10

mg/mL) was added to the cell suspension (990 μL), followed by incubation at room temperature unless indicated otherwise. OD600 was measured after incubation for 30 min, and the lytic activity was calculated using the following equation: 100 × (OD600 of control without enzyme ‒ OD600 of the reaction mixture)/OD600 of control without enzyme. To evaluate the effect of different pH on LytSD enzymatic activity at 28 ℃, the following buffers were used for cell suspension instead of the Tris-HCl buffer: 20 mM sodium acetate for pH 4.2 and 5.2; 10 mM phosphate for pH 6.2; 10 mM PBS for pH 7.2; 20 mM Tris-HCl for pH 8.2; 20 mM glycine-NaOH for pH 9.2. Different temperatures (4, 16, 28, 37, 42, 65, and 80 °C) were applied to test the effect of temperature on the enzymatic activity of LytSD at pH 7.2. To evaluate the effect of three common molecular reagents and metal ions on LytSD enzymatic activity, LytSD was supplemented in cell resuspension cultures with three common molecular reagents ethylene diamine tetraacetic acid (EDTA) (1 and 10 mM), and 1,4-dithiothreitol (DTT) (1 and 10 mM), SDS (1 and 10 mM), and metal ions (NaCl, ZnCl2, MgCl2, MnCl2, CuCl2, PbCl2,CaCl2, FeCl3, or AlCl3; the concentration of NaCl was 50 and 100 mM, and the concentrations of other metal ions were 1 and 10 mM).

2.11. Antibacterial assays of LytSD

Eighteen bacterial strains were used to assess the antimicrobial spectrum (Table 3). Antibacterial activity of LytSD towards the tested strains was assessed using the plate lysis assay. In brief, the Streptomyces strains were cultured at 28 ℃ for 7 d, and then the mycelium was removed by filtration to obtain spore suspension. The YMS 11

medium (0.4% yeast extract, 0.4% soluble starch, 1% malt extract, 0.0005% CoCl2⋅6H2O, and 2% agar; pH 7.2) cooled to 42 ℃ was poured into plates, and after solidification, an underlying plate was obtained. Next, the YEME medium (0.3% yeast extract, 0.5% peptone, 0.3% malt extract, 1% glucose, 34% sucrose, and 0.7% agar) was cooled to approximately 42 ℃, mixed with the above spore suspension, and poured as the upper layer. After solidification, a 6-mm round sterile filter paper was placed on the upper plate and filled with 10 μg of purified protein (10 μL, 1.08 mg/mL) or PBS buffer (negative control). The plates were then incubated at 30 ℃ for 12 h and examined for clear zones surrounding the filter paper (excluding the filter paper diameter). For other bacterial strains in Table 3, the only difference was that bacterial cells grown to the late-exponential phase (OD600 of 0.8–1.0) were added to LB agar cooled to approximately 42 ℃.

Antibacterial activity of LytSD towards the tested strains was further assessed via a log-fold reduction assay. In brief, the Streptomyces strains were cultured at 28 ℃ for 7 d, and the mycelium was removed by filtration to obtain spore suspension. After the spore suspension with 106 colony-forming units/mL (CFU/mL) was pre-germinated for 6 h at 28 ℃, the purified LytSD was added into the bacterial suspension (the final concentration of LytSD is 10 μg/mL), and the mixture was incubated at 30 °C for 60 min. For other bacterial strains in Table 3, mid-exponential growing strains (OD600 = 0.6) were diluted to an initial cell density of 106 CFU/mL and incubated with the purified LytSD (the final concentration is 10 μg/mL) at 30 °C for 60 min. The purified LytSD was diluted in PBS buffer, and each bacterial strain was treated with 12

equivalent PBS buffer as a control. After incubation, ten-fold cell dilutions were prepared using PBS buffer (pH 7.4), and 100 μL of each dilution was plated out on YMS (for Streptomyces strains) or LB (for other bacteria in Table 3) agar. After incubation, CFUs were counted in agar plates after 24-h incubation at 30 °C, and antibacterial activity was quantified as the relative inactivation in logarithmic units = lg (N0/Ni) (N0 = the number of untreated cells, and Ni = the number of treated cells). All samples were replicated three times.

2.12. GenBank accession numbers

The GenBank accession numbers of lytSD and holSD of phage phiSASD1 are YP_003714747 and YP_003714769, respectively.

3. Results

3.1. Identification and sequence analysis of holSD and lytSD genes

The complete phage phiSASD1 genome is 37,068-bp, containing 43 ORFs. Among them, ORF19 has been predicted to encode a putative holin protein and designated as HolSD. The holSD gene is 231 bp long and encodes a 76-amino acid (aa) protein with a deduced molecular mass of 8.8 kDa and theoretical isoelectric point of 11.53. BLASTP revealed that HolSD has a high sequence similarity to three other predicted holin proteins from Streptomyces sp. phage C (EFL15336.1, 69% similarity, 5e-23), Streptomyces phage phiBT1 (NP_813745.1, 66% similarity, 2e-18), and Streptomyces phage phiC31(NP_047975.1, 61% similarity, 2e-16). HolSD contains 11 positively aa 13

