- Email: [email protected]
Cloning and characterization of estrogen receptor α in mummichog, Fundulus heteroclitus
Molecular and Cellular Endocrinology 203 (2003) 41 /50 www.elsevier.com/locate/mce
Cloning and characterization of estrogen receptor a in mummichog, Fundulus heteroclitus Hiroshi Urushitani a,b,c, Makoto Nakai d, Hideko Inanaga e, Yasuyuki Shimohigashi f, Akio Shimizu g, Yoshinao Katsu b,c, Taisen Iguchi a,b,c,* a Graduate School of Integrated Science, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027, Japan Department of Molecular Biomechanics, Center for Integrative Bioscience, Okazaki National Research Institutes, School of Life Science, The Graduate University for Advanced Studies, 5-1 Higashiyama, Myodaiji, Okazaki 444-8585, Japan c Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, Kawaguchi 332-0012, Japan d Chemicals Assessment Center, Chemicals Evaluation and Research Institute, Japan (CERI), 1600 Shimo-Takano, Sugito-machi, Kitakatsushika-gun, Saitama 345-0043, Japan e Kurume Laboratory, Chemicals Evaluation and Research Institute, Japan (CERI), 19-14 Chuo-machi, Kurume, Fukuoka 830-0023, Japan f Laboratory of Structure-Function Biochemistry, Department of Molecular Chemistry, Graduate School of Science, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-8581, Japan g National Research Institute of Fisheries Science, 2-12-4 Fukuura, Kanazawa-ku, Yokohama 236-8643, Japan b
Received 9 December 2002; accepted 20 February 2003
Abstract Developmental exposure to 17b-estradiol (E2) induced the death of embryos and fry, malformations, sex reversal, and incomplete ossification of vertebrae and cranial bones in the cyprinodont fish, the mummichog (Fundulus heteroclitus ). To clarify the mechanism by which exogenous estrogens caused these developmental effects, we determined the sequence of an estrogen receptor (ER) coding region, encoded by 620 amino acid residues. This region shared 80% identity to that of ERa of medaka (Oryzias latipes ). Northern blot analysis showed that two ERa mRNAs with 5.5 and 4 kb were expressed in the liver. These mRNAs were strongly induced by E2 stimulation. The 4 kb mRNA was expressed 8 h after treatment, whereas the 5.5 kb mRNA was not induced until 12 h after E2 stimulation. Vitellogenin (VTG) was expressed 8 h after E2 stimulation in the male liver. Receptor binding assays using the protein of F. heteroclitus ERa (fhERa) ligand binding domain showed that alkylphenols bind to fhERa with a higher affinity (50 times or more) as compared with the human ERa. The present results demonstrate that the fhERa has a sequence very similar to that of medaka, and the mRNA for this receptor was induced by E2-stimulation, followed subsequently by VTG expression. Furthermore, alkylphenols bind to fhERa more efficiently than to human ERa. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Estrogen receptor a; Cloning; Receptor binding assay; Vitellogenin; Fundulus heteroclitus
1. Introduction Many chemicals released into the environment have been reported to have the potential to disrupt the endocrine system of wildlife and humans (Colborn and Clement, 1992; Guillette et al., 1995; Guillette, 2000; McLachlan, 2001). Many of these chemicals have estrogenic activities as they can bind to the estrogen
* Corresponding author. Tel.: /81-564-59-5235; fax: /81-564-595236. E-mail address: [email protected] (T. Iguchi).
receptor (ER) found in various wildlife, humans and various cell lines (Guzelian, 1982; Gray et al., 1989; Soto et al., 1991; White et al., 1994; Flouriot et al., 1995; Guillette, 2000). Many chemicals released into aquatic environment have been suspected to play a causative role in alterations of endocrine and sexual development in aquatic wildlife (Guillette et al., 1995; Crain and Guillette, 1998; Van Der Kraak et al., 2001). In order to establish a model for analyzing the possible influence of estrogenic compounds on marine fish, effects of 17bestradiol (E2) on the development of mummichog was examined. We found that exogenous estrogen induced
0303-7207/03/$ - see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0303-7207(03)00118-7
42
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
death of embryos and fry, malformations, sex reversal, and incomplete ossification of vertebrae and cranial bones (Urushitani et al., 1997, 2002). In vertebrates, steroid hormone actions are mediated by specific receptors. The ER is a member of the steroid/ thyroid hormone receptor superfamily of ligand-activated transcription factors (Evans, 1988; Beato, 1989; Beato et al., 1995; Truss and Beato, 1993; Laudet, 1997). Recently, two types of ERs (ERa and ERb) have been identified by cloning of ER complementary DNA (cDNA) in various vertebrates (Green et al., 1986; Krust et al., 1986; Koike et al., 1987; Weiler et al., 1987; Pakdel et al., 1990; Mosselman et al., 1996; Kuiper et al., 1996; Todo et al., 1996; Tremblay et al., 1997; Xia et al., 1999; Tchoudakova et al., 