(1 Lys, 8 Arg, and 2 His) and 5 negatively charged aa (3 Asp and 2 Glu), most of which were located in the junction of the two transmembrane regions (Fig. 1A). TMHMM analysis revealed that HolSD contains two putative hydrophobic TMDs, an extracellular

N-terminus,

and

an

intracellular

C-terminus,

forming

two

transmembrane helices at 4~23 aa and 57~75 aa, respectively, consistent with the predicted hydrophilic and transmembrane regions (Fig. 1C). Furthermore, SignalP 4.0 software analysis revealed a signal peptide at the N-terminus of HolSD (Fig. 1D). Its 3D model was predicted as Supplementary Fig. 1A using the online SWISS-MODEL server. ORF40 of phage phiSASD1, encoding a 278-aa protein (termed LytSD) with a deduced molecular mass of 29.6 kDa, has been predicted to contain a putative peptidoglycan-binding domain (pfam01471) between 212 and 268 aa. According to Clustal W program analysis, the 140-278 aa domain of LytSD showed similarity to N-acetylmuramoyl-L-alanine

amidase

of

some

bacteria,

including

S.

viridochromogenes (WP_063784880.1, 166/316, 57.62% identity), S. canus (WP_062041491.1, 161/302, 45.77% identity), and S. fragilis (WP_108954828.1, 210/300, 61.54% identity) (Fig. 1B). BLASTP revealed that the protein shares a certain degree of similarity with five other predicted endolysins from Streptomyces sp. 69 (WP_100825015.1, 41% similarity, 2e-42), S. cellulosae (WP_030682158.1, 40% similarity, 2e-40), Streptomyces sp. V2 (WP_109361563.1, 38% similarity, 4e-32), S. acidiscabies (WP_075737552.1, 38% similarity, 2e-29), and Streptomyces phage μ1/6 (YP_579222.1, 33% similarity, 1e-24). As shown in Supplementary Fig. 1B, the 3D 14

model of LytSD was predicted using the online SWISS-MODEL server. Furthermore, SignalP 4.0 software analysis revealed the absence of a signal peptide in LytSD (data not presented).

3.2. HolSD and LytSD production in E. coli

E. coli is a convenient host to assess holin proteins from phages infecting Gram-positive bacteria [31]. Therefore, the expression and functional identification of putative holin protein HolSD and endolysin protein LytSD were performed in E. coli strains. As the molecular weight of HolSD is relatively small, the plasmid pGEX-4T-1 with a relatively large GST tag was chosen to produce HolSD protein. The plasmid GST-holin, containing the holSD gene sequence, was used to transform E. coli BL21 (DE3) for expression, and HolSD production was induced by the addition of IPTG in the middle exponential growth phase. The total protein content of E. coli BL21 (DE3) carrying plasmid GST-holin was analyzed by SDS-PAGE at various time intervals (0, 30, 60, 90, 120, 150, and 180 min) after IPTG induction. The fusion protein (approximately 34.8 kDa) could not be detected via SDS-PAGE at 30-180 min after IPTG induction. However, after IPTG induction, the OD600 value of the bacterial culture gradually decreased, indicating that GST-holin is a potentially low-abundance, lethal protein with very low expression levels (Fig. 2A). Besides, although seemingly small amounts of the fusion protein appeared until 10 h of induction (Fig. 2B), we did not detect them by western blotting (data not shown). The plasmid pColdII produced more soluble protein at a low temperature of 15

induction than the plasmid pET28a+. Therefore, we chose the plasmid pColdII to produce the LytSD protein. The plasmid pColdII-endolysin, containing the lytSD gene sequence, was constructed. Recombinant LytSD containing an N-terminal His-tag was cloned, produced in E. coli BL21 (DE3), and followed by purification via affinity chromatography and gel filtration chromatography. SDS-PAGE revealed a single band of approximately 30 kDa, consistent with the calculated molecular mass (29.6 kDa; Fig. 3A). The identity of the purified pColdII-endolysin was further confirmed by western blotting. The expressed fusion protein with a His-tag showed a distinct band at 30 kDa as compared with cultures of E. coli BL21 (DE3) containing the empty vector pColdII, in agreement with the theoretical prediction (Fig. 3B). Besides, LytSD was purified under native conditions, yielding a soluble protein of 17.2 mg per liter of culture.

3.3. Effects of pH, temperature, different molecular reagents, and metal ions on LytSD

Mycelia are formed during the growth of Streptomyces, and its long growth cycle is not suitable for killing assessment via the turbidity reduction method. Therefore, S. aureus was selected as the biological indicator. LytSD displayed the highest lytic activity at pH 7.2 and significantly decreased at pH < 6.2 (Fig. 4A). LytSD displayed a wide range of temperature activity that, under experimental conditions, peaked at 28 °C. When the temperature increased from 16 °C to 28 °C, the relative activity of LytSD increased. When the temperature was beyond 28 °C, lytic activity decreased 16

with temperature increased. However, the reduction of lytic activity was relatively low between 37 °C and 80 °C, and even at 80 °C, LytSD treatment decreased the turbidity of the bacterial suspension by 17% (Fig. 4B). Three common molecular reagents, EDTA, DTT, and SDS, showed different influence on LytSD antibacterial activity. Among them, DTT, at a low concentration (1 mM), enhanced LytSD activity but inhibited its activity at a high concentration (10 mM). EDTA inhibited the activity of LytSD at 1 mM, indicating that endolysin is a potential metal-binding enzyme. SDS reduced LytSD activity by 63% and 85% at 1 mM and 10 mM, respectively (Table 2). As regards the effect of metal ions on LytSD activity, Cu2+, Mn2+, Zn2+, Al3+, Pb2+, and Fe3+ displayed potent inhibition at a low concentration of 1 mM, while Na+, Ca2+, and Mg2+ positively influenced LytSD activation. Na+ at 50 mM increased enzyme activity by 60%, and the high concentration (10 mM) of Ca2+ and Mg2+ also increased the antibacterial activity of LytSD (Table 2). Taken together, LytSD required metal ions, particularly Ca2+, Na+, or Mg2+ for its optimum enzymatic activity.

3.4. Antimicrobial spectrum of LytSD

Phage endolysin generally has a broader antibacterial spectrum than its original phages. The lytic activity of LytSD on the eighteen bacteria strains in Table 3 was examined by the plate lysis assay and a log-fold reduction assay (Supplementary Fig. 2 and Fig. 5). LytSD displayed intense lytic activity against different strains of S. avermitilis, including wild-type strains and avermectin high-yield strains 76-9 and 17

76-5, causing 3 log reduction of viable cells, but did not inhibit other Streptomyces strains tested (Table 3 and Fig. 5). Surprisingly, the lytic activity of LytSD against S. lutea and B. subtilis was almost as vigorous as it was against the strains of S. avermitilis, causing about 3 log reduction of viable cells (Fig. 5). Moreover, LytSD can also lyse E. faecalis and S. aureus which was weaker compared to the results of S. avermitilis strains, causing about 1.8 log reduction of viable cells (Fig. 5). However, LytSD did not show lytic activity against these Gram-negative bacteria including E. coli and P. aeruginosa strains (Table 3). Together, these results showed that LytSD has potent antibacterial activity against S. avermitilis strains and some gram-positive bacteria.

3.5. Effect of HolSD production on the growth activity of different E. coli strains

The effect of GST-holin fusion protein expression on the growth of different E. coli strains was examined, and two types of results were obtained after IPTG induction, including growth inhibition and bacterial cell lysis. Some bacterial growth was significantly inhibited, including E. coli JM109, TOP10, DH5α, and Rosseta (DE3) after IPTG was added for 4 h, and OD600 of the bacterial culture gradually decreased. After 4.5 h, the cells began to grow slowly. For E. coli BL21 (DE3) pLysS within 1 h of induction, it was rapidly lysed, and the absorbance at 600 nm of the bacterial suspension decreased to less than 0.2, and bacterial growth in the medium was stagnant. After 2.5 h, cells displayed rapid growth (Fig. 6A). The turbidity of E. coli BL21 (DE3) pLysS harboring the GST-holin plasmid very rapidly decreased probably 18

because it also contained plasmid pLysS expressing T7 lysozyme to lyse the bacterial cell wall synergistically with GST-holin, resulting in a rapid reduction in the turbidity of the bacterial suspension. In addition, in order to examine the effect of HolSD production on bacterial growth vitality, E. coli BL21 (DE3) pLysS, which was sensitive to GST-holin, was selected to detect bacterial survival rate. Consequently, growth of E. coli BL21 (DE3) pLysS transformed with the GST-holin plasmid was significantly inhibited in comparison with the control group harboring pGEX-4T-1 plasmid after IPTG induction (Fig. 6 B and C). In the first 40 min, the OD600 value rapidly declined to approximately 0.2, and the number of viable cells decreased by 3~4 log values. After 40 min, the OD600 value and bacterial viability stabilized, indicating that the production of GST-holin was lethal to the host bacteria during the initial 40 min of induction.

3.6. Effect of HolSD on bacterial morphology

To evaluate the damage to host cells during HolSD production after induction, morphological changes of E. coli BL21 (DE3) pLysS carrying the plasmid pGEX-4T-1 or GST-holin were observed via TEM. The control group E. coli BL21 (DE3) pLysS containing the empty vector pGEX-4T-1 showed no significant changes in cellular morphology after IPTG induction (Fig. 7B); however, significant changes in E. coli BL21 (DE3) pLysS carrying GST-holin plasmid were observed after IPTG induction (Fig. 7C and D). The major changes indicated by arrows were as follows: (1) after induction, most of the cells were deformed; (2) the cells became transparent 19

and translucent probably owing to efflux of cell contents; and (3) the cell boundary was blurred and eventually deformed into cell debris (Fig. 7C and D).