1999; Socorro et al., 2000; Menuet et al., 2002). ER proteins are divided into six domains, termed A to F from the amino to carboxyl terminus (Krust et al., 1986). The A/B domain at the Nterminal region of ER protein has been demonstrated to contain a ligand-independent transcriptional activation function (AF-1) (Tora et al., 1989; Beato et al., 1995). The C domain (DNA-binding domain) lying in the middle region is most highly conserved among species, and regulates various target genes by binding to an estrogen response element (ERE) (Kumar et al., 1987). The D domain (hinge region) acts as a flexible hinge between the C and E domains. The E domain (ligand binding domain (LBD) is important for ligand-binding, dimerization and ligand-dependent transcriptional activation function (AF-2) (Danielian et al., 1992). In oviparous vertebrates, one of the target genes for estrogens is the hepatic ER that in turn induces the transcription of vitellogenin (VTG), a precursor of yolk protein. VTG synthesis is stimulated by natural estrogens from the ovary. Exogenous estrogenic chemicals also stimulate the liver of male fish, resulting in VTG synthesis. In contrast to its normal functions, exposure to estrogens during embryonic development can have major disruptive effects. Fish fry or embryos exposed to exogenous estrogens show abnormal gonads, alterations in sex steroid hormone levels, and or sex reversal (Nakamura, 1984; Crain et al., 1997; Guillette et al., 1999; Willingham and Crews, 1999). ER is present at early developmental stages in mouse embryos, even as early as the two-cell stage (Gorski and Hou, 1995). In Xenopus laevis embryos, ER mRNAs are also present in unfertilized eggs, and expression patterns of ER mRNAs change throughout the developmental stages and following E2-treatment (Nishimura et al., 1997). These results suggest that exogenous estrogenic xenobiotics could directly affect early embryonic development of many species. In order to clarify the developmental effects of exogenous estrogenic chemicals on fish embryos, we need to further understand the relationship between the
ER from fish and suspected environmental estrogens. We, therefore, determined the sequence of the Fundulus heteroclitus estrogen receptor a (fhERa) and compared the binding affinities of various estrogenic chemicals with the LBD of the fhERa.
2. Materials and methods 2.1. Animals Mummichog was maintained under natural condition as previously described (see Urushitani et al., 2002). Mummichog (Arasaki Strain) originating from Chesapeake Bay (USA) were introduced to the National Research Institute of Fisheries Science (Yokosuka, Kanagawa, Japan) from the Ocean Research Institute of the University of Tokyo (Tokyo, Japan) in 1985. These fish, which maintained under Natural condition, spawn eggs daily from April through August (Shimizu, 1997). Mature male and female fish were given an intra peritoneal injection of 17b-estradiol (E2) (0.01 mg/g body weight) dissolved in sesame oil. Fish were killed before injections began (time 0) and 2, 4, 6, 8, 12 and 24 h after injection; the liver was removed from all fish. Tissues were frozen in liquid nitrogen and stored at /80 8C for RNA isolation. Materials otherwise mentioned were purchased from Wako Pure Chemical, Osaka, Japan. 2.2. RNA isolation Total RNA was isolated from liver and ovary using a RNeasy total RNA isolation kit (QIAGEN, Chatsworth, CA) according to the manufacturer’s protocol. The concentrations and quality of isolated RNA were estimated by spectrophotometric measurement at 260 nm and checked by formaldehyde gel electrophoresis, then stored at /80 8C until used. Total RNAs were used for Northern blot analysis and reverse transcriptionpolymerase chain reaction (RT-PCR). Each RNA samples for RT-PCR were treated with ribonucleasefree deoxyribonuclease I (Nippongene, Tokyo, Japan). 2.3. Reverse transcription-polymerase chain reaction (RT-PCR) amplification and complementary DNA (cDNA) cloning RT-PCR was performed using a Takara RNA PCR kit (Takara, Ohtsu, Japan) according to the manufacturer’s protocol with minor modifications. Total RNA (1 mg/100 ml of PCR reaction) from female liver was reverse transcribed with Avian Myeloblastomas Virus (AMV) reverse transcriptase and oligo(dT)12 18 (GibcoBRL, Gland Island, NY) at 42 8C for 50 min, and PCR was subsequently performed with the Program Temp
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Control System PC-700 (ASTEC, Fukuoka, Japan) with the following profile: 30 s at 94 8C, 1 min at 54 8C, 2 min at 72 8C; 30 cycles. Finally the reaction mixtures were kept at 72 8C for 10 min to achieve complete extension. Primers were also kept at 72 8C for 10 min to achieve complete extension. Primers were designed according to the Oryzias sp. ER (D28954) (see Table 1). Major RT-PCR products resolved on a low melting point agarose gel, NuSieve GTG (FMC BioProducts, Rockland, ME), were purified by the standard phenol extraction method. Purified RT-PCR products were ligated to the TA cloning site of the pCR II vector using the TA Cloning Kit Dual Promoter (Invitrogen, San Diego, CA), and then transfected into INVaF cells (Invitrogen). Nucleotide sequence analysis was performed by the dideoxy chain terminating method using the SequiThern Long-Read Cycle Sequencing Kit-LC (Epicentre Technologies, Madison, WI) according to the manufacture’s protocol. The reaction was carried out by cycling the reactions 30 times for 30 s at 95 8C, 30 s at 60 8C and 1 min at 70 8C with Program Temp Control System PC700 (ASTEC), then heat-denatured products were separated on a poly acrylamide/urea gel using DNA Sequencer Model 400L (LI-COR, Lincoln, NE). The sequence alignments and phylogenetic trees were carried out using GENE WORKS software (Oxford Molecular Group, Campbell, CA) containing the CLUSTAL V computer program for multiple sequence alignment and construction of phylogenetic tree. The computer program constructs phylogenetic trees according to the UPGMA method. 2.4. Digoxigenin (DIG)-dUTP labeled probe synthesis DIG-dUTP labeled probe synthesis was performed using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s protocol. Cloned plasmid DNA (Primer No. ER1 and ER-2; 100 pg/50 ml of PCR reaction) was used as the template DNA. After heat-denaturation (4 min at Table 1 PCR primers for the cloning of fhER mRNA Name Position of 5? residues Sequences (5? /3?) ER-1 ER-2 ER-3 ER-4 ER-5 ER-6 ER-7 ER-8
709 /729 1542 /1562 1010 /1030 1708 /1730 799 /821 1101 /1123 133 /153 752 /772
CTTCAAGAGGAGCATCCAGG CCGACGCTCTCATACATCAT TCTGTGACCAGCATACCTCC CCTCCTACTGGAGATGCTCGAT GGCTTGTCGTCTTAGGAAGTGC CCTACACCGAGGTCACCATGAT ACTCAGATCCAGGATCAGCC GCGACCAATCAGTGCACTAT
*Numbers of besides the primer sequences indicated the most 5?-end nucleotide of the primer corresponding to the sequence for which the GenBank accession number (Oryzias sp. ER: D28954) is given.
43
95 8C) of the template DNA, PCR was carried out by cycling the reactions 30 times for 45 s at 94 8C, 1 min at 56 8C and 2 min at 72 8C with Program Temp Control System PC-700 (ASTEC). Finally the reaction mixtures were kept at 72 8C for 10 min to achieve complete extension. 2.5. Construction of a cDNA library Poly(A) RNA was prepared total RNA from female liver using Oligotex-dT30 super (Takara) according to the manufacturer’s protocol. cDNA was synthesized from 5 mg of poly(A) RNA with oligo (dT)18-Xho I linker primer as a primer using SuperScript II RNase H reverse transcriptase (Gibco-BRL), followed by addition of Eco RI adaptor according to the manufacturer’s protocol. The cDNA was ligated into Eco RI and Xho I restriction sites of lamda ZAP II vector (Stratagene, La Jolla, CA) and then packaged at 22 8C for 2 h using Gigapack III GOLD phage extract (Stratagene). For screening of the cDNA library, approximately 5 /105 plaques were screened by plaque hybridization with a DIG-dUTP labeled cDNA probe prepared by the manufacturer’s protocol. Hybridization was carried out in a solution containing 5 /SSC, 1% blocking reagent (Roche Diagnostics), 0.1% sodium N -lauroylsarcosine, 0.02% SDS and the probe (10 ng/ml) at 50 8C overnight. The membranes were washed with 2 /SSC /0.1% SDS at room temperature and 0.1 /SSC /0.1% SDS at 65 8C for 15 min twice, and then positive clones were detected immunologically with anti-DIG-AP and nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer’s protocol. Two cDNA clones, 4-1 and 12-2, were chosen, subcloned into plasmids and sequenced. 2.6. Northern blot analysis Poly(A) RNA was isolated from total RNA of control and E2-stimulated male liver using OligotexdT30 super (Takara) according to the manufacturer’s protocol. Poly(A) RNA (1 or 0.5 mg) was denatured in 1 /3-(N -morpholino) propanesulfonic acid (MOPS) loading buffer (0.04 M MOPS, 0.01 mM sodium acetate, 1 mM EDTA), 2.2 M formaldehyde, 50% formamide by heating at 65 8C for 10 min and electrophoresed in 2.2 M formaldehyde /1.0% agarose gel. After electrophoresis, the RNA was transferred to a nylon membrane, Hybond-N/ (Amersham Pharmacia Biotech, Buckinghamshire, UK) by capillary blot with 10/SSC (0.15 M NaCl, 15 mM sodium citrate) and was cross-linked to the membrane by UV irradiation. These membranes were hybridized with DIG-dUTP labeled probes (10 ng/ ml) at 50 8C in 5 /SSC, 50 mM sodium phosphate buffer (pH 7.0), 50% formamide, 2% blocking reagent
44
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