3.7. Determination of HolSD as a holin protein

To further investigate the physiological role of ORF19 during the process of endolysin release, we co-expressed holSD gene and lytSD gene in E. coli BL21(DE3). To induce the holSD and lytSD genes at the same temperature (30 ℃), we chose plasmids pET-SDlysin and GST-holin to co-transform into E. coli BL21(DE3). The growth of clones co-transformed with pET-SDlysin and GST-holin were monitored after IPTG induction (Fig. 6D). The results showed that the growth of E. coli BL21 (DE3) harboring plasmids pET-SDlysin and pGEX-4T-1, expressing only lytSD, was not inhibited. Co-transformation with pET-28a+ and GST-holin, expressing holSD, the growth of E. coli BL21 (DE3) was inhibited, and the turbidity of the bacterial suspension gradually decreased. However, the co-expression of holSD and lytSD resulted in an abrupt decrease in absorbance at 600 nm (Fig. 6D). These results suggested that HolSD might help the release of LytSD, which resulted in the abrupt decrease in absorbance at 600 nm. Holins are essential for endolysin R lytic activity in phage λ, and it can complement an S-negative lysis-defective λ phage mutant [32]. Phage λ Sam7 harbors an amber mutation in the S gene and consequently cannot trigger the lysis of infected host cells unless a suppressing E. coli strain with an amber mutation inhibitor (supE supF) is used. To further examine the role of HolSD, we carried out complementation tests by 20

infecting non-suppressing strains E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS with phage λ Sam7. Infected bacterial cells were seeded in soft agar supplemented with IPTG. When λ Sam7 infected E. coli LE392 with an amber mutation inhibitor (supE supF), numerous clearly visible plaques were formed (Fig. 8). The plasmid pGEX-4T-1 did not contain any sequence compensating for the S gene, and the transformed strain of E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS harboring the plasmid pGEX-4T-1 was induced with IPTG, and no plaque formation was observed. However, when GST-holin was transformed into E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS, the fusion protein formed by holSD gene induced by IPTG compensated for the functional mutation of λ Sam7 to lyse and infect adjacent host cells to form visible plaques (Fig. 8). Moreover, since E. coli BL21 (DE3) pLysS harbors the pLysS plasmid, which carries the gene encoding T7 lysozyme, this probably made E. coli BL21 (DE3) pLysS (GST-holin) form bigger plaques compared to that of BL21 (DE3) (GST-holin) (Fig. 8). The complementation test indicated that HolSD could function as a holin protein and complement an S-negative lysis-defective λ phage mutant.

4. Discussion

Many endolysin and holin proteins have been investigated for the treatment of antibiotic- resistant bacteria [19-22]. However, few studies have focused on endolysin and holin of Streptomyces phages. In the present study, the lytSD and holSD genes of S. avermitilis phage phiSASD1 were cloned, expressed, and characterized. Most (if 21

not all) endolysins display a modular molecular structure, containing catalytic domains and substrate recognition/binding domains. The catalytic domain is generally located in the N-terminal region, and the C-terminal domain is responsible for special target recognition and binding [33]. The 140-278 aa domain of LytSD showed similarity to N-acetylmuramoyl-L-alanine amidase of three Streptomyces bacteria. The C-terminal domain of LytSD was also predicted to contain a putative peptidoglycan-binding domain (pfam01471) between 212 and 268 aa. Further investigation involving structural analysis of catalytic and substrate binding domains of LytSD is needed. This will make it possible to manipulate the lysis gene in vitro to enhance its functional activity. BLAST analysis revealed that LytSD has no high similarity with other endolysins, that is because sequence data for experimentally confirmed endolysins encoded by other Streptomyces phages, and information on well-characterized bacterial cell wall lytic enzymes (autolysins) encoded by Streptomyces are scarce [34]. Biochemical characterization revealed that LytSD was slightly alkalophilic because, under neutral or weakly alkaline conditions, LytSD activity was relatively high. LytSD displayed the highest activity at 28 ℃; however, there is not much reduction in activity at 80 ℃, indicating that LytSD was thermostable, a marked advantage with respect to its practical applications to prevent and treat pathogenic bacteria. The metal cations Mg2+, Na+, and Ca2+ seemed to be essential for enzyme activity, since after removing them from the solution by using EDTA the LytSD activity significantly decreased. The requirement for ionization of LytSD is similar to the reported S. aureus phage phi-SauS-IPLA88, in which Na+, 22

Ca2+, Mg2+, etc., maintained the stability of the lactam hydrolase [35]. LytSD could lyse not only different S. avermitilis strains but also some Gram-positive bacteria such as S. lutea, B. subtills, E. faecalis, and S. aureus strains. Considering that phage phiSASD1 can only lyse S. avermitilis strains, antibacterial spectrum of LytSD is broader. This suggested that more bacterial species have the cell wall recognition site of LytSD rather than the phage phiSASD1 receptor. LytSD lytic activity was not detected with Gram-negative bacteria, probably because they have a different cell wall composition (e.g., outer membrane) from Gram-positive bacteria [36]. Future studies are required to increase enzyme activity and further broaden its antibacterial spectrum through genetic modification of the C-terminus or the N-terminus. Holins are hydrophobic membrane proteins, and they form nonspecific pores or lesions in the cytoplasmic membrane of hosts, which facilitate the interaction between endolysins and peptidoglycan to hydrolyze host cell wall and release phages [37]. Holins can generally be grouped into three classes by topology. Class I holins have more than 95 aa and form three TMDs. Class II holins are 65 ~ 95 aa and form two TMDs. Class III holins have a single TMD in the central region of the molecule [16]. All three types of holins had no signal peptides. In contrast, HolSD had the different characteristics from the classical holins: (1) it is not adjacent to endolysin like other holin proteins; (2) it does not have a typical binary initiation trimmer module; (3) it has two transmembrane regions and an N-terminal signal peptide, and (4) the charge distribution is different from that of other reported holins. Therefore, HolSD may be a new class of holin proteins. 23