(Roche Molecular Biochemicals), 0.1% sodium N -lauroyl sarcosinate and 7% SDS. They were washed to a final stringency of 0.1 /SSC, 0.1% SDS at 65 8C. Then detected immunologically with anti-DIG-AP and CDPStar (Roche Molecular Biochemicals) according to the manufacturer’s protocol. These signals were exposed to X-ray film, X-OMAT AR (Kodak, Rochester, NY). After detection, these membranes were stripped at 68 8C in 1% SDS, 50 mM Tris /HCl (pH 8.0) and 50% formamide, and then were hybridized again. 2.6.1. Chemicals 4-t-Octylphenol, benzophenone, di-n -butyl phthalate, dicyclohexyl phthalate, di-2-ethylhexyl phthalate, octachlorostyrene, and tributyltin chloride were obtained from Wako Pure Chemical Industries. 4-Nonylphenol was purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). 2.6.2. Construction of receptor expression plasmid and expression of the fusion protein The LBD of fhERa was ligated with the prokaryotic expression vector pGEX-4T1 (Amersham Pharmacia Biotech) in Bam H I and Not I sites. Escherichia coli DH5a transformed with the expression plasmid was cultured in 250 ml of L-broth containing 50 mg/ml of ampicillin and protein expression was induced in the presence of isopropyl 1-thio-b-D-galactoside. The cells were harvested by centrifugation and resuspended in 4 ml of 50 mM Tris /HCl (pH 8.0) containing 50 mM NaCl, 1 mM EDTA, and 1 mM DTT. After sonication and centrifugation, a soluble fraction was loaded to the affinity resin, Glutathione-Sepharose 4B (Amarsham Pharmacia Biotech). After incubation for 30 min at 4 8C, the resin was washed three times with phosphate buffered saline containing 0.5% (v/v) Triton X-100 (PBST) and the fusion protein was eluted with PBST containing 16 mM of reduced glutathione. 2.6.3. Receptor binding assay The receptor binding assay was carried out as reported previously (Nakai et al., 1999). A solution (10 ml) of recombinant fhERa LBD fusion protein was dissolved in Tris /HCl (pH 7.4, 70 ml) containing 1 mM EDTA, 1 mM EGTA, 1 mM NaVO3, 10% glycerol, 10 mg/ml bovine serum albumin, 0.5 mM phenylmethylsulfonyl fluoride, and 0.2 mM leupeptin. After a test solution (10 ml) of various concentration (1 /10 4 /1/ 1011 M) and 5 nM [2,4,6,7,16,17-3H] 17b-estradiol (10 ml) were added, the solution was incubated for 1 h at 25 8C. Free radiolabelled ligand was removed by incubation with 0.2% activated charcoal and 0.02% dextran in PBS (pH 7.4) for 10 min at 4 8C and centrifugation for 10 min at 15 000 rpm. The residual radioactivity of radioligand bound to the receptor was measured by liquid scintillation counting. The receptor
binding assay was repeated three times and data were analyzed by the computer program GRAPHPAD PRISM Ver. 3 (GraphPad Software, Inc.).
3. Results 3.1. Screening of the cDNA library Using RT-PCR, one PCR product (ca. 850 base pairs) was isolated, cloned and sequenced. The nucleotide sequences of this clone indicated high homology with medaka ERa (data not shown). This PCR product was used to screen the cDNA library made from the liver of a mature female mummichog. Two positive cDNA clones, clone 4-1 and 12-2, were obtained. These fragments containing about 2000 nucleotides were cloned, and found to encoded 620 amino acid residues (Fig. 1) (DDBJ/EMBL/GenBank accession number AB097197). 3.2. Sequence homology with other species’ ERs To infer a phylogeny of ER subtypes, the deduced amino acid sequence of fhER cDNA was compared with other species’ ERs (human, mouse rat, chicken, X. laevis , channel catfish, goldfish, tilapia, red sea bream, gilthead seabream, rainbow trout, medaka, Atlantic croaker and Japanese eel) (Fig. 2). As previously reported, the analysis indicates that there are two major groups of ERs: ERa and ERb clusters. The ERa and ERb clusters shared about 45/80 and 40 /43%, respectively, the overall identity of their amino acid residues when compared with fhER. The fhER shared about 80, 74 and 72% overall identity to amino acid residues of medaka (Oryzias latipes ) ERa, tilapia (Oreochromis aureus ) type 1 ER and red seabream (Chrysophirus ) ERa, respectively. The deduced amino acid residues of fhER contained a highly conserved region (Fig. 3). Using the nomenclature for domain structure by Krust et al. (1986), the DNA binding domain (C domain) and LBD (E domain) showed high homology with other ERs. The homology with the C domain of medaka ER is 95%, and it is conserved among other species’ ER, exhibiting 90% homology. In the C domain of the fhER, two zinc finger motifs with eight cysteine residues were conserved. The homology with the E domain of the medaka ER was most conserved (92%). 3.3. Northern blot analysis Northern blot analysis showed that two ER mRNA transcripts of 5.5 and 4 kb were expressed in male and female liver (Fig. 4). Northern blot analysis of time course showed that the both mRNA transcripts were
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
45
Fig. 1. The nucleotide and deduced amino acid sequence of the clone 12-2. The numbers on the right refer to the nucleotide and amino acid sequences. The eight cysteine residues within zinc-finger motifs in C domain are boxed.
expressed at 0 h following treatment of males with exogenous estrogen (Fig. 5). Then, only 4 kb transcript was expressed from 2 to 8 h after E2-stimulation. The 5.5 kb transcript was observed from 12 h, and seemed to be expressed strongly at 24 h after E2 stimulation. VTG mRNA expression was observed from 8 h after E2 stimulation. It seemed to be expressed strongly 24 h after E2-stimulation.
3.4. Receptor binding assay FhERa binding affinities to 4-t-octylphenol, 4-nonylphenol, benzophenone, di-n-butyl phthalate, dicyclohexyl phthalate, di-2-ethylhexyl phthalate, octachlorostyrene, and tributyltin chloride were measured. The chemicals were tested as they were designated priority substances for risk assessments by the Japanese
46
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Fig. 3. Domain structure of Fh (F. heteroclitus ) ER. Using the nomenclature of Krust et al. (1986), the five to six domains of ER (A-F domains) are indicated. Sequence identity with Medaka (NCBI BLAST identification number: Gi-1706707), chicken (Krust et al., 1986), mouse (White et al., 1987), human (Green et al., 1986) ERs. The overall identity of each region is shown as a percentage compared with the clone.
Fig. 2. Phylogenetic analysis of ER amino acid sequences including F. heteroclitus ER. This tree was constructed according to the clustal W method. The lengths of the vertical lines indicate reciprocal sequence similarities. NCBI BLAST identification numbers for each sequence are Atlantic croaker (A. Croaker) beta, Gi-10312208; A. Croaker gamma, Gi-10312210; catfish alpha, Gi-10945423; catfish beta, Gi7527468; chicken alpha, Gi-119597; chicken beta, Gi-13124227; Japanese eel, Gi-2073113; goldfish alpha, Gi-16118451; goldfish beta1, Gi-4666318; goldfish bata2, 7012683; gilthead seabream (GS) alpha, Gi-12643248; GS beta, Gi-13124245; human alpha, Gi-544257; human beta, Gi-1518263; medaka alpha, Gi-3915675; medaka beta, Gi18143643; mouse alpha, Gi-119599; mouse beta, Gi-1912468; rainbow trout (R. Trout) alpha, Gi-12643267; R. Trout beta, Gi-13124194; rat alpha, Gi-119600; rat beta, Gi-1373281; red seabream, Gi-2447038; tilapia type1, Gi-4098199; tilapia type2, Gi-4098201; X. laevis , Gi625330.
government in the ‘‘Strategic Programs on Environmental Endocrine Disrupters ’98 (SPEED’98)’’. The binding curves of chemicals are illustrated in Fig. 6. E2 bound to fhERa with an IC50 value of 5.5 /109 M. The binding affinities of the other chemicals are represented as relative binding affinity (RBA), which was calculated as a percent ratio of the IC50 values of test substances relative to E2. Table 2 shows the mean of RBA values of chemicals for fhERa. RBA values of 4-toctylphenol and 4-nonylphenol for fhERa were approximately 0.0067- and 0.0042-fold of E2, respectively. Benzophenone exhibited weak binding affinity, approximately 0.008% of E2. Phthalates also showed weak binding affinities (0.01/0.02% of E2). Di-n-butyl phtha-
Fig. 4. Transcriptional sizes and expressions of ER and VTG mRNA as analyzed by Northern blot analysis. The poly(A) RNA (1 mg each lanes), isolated from male (M) and female (F) livers, were separated on a denaturing formaldehyde agarose gel (1%).
late showed slightly higher receptor binding ability for the fhERa. Binding potency of octachlorostyrene to fhERa was estimated as 0.02% of E2.