After induction expression of the vector GST-holin for 180 min, the holin protein was not detected by SDS-PAGE. However, the turbidity of the bacterial suspension was reduced during the growth of the strain with the plasmid GST-holin. This indicated that a minimal amount of holin is probably sufficient to induce membrane damage. Similar phenomena have been reported in other holin proteins including the holin protein of actinomycete phage AV-1, the holin-like protein encoded by the bhlA gene of B. subtilis, and the holin protein of the thermophilic streptococcus phi O1205 [38, 39]. Besides, biological evidence for the holin-like character of HolSD was obtained by using E. coli. HolSD caused cell death, and the changes of cellular morphology, which might be due to membrane lesions of the tested cells. HolSD showed the same host non-specificity and membrane energy sensitivity as other holins [40, 41]. By forming membrane lesions in the cytoplasmic membrane, HolSD permitted T7 lysozyme in E. coli BL21 (DE3) pLysS, LytSD of phage phiSASD1 in E. coli BL21 (DE3), and R in phage λ-infected cells to evade the tested cells through the membrane and by damaging the cell wall, suggesting that HolSD potentially functions as a holin-like protein. Moreover, HolSD triggers LytSD activity and release of viral progeny through host cell lysis. Thereby, the holin-endolysin lysis system of phage phiSASD1 was also determined in this study.

Acknowledgements

This work was sponsored by the National Natural Science Foundation of China (grant No. 31570084 to YS, grant No.31770152 to SW, and grant No.31800006 to 24

YQ) and Natural Science Foundation of Guangdong Province (grant No.18zxxt26 to YQ). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests

The authors declare that they have no competing interests.

References

[1] F.L. Gordillo Altamirano, J.J. Barr, Phage Therapy in the Postantibiotic Era, Clin. Microbiol. Rev. 32 (2) (2019), https://doi.org/10.1128/CMR.00066-18. [2] L. Rahbarnia, S. Farajnia, B. Naghili, V. Ahmadzadeh, K. Veisi, R. Baghban, S. Toraby, Current trends in targeted therapy for drug-resistant infections, Appl. Microbiol. Biotechnol. (2019), https://doi.org/10.1007/s00253-019-10028-5. [3] Y. Yuan, L. Wang, X. Li, D. Tan, C. Cong, Y. Xu, Efficacy of a phage cocktail in controlling phage resistance development in multidrug resistant Acinetobacter baumannii, Virus Res. 272 (2019), https://doi.org/10.1016/j.virusres.2019.197734. [4] E.L. Zdorovenko, N.V. Besarab, A.S. Shashkov, G.I. Novik, A.A. Shirokov, A.M. Burov, Y.A. Knirel, Investigation of O-polysaccharides from bacterial strains of Pseudomonas genus as potential receptors of bacteriophage BIM BV-45, Int. J. Biol. Macromol. 118 (2018) 1065–1072, https://doi.org/10.1016/j.ijbiomac.2018.06.165. [5] M.J. Mayer, J. Payne, M.J. Gasson, A. Narbad, Genomic sequence and characterization of the virulent bacteriophage φCTP1 from Clostridium tyrobutyricum and heterologous expression

25

of

its

endolysin,

Appl.

Environ.

Microbiol.

76

(16)

(2010)

5415–5422,

https://doi.org/10.1128/AEM.00989-10. [6] J. Borysowski, B. Weber-Dabrowska, A. Gorski, Bacteriophage endolysins as a novel class of antibacterial

agents,

Exp.

Biol.

Med.

231

(4)

(2006)

366–377,

https://doi.org/10.1177/153537020623100402. [7] D.C. Nelson, M. Schmelcher, L. Rodriguez-Rubio, J. Klumpp, D.G. Pritchard, S. Dong, D.M. Donovan,

Endolysins

as

antimicrobials,

Adv.

Virus

Res.

83

(2012)

299–365,

https://doi.org/10.1016/B978-0-12-394438-2.00007-4. [8] R. Schuch, D. Nelson, V.A. Fischetti, A bacteriolytic agent that detects and kills Bacillus anthracis, Nature 418 (2002) 884–889, https://doi.org/10.1038/nature01026. [9] M. Kong, S. Ryu, Bacteriophage PBC1 and its endolysin as an antimicrobial agent against Bacillus

cereus,

Appl.

Environ.

Microbiol.

81

(7)

(2015)

2274–2283,

https://doi.org/10.1128/AEM.03485-14. [10] S.B. Linden, H. Zhang, R.D. Heselpoth, Y. Shen, M. Schmelcher, F. Eichenseher, D.C. Nelson, Biochemical and biophysical characterization of PlyGRCS, a bacteriophage endolysin active against methicillin-resistant Staphylococcus aureus, Appl. Microbiol. Biotechnol. 99 (2) (2015) 741–752, https://doi.org/10.1007/s00253-014-5930-1. [11] Y. Chang, M. Kim, S. Ryu, Characterization of a novel endolysin LysSA11 and its utility as a potent biocontrol agent against Staphylococcus aureus on food and utensils, Food Microbiol. 68 (2017) 112–120, https://doi.org/10.1016/j.fm.2017.07.004. [12]

M.R. Islam,

N. Son,

J. Lee,

D.W. Lee,

E.J. Sohn,

I. Hwang,

Production

of bacteriophage‑encoded endolysin, LysP11, in Nicotiana benthamiana and its activity

26

as a potent antimicrobial agent against Erysipelothrix rhusiopathiae, Plant Cell Rep. (2019), https://doi.org/10.1007/s00299-019-02459-1. [13] M. Plotka, M. Kapusta, S. Dorawa, A.K. Kaczorowska, T. Kaczorowski, Ts2631 endolysin from the extremophilic Thermus scotoductus bacteriophage vB_Tsc2631 as an antimicrobial agent against Gram-negative multidrug-resistant bacteria, Viruses 11 (7) (2019), 657, https://doi.org/10.3390/v11070657. [14] R. Young, I. Wang, W.D. Roof, Phages will out: strategies of host cell lysis, Trends Microbiol. 8 (2000) 120–128, https://doi.org/10.1016/S0966-842X(00)01705-4. [15] I.N. Wang, D.L. Smith, R. Young, Holins: the protein clocks of bacteriophage infections, Annu. Rev. Microbiol. 54 (2000) 799–825, https://doi.org/10.1146/annurev.micro.54.1.799. [16] Y. Shi, Y. Yan, W. Ji, B. Du, X. Meng, H. Wang, J. Sun, Characterization and determination of holin protein of Streptococcus suis bacteriophage SMP in heterologous host, Virol. J. 9 (2012) 70, https://doi.org/10.1186/1743-422X-9-70. [17] C.A. Agu, R. Klein, S. Schwab, M. König-Schuster, P. Kodajova, M. Ausserlechner, B. Binishofer, U. Bläsi, B. Salmons, W.H. Günzburg, C. Hohenadl, The cytotoxic activity of the bacteriophage lambda-holin protein reduces tumour growth rates in mammary cancer cell xenograft models, J. Gene Med. 8 (2006) 229–241, https://doi.org/10.1002/jgm.833. [18] C.A. Agu, R. Klein, J. Lengler, F. Schilcher, W. Gregor, T. Peterbauer, U. Bläsi, B. Salmons, W.H. Günzburg, C. Hohenadl, Bacteriophage-encoded toxins: the lambda-holin protein causes caspase-independent non-apoptotic cell death of eukaryotic cells, Cell Microbiol. 9 (2007) 1753–1765, https://doi.org/10.1111/j.1462-5822.2007.00911.x. [19] J. Song, F. Xia, H. Jiang, X. Li, L. Hu, P. Gong, L. Lei, X. Feng, C. Sun, J. Gu, W. Han,

27

Identification and characterization of HolGH15: the holin of Staphylococcus aureus bacteriophage

GH15,

J.

Gen.

Virol.

97

(2016),

1272–1281,

https://doi.org/10.1099/jgv.0.000428. [20] Y. Zhang, M. Cheng, H. Zhang, J. Dai, Z. Guo, X. Li, Y. Ji, R. Cai, H. Xi, X. Wang, Y. Xue, C. Sun, X. Feng, L. Lei, W. Han, J. Gu, Antibacterial effects of phage lysin LysGH15 on planktonic cells and biofilms of diverse Staphylococci, Appl. Environ. Microbiol. 84 (15) (2018) e00886-18, https://doi.org/10.1128/AEM.00886-18. [21] I. Imanishi, J. Uchiyama, T. Tsukui, J. Hisatsune, K. Ide, S. Matsuzaki, M. Sugai, K. Nishifuji, Therapeutic potential of an endolysin derived from Kayvirus S25-3 for Staphylococcal Impetigo, Viruses 11(9) (2019), https://doi.org/10.3390/v11090769. [22] K. Ciepluch, B. Maciejewska, K. Gałczyńska, D. Kuc-Ciepluch, M. Bryszewska, D. Appelhans, Z. Drulis-Kawa, M. Arabski, The influence of cationic dendrimers on antibacterial activity of phage endolysin against P. aeruginosa cells, Bioorg. Chem. 91 (2019), https://doi.org/doi: 10.1016/j.bioorg.2019.103121. [23] S. Wang, X. Qiao, X. Liu, X. Zhang, C. Wang, X. Zhao, Z. Chen, Y. Wen, Y. Song, Complete genomic sequence analysis of the temperate bacteriophage phiSASD1 of streptomyces

avermitilis,

Virology

403

(2010)

78–84,

https://doi.org/10.1016/j.virol.2010.03.044. [24] S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402, https://doi.org/10.1093/nar/25.17.3389. [25] A. Bateman, L. Coin, R. Durbin, R.D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M.

28

Marshall, S. Moxon, E.L.L. Sonnhammer, D.J. Studholme, C. Yeats, S.R. Eddy, The Pfam protein

families

database,

Nucleic

Acids

Res.

32

(2004)

D138–D141,

https://doi.org/10.1093/nar/gkh121. [26] A. Marchler-Bauer, S. Lu, J.B. Anderson, F. Chitsaz, M.K. Derbyshire, C. DeWeese-Scott, J.H. Fong, L.Y. Geer, R.C. Geer, N.R. Gonzales, M. Gwadz, D.I. Hurwitz, J.D. Jackson, Z.X. Ke, C.J. Lanczycki, F. Lu, G.H. Marchler, M. Mullokandov, M.V. Omelchenko, C.L. Robertson, J. Song, N. Thanki, R.A. Yamashita, D. Zhang, N. Zhang, C. Zheng, S.H. Bryant, CDD: a Conserved Domain Database for the functional annotation of proteins, Nucleic Acids Res. 39 (2011) D225–D229, https://doi.org/10.1093/nar/gkq1189. [27] A. Biswas, S. Ghosh, D. Sinha, A. Dutta, S. Seal, A. Bagchi, S. Sau, Dimerization ability, denaturation mechanism, and the stability of a staphylococcal phage repressor and its two domains,

Int.

J.

Biol.

Macromol.

124

(2019)

903–914,

https://doi.org/10.1016/j.ijbiomac.2018.11.263. [28] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. [29] N. Damak, S. Abdeljalil, A. Koubaa, S. Trigui, M. Ayadi, H. Trigui-Lahiani, E. Kallel, N. Turki, L. Djemal, H. Belghith, N.H. Taieb, A. Gargouri, Cloning and heterologous expression of a thermostable pectate lyase from Penicillium occitanis in Escherichia coli, Int. J. Biol. Macromol. 62 (2013) 549–556, http://dx.doi.org/10.1016/j.ijbiomac.2013.10.013. [30] D. Nelson, L. Loomis, V.A. Fischetti, Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 4107–4112, https://doi.org/10.1073/pnas.061038398.

29

[31] M. Steiner, U. Bläsi, Charged amino-terminal amino acids affect the lethal capacity of Lambda

lysis

proteins

S107

and

S105,

Mol.

Microbiol.

8

(1993)

525–533,

https://doi.org/10.1111/j.1365-2958.1993.tb01597.x. [32] J. Farkasovská, A. Godány, C. Vlcek, Identification of a holin encoded by the Streptomyces aureofaciens phage μ1/6; functional analysis in Escherichia coli system, Folia. Microbiol. (Praha) 49 (6) (2004) 679–684. [33] M.J. Loessner, G. Wendlinger, S. Scherer, Heterogeneous endolysins in Listeria monocytogenes bacteriophages: a new class of enzymes and evidence for conserved holin genes within the siphoviral lysis cassettes, Mol. Microbiol. 16 (1995) 1231–1241, https://doi.org/10.1111/j.1365-2958.1995.tb02345.x. [34] J. Farkasovská, A. Godány, C. Vlcek, Identification and characterization of an endolysin encoded by the Streptomyces aureofaciens phage μ1/6, Folia. Microbiol. (Praha) 48 (6) (2003) 737–744. [35] P. Garcia, B. Martínez, L. Rodriguez, A. Rodríguez, Synergy between the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized milk, Int. J. Food Microbiol. 141 (2010) 151–155, https://doi.org/10.1016/j.ijfoodmicro.2010.04.029. [36] B. Son, J. Yun, J.A. Lim, H. Shin, S. Heu, S. Ryu, Characterization of LysB4, an endolysin from the Bacillus cereus-infecting bacteriophage B4, BMC Microbiol. 12 (2012) 33, https://doi.org/ 10.1186/1471-2180-12-33. [37] R. Young, Bacteriophage lysis: mechanism and regulation, Microbiol. Rev. 56 (1992) 430– 481. [38] L.D. Allan, J.B. Gerard, G. Ming, Isolation and expression of the lysis genes of actinomyces

30

naeslundii

phage

Av-1,

Appl.

Environ.

Microbiol.

72

(2)

(2006)

1110–1117,

https://doi.org/10.1128/AEM.72.2.1110-1117.2006. [39] T. Anthony, G.S. Chellappa, T. Rajesh, P. Gunasekaran, Functional analysis of a putative holin-like peptide-coding gene in the genome of Bacillus licheniformis AnBa9, Arch. Microbiol. 192 (1) (2010) 51–56, https://doi.org/10.1007/s00203-009-0530-7. [40] E. Diaz, M. Munthali, H. Lunsdorf, J.V. Holtje, K.N. Timmis, The two-step lysis system of pneumococcal bacteriophage EJ-1 is functional in gram-negative bacteria: triggering of the major pneumococcal autolysin in Escherichia coli, Mol. Microbiol. 19 (1996) 667–681, https://doi.org/10.1046/j.1365-2958.1996.399929.x. [41] A.C. Martín, R. López, P. García, Functional analysis of the two-gene lysis system of the pneumococcal phage Cp-1 in homologous and heterologous host cells, J. Bacteriol. 180 (1998) 210–217.

31

Table 1 Plasmids and primers used in this study Plasmids

Construct

pET-SDlysin

pET28a+:: endolysin gene from phage phiSASD1 with N-terminal His-Tag

pColdII-endolysin

GST-holin

pColdII::endolysin gene from phage phiSASD1 with N-terminal His-Tag

pGEX-4T-1:: holin gene from phage phiSASD1 with N-terminal GST

aRestriction

Forward primer Reverse primera CTAGGATCCATGGACAGCCC TTCGCGT CCGCTCGAGTCAGGCGGTCA CGGTCC CTACATATGGACAGCCCTTC GCGT CCGGAATTCTCAGGCGGTCA CGGTC TGGATCCTTGAGCTCGTGGA CGCT ACTCGAGTCACACCCAGCCT CCCG

endonuclease sites are underlined, and start codons are shown in bold.