4. Discussion Man-made chemicals have the potential to health and reproduction problems in human and wildlife (Colborn
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Fig. 5. Northern blot analysis of ER and VTG mRNA expressions in time series. The poly(A) RNA isolated from male liver at 0, 2, 4, 8, 12 and 24 h after E2 stimulation. Amounts of poly(A) RNA loaded on a denaturing formaldehyde agarose gel (1%) were 0.5 mg each lanes. Table 2 IC50 and RBA values of each chemical to fhERa Chemicals 17b-Estradiol Dibutyl phthalate Di(2-ethylhexyl) halate Dicyclohexyl phthalate 4-t -Octylphenol 4-Nonylphenol Benzophenone Octachlorostyrene Tributyltin chloride
IC50 (M) 9
5.5/10 5.3/10 5 3.2/10 5 3.8/10 5 8.5/10 7 1.3/10 6 7.3/10 5 2.9/10 5 3.3/10 6
RBA (%) 100 0.010 0.017 0.014 0.65 0.42 0.0075 0.019 0.17
47
et al., 1993). These chemicals, can act as hormonal agonists or antagonists, and have been called endocrinedisrupting chemicals (EDCs). Recent surveys have reported that many chemicals exhibiting ER affinity are widely distributed in the aquatic environment. It is the widespread nature of these contaminants and reports documenting that exposure to ecologically relevant concentrations of EDCs and or exogenous hormones early in development can cause permanent alterations of the reproductive, immune, and neurological systems that require further studies on the mechanisms by which these changes occur (Guillette et al., 1995; Iguchi et al., 2002a). A number of studies have revealed a risk of exposure of estrogens or estrogenic compounds during their early development (Crain et al., 1997; Willingham and Crews, 1999; Guillette et al., 1999; McLachlan, 2001; Iguchi et al., 2002a). We reported that exposure to estrogen early in the development of the mummichog (F. heteroclitus ), caused malformations, growth retardation, incomplete ossification, sex reversal and death of fry (Urushitani et al., 2002). In X. laevis , similar results have been reported by Nishimura et al. (1997). Furthermore, they demonstrated there was an effect of estrogen on ER mRNA expression during development. In mice, ER was expressed in the oocytes and fertilized eggs (Gorski and Hou, 1995). These findings suggested that estrogen can affect early development, and may have a specific direct effect on early osteogenesis through an ER-mediated mechanism. In the present study, fhER cDNA was isolated to further
Fig. 6. Concentration-dependent curves of chemicals in the receptor binding assay to measure the abilities to displace [3H]17b-estradiol. Abbreviations of chemicals were as follows; DBP, dibutyl phthalate; DEHP, di(2-ethylhexyl) phthalate; DCHP, dicyclohexyl phthalate; t -OP, 4-t octylphenol; NP, 4-nonylphenol; BP, benzophenone; OCS, octachlorostyrene; TBTCl, tributyltin chloride.
48
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
clarify the mechanisms by which exogenous estrogen affect development of teleost fish. To isolate the fhER, we used a cDNA library from mRNA of the sexually mature female liver during the spawning season. cDNA screening using RT-PCR product resulted in two cDNA clones containing complete open reading frame. Phylogenetic analysis of ER families indicates that fhER belongs to the ERa clusters consisting of tetrapod and fish ERa. Specifically, the fhER was clonally related to medaka ERa, tilapia type-1 ER, red seabream ERa, and gilthead seabream ERa (Fig. 2). These results indicate that the receptor we isolated and cloned in the mummichog should be classified as an ERa. The comparison between the deduced amino acid sequence of fhER and ERs of four species ER shows high levels of identity in the C and E domains. The C (DNA binding) domain is the most highly conserved (90 /95%) among ERs and our observation on the fhERa is consistent with this conclusion. This region is well conserved in the ER family, containing two zincfinger motifs (Schwabe et al., 1993). These structures are necessary for recognizing and binding to the target sites in DNA. These results suggested that fhER might interact with the target sites on DNA by a similar mechanism as reported for other species. The E (ligand binding) domain has high identity with other species’ ER amino acid residues, especially with the medaka ER, as it has 92% amino acid sequence identity. Several amino acid residues of this E domain have been identified as important for ligand binding, dimerization, and transcriptional activation functions (AF-2) (Lees et al., 1990; Danielian et al., 1992). The estradiol-binding studies of human ERa identified a number of amino acid residues (A350, E353, L387, I424, G521, H524, L525 and M628) as involved in ligand binding (Brzozowski et al., 1997; Ekena et al., 1996, 1998). These amino acids were conserved in the fhER (A356, E359, L393, R400, I430, G527, H530, L531 and M534). The His513, which plays an important role for dimerization in human ER, was conserved in the fhER (H519). In transactivation, the AF-2 region is conserved in fhER (L545 to L550), equivalent to the fhER region L539 to L544. The A/B domain shared a high identity with medaka ER (77%), compared with other ERs (15 /23%). The A/ B domain has a cell type and promoter specific transactivation function (AF-1) (Tora et al., 1989). Pakdel et al. (2000) indicated 45 amino acids differences in the A/B domain between short and long isoforms of rainbow trout ERa. These sequence differences in the A/ B domain suggested the presence of species or isoform specific mechanisms in the transactivation of ERs. The Northern blot analysis indicated the presence of two transcripts (5.5 and 4 kb) in the mummichog liver (Fig. 4). The presence of several transcripts of ER has
been reported in many other mammals and fishes (Weiler et al., 1987; Pakdel et al., 1990; Todo et al., 1996; Tchoudakova et al., 1999; Socorro et al., 2000). Moreover, two functional ERa isoforms, which differ by 45 amino acids in the A/B domain, were reported in trout (Pakdel et al., 2000). In Northern blot analysis of time course, the 4 kb transcript was rapidly observed (within 8 h) after exogenous treatment with E2, followed by the 5.5 kb transcript 12 h after E2 stimulation. At 24 h after E2 stimulation, the 5.5 kb transcript seemed to be expressed strongly. VTG mRNA was expressed from 8 h. Then, it tended to be expressed strongly at 24 h after E2 stimulation. Many studies showed that ER levels have been regulated by ligand in various animals and tissues. In trout’s hepatocyte culture, ER mRNA had increased after 2 h, and reached maximum expression 24 h after E2 stimulation. VTG mRNA was induced 8 h after E2 stimulation (Flouriot et al., 1996). In this study, the 4.5 kb transcript was expressed before the inducement of 5.5 kb transcripts and VTG mRNA expression. The 5.5 kb transcript was expressed from 8 h after E2 stimulation, and then VTG mRNA seemed to be expressed strongly. These results suggested that the both of 4 and 5.5 kb transcripts may be functional isoforms and play important roles in transcription of fhER and VTG mRNAs. It has been reported that alkylphenols are xenoestrogens (Soto et al., 1991; White et al., 1994). However, binding affinities of alkylphenols to various ERs from different species showed wide spectrum of responses, i.e. 4-t-octylphenol bound to rainbow trout ERa stronger than human ERa (Matthews et al., 2000), and binding affinity of nonylphenol for the ERa from testicular and liver cytosol of Atlantic croaker was comparable to human ERa (Loomis and Thomas, 1999; Tabira et al., 1999). RBA values of 4-t -octylphenol and 4-nonylphenol for fhERa were approximately 0.0067- and 0.0042fold of E2, respectively, and these values were 20 and 7 times greater in affinity when compared with the interaction between these chemicals and human ERa (Tabira et al., 1999). The binding affinities for the fhERa were similar to those reported for rainbow trout ERa using the same chemicals. Benzophenone exhibited weak binding affinity, approximately 0.008% of E2. Phthalates also showed weak binding affinities and they bound to fhERa at 0.01 / 0.02% the strength of E2. Di-n -butyl phthalate showed a slightly higher receptor binding ability for fhERa when compared with human ERa, however, its RBA value was no more than three times the RBA for human ERa (Nakai et al., 1999). Octachlorostyrene was inactive in both the human ER binding assay (Nakai et al., unpublished data) and immature rat uterotrophic assay (Yamasaki et al., 2002). However, its binding potency to fhERa was detectable (0.02% of E2). These results suggested there
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
are species differences in receptor binding abilities of various environmental pollutants. To resolve the ecotoxic effects of chemicals based on endocrine disruption mediated by receptor binding, it is necessary to measure the binding potencies of chemicals to various receptors, and evaluate the differences among species. Binding affinities of nonylphenol and octylphenol with fish ERa were higher in medaka (O. latipes ) than in the humans (Ministry of Environment, 2001). Breeding experiments performed with medaka exposed to nonylphenol levels reported in natural aquatic system in Japan, revealed increased incidences of ovotestis and decreases in the numbers of males produced. VTG expression was observed in fish exposed to nonylphenol levels of 11.6, 23.5 and 22.5 mg/l, respectively. Recent studies report that the maximum concentration of nonylphenol in Japanese river water is 21 mg/l. Based on these results, the Ministry of the Environment restricted the release of nonylphenol into the aquatic environment in 2001 (Iguchi et al., 2002b). We do not know whether chemicals used present study have a possibility to affect mummichog in the wild, since we have no wild mummichog in Japan. However, some of the chemicals may affect the medaka in Japan. There are species differences in ER binding to chemicals, therefore, we need to consider the species difference in the risk assessment of chemicals especially in fish species (Iguchi et al., 2002b). In conclusion, cDNA of fhERa was cloned, and the protein of the LBD of the fhERa binds E2 as well as alkylphenols which previously have been reported to have estrogenic activity. Interestingly, fhERa binds nonylphenol and octylphenol more than 50 times greater than that observed for the human ERa, suggesting species-specific differences in ligand binding of ERa.
Acknowledgements The authors thank Professor Louis Guillette, University of Florida, for critical reading of this manuscript. This work was partly supported by a Grant-in-Aid for Scientific Research on Priority (A) from the Ministry of Education, Sports, Science, Culture and Technology of Japan and a Research Grant from the Ministry of the Environment. H. Urushitani is a Research Fellow of the Japan Society for the Promotion of Science.