32

Restriction sites BamHI XhoI NdeI EcoRI BamHI XhoI

Table 2 Effects of different substances on the activity (%)a of LytSD Substances

mM

%

NaCl

50 100 1 10 1

160 100 135 160 20

10 1 10 1 10 1 10 1

10 125 147 78 45 30 10 62

10 1 10 1 10 1 10

35 50 34 67 32 50 32

1 10 1 10

152 80 37 15

CaCl2 CuCl2 MgCl2 MnCl2 PbCl2 ZnCl2 FeCl3 AlCl3 EDTA DTT SDS

aActivity

under test conditions expressed as percentage of that under control conditions (control buffer: PBS buffer, pH 7.2, representing 100 % activity).

33

Table 3 The antimicrobial spectrum of LytSD Strains

Relative lytic activity (%)

Size of zones (mm)

S. avermitilisATCC31267 S. avermitilis 76-9 S. avermitilis76-5

+++ +++ +++

12.6 12.5 12.4

S. lividans TK54 S. coelicolor M145 S. nigrificans S. violaoeorectus S. toyocaensis S. spinosa S. lutea B. subtilus

+++ +++

0 0 0 0 0 0 11.8 11.6

E. faecalis

++

6.5

S. aureus

++

7.1

P. aeruginosa

-

0

E．coli JM109 E. coli DH5α E. coli Top10 E. coli Rosseta

-

0 0 0 0

Relative lytic activity was obtained by comparing the lytic activity of each test to it toward S. avermitilisATCC31267; +++ strong intensity (> 10 mm), ++ weak intensity (5-10mm), - absence of lysis (0 mm).

34

Fig. 1. Bioinformatics analysis of HolSD and LytSD. (A) The primary structure of HolSD. Predicted anionic (-) and cationic (+) residues are indicated in italics. The transmembrane domains are underlined. (B) Amino acid sequence alignment of LytSD (140-278 aa) with predicted N-acetylmuramoyl-L-alanine amidase from S. viridochromogenes_amidase (166-316 aa), S. canus_amidase (161-302 aa), and S. fragilis_amidase (210-300 aa); identical amino acid residues are shaded in yellow; dashes represent introduced gaps to maximize alignment. (C) Prediction of transmembrane segments in HolSD using TMHMM. (D) Signal peptide prediction in HolSD using SignalP 4.0. C-score (raw cleavage site score) is used to distinguish whether it is a cleavage site, and the highest peak is the first amino acid after the cleavage site; S-score (signal peptide score) is used to distinguish whether the corresponding position is a signal peptide region; Y-score (combined cleavage site score) is the geometric mean of C-score and S-score, and is used to avoid the impact of multiple high score C-scores.

Fig. 2. Assessment of HolSD production. (A) The turbidity of the bacterial suspension after GST-holin expression; (B) SDS-PAGE analysis of GST-holin after 10 h of induction. Lane 1, Marker; lane 2, E. coli (pGEX-4T-1) induced for 10 h; lane 3–4, E. coli (GST-holin) induced for 10 h.

Fig. 3. SDS-PAGE and western blotting for endolysin production analysis. (A) 35

Purified pColdII-endolysin was loaded on an SDS-PAGE gel. Lane 1, protein marker; lane 2, the purified endolysin protein. (B) Western blotting for endolysin detection. Lane1, protein marker; lane 2, cultures of E. coli BL21 (DE3) (pColdII) were collected at 24 h after induction as a negative control; lane 3, purified pColdII-endolysin from E. coli BL21 (DE3) (pColdII-endolysin) after induction for 24 h.

Fig. 4. Effects of pH (A) and temperature (B) on the lytic stability of LytSD against S. aureus cells. The lytic activity was calculated using the equation: 100 × (OD600 of control without enzyme ‒ OD600 of the reaction mixture)/OD600 of control without enzyme.

Fig. 5. Antibacterial activity of LytSD towards the tested eighteen strains via a log-fold reduction assay. Other strains represent strains in which LytSD has no lytic activity, including S. lividans TK54, S. coelicolor M145, S. nigrificans, S. violaoeorectus, S. toyocaensis, S. spinosa, P. aeruginosa, E ． coli JM109, E. coli DH5α, E. coli Top10, and E. coli Rosseta. Each column represents the mean of triplicate experiments, and error bars indicate the standard deviation.

Fig. 6. (A) Effect of holSD expression on growth in different E. coli strains. (B and C) growth curves and vitality assays of E. coli BL21 (DE3) pLysS (GST-holin). (D) Co-expression of the holSD and lytSD genes in E. coli BL21 (DE3). 36

Fig. 7. TEM analysis of morphological changes in the different strains after IPTG induction. (A) Induced E. coli BL21 (DE3) pLysS; (B) Induced E. coli BL21 (DE3) pLysS (pGEX-4T-1); (C and D) Induced E. coli BL21 (DE3) pLysS (GST-holin). Black arrows in panel C and D indicate morphological changes.

Fig. 8. HolSD complementing the defective λ S allele. Phage λ Sam7 can infect suppressing strain E. coli LE392 but not the non-suppressing strains E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS. Besides, no plaques formed on the plates of E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS harboring the control plasmid pGEX-4T-1.

37