References Beato, M., 1989. Gene regulation by steroid hormones. Cell 56, 335 / 344. Beato, M., Herrlich, P., Schutz, G., 1995. Steroid hormone receptors: many actors in search of a plot. Cell 83, 851 /857. Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.L., Gustafsson, J.A.,
49
Carlquist, M., 1997. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753 /758. Colborn, T., Clement, C. (Eds.), 1992. Chemically-induced alterations in sexual and functional development: the wildlife/human connection. In: Advances in Modern Environment Toxicology. Princeton Scientific Publishing, Princeton, New Jersey, p. 403. Colborn, T., vom Saal, F.S., Soto, A.M., 1993. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ. Health Perspect. 101, 378 /384. Crain, D.A., Guillette, L.J., Jr, 1998. Reptiles as models of contaminant-induced endocrine disruption. Anim. Reprod. Sci. 53, 77 /86. Crain, D.A., Guillette, L.J., Jr, Rooney, A.A., Pickford, D.B., 1997. Alterations in steroidogenesis in alligators (Alligator mississippiensis ) exposed naturally and experimentally to environmental contaminants. Environ. Health Perspect. 105, 528 /533. Danielian, P.S., White, R., Lees, J.A., Parker, M.G., 1992. Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11, 1025 /1033. Ekena, K., Weis, K.E., Katzenellenbogen, J.A., Katzenellenbogen, B.S., 1996. Identification of amino acids in the hormone binding domain of the human estrogen receptor important in estrogen binding. J. Biol. Chem. 271, 20053 /20059. Ekena, K., Katzenellenbogen, J.A., Katzenellenbogen, B.S., 1998. Determinants of ligand specificity of estrogen receptor-alpha: estrogen versus androgen discrimination. J. Biol. Chem. 273, 693 /699. Evans, R.M., 1988. The steroid and thyroid hormone receptor superfamily. Science 240, 889 /895. Flouriot, G., Pakdel, F., Ducouret, B., Valotaire, Y., 1995. Influence of xenobiotics on rainbow trout liver estrogen receptor and vitellogenin gene expression. J. Mol. Endocrinol. 15, 143 /151. Flouriot, G., Pakdel, F., Valotaire, Y., 1996. Transcriptional and posttranscriptional regulation of rainbow trout estrogen receptor and vitellogenin gene expression. Mol. Cell. Endocrinol. 124, 173 /183. Gorski, J., Hou, Q., 1995. Embryonic estrogen receptors: do they have a physiological function. Environ. Health Perspect. 103 (Suppl. 7), 69 /72. Gray, L.E., Jr, Ostby, J., Ferrell, J., Rehnberg, G., Linder, R., Cooper, R., Goldman, J., Slott, V., Laskey, J., 1989. A dose /response analysis of methoxychlor-induced alterations of reproductive development and function in the rat. Fundam. Appl. Toxicol. 12, 92 /108. Green, S., Walter, P., Greene, G., Krust, A., Goffin, C., Jensen, E., Scrace, G., Waterfield, M., Chambon, P., 1986. Cloning of the human oestrogen receptor cDNA. J. Steroid Biochem. 24, 77 /83. Guillette, L.J., Jr, 2000. Contaminant-induced endocrine disruption in wildlife. Growth Horm. IGF Res. 10 (Suppl. B), S45 /S50. Guillette, L.J., Jr, Crain, D.A., Rooney, A.A., Pickford, D.B., 1995. Organization versus activation: the role of endocrine-disrupting contaminants (EDCs) during embryonic development in wildlife. Environ. Health Perspect. 103 (Suppl. 7), 157 /164. Guillette, L.J., Jr, Woodward, A.R., Crain, D.A., Pickford, D.B., Rooney, A.A., Percival, H.F., 1999. Plasma steroid concentrations and male phallus size in juvenile alligators from seven Florida lakes. Gen. Comp. Endocrinol. 116, 356 /372. Guzelian, P.S., 1982. Comparative toxicology of chlordecone (Kepone) in humans and experimental animals. Annu. Rev. Pharmacol. Toxicol. 22, 89 /113. Iguchi, T., Watanabe, H., Katsu, Y., Mizutani, T., Miyagawa, S., Suzuki, A., Sone, K., Kato, H., 2002a. Developmental toxicity of estrogenic chemicals on rodents and other species. Congen. Anorm. 42, 94 /105. Iguchi, T., Sumi, M., Tanabe, S., 2002b. Endocrine disruptor issues in Japan. Congen. Anorm. 42, 106 /119.
50
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Koike, S., Sakai, M., Muramatsu, M., 1987. Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res. 15, 2499 /2513. Krust, A., Green, S., Argos, P., Kumar, V., Walter, P., Bornert, J.M., Chambon, P., 1986. The chicken oestrogen receptor sequence: homology with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J. 5, 891 /897. Kuiper, G.G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J.A., 1996. Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 93, 5925 /5930. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987. Functional domains of the human estrogen receptor. Cell 51, 941 /951. Laudet, V., 1997. Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor. J. Mol. Endocrinol. 19, 207 /226. Lees, J.A., Fawell, S.E., White, R., Parker, M.G., 1990. A 22-aminoacid peptide restores DNA-binding activity to dimerization-defective mutants of the estrogen receptor. Mol. Cell. Biol. 10, 5529 / 5531. Loomis, A.K., Thomas, P., 1999. Binding characteristics of estrogen receptor (ER) in Atlantic croaker (Micropogonias undulatus ) testis: different affinity for estrogens and xenobiotics from that of hepatic ER. Biol. Reprod. 61, 51 /60. Matthews, J., Celius, T., Halgren, R., Zacharewski, T., 2000. Differential estrogen receptor binding of estrogenic substances: a species comparison. J. Steroid Biochem. Mol. Biol. 74, 223 /234. McLachlan, J.A., 2001. Environmental signaling: what embryos and evolution teach us about endocrine disrupting chemicals. Endocr. Rev. 22, 319 /341. Menuet, A., Pellegrini, E., Anglade, I., Blaise, O., Laudet, V., Kah, O., Pakdel, F., 2002. Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biol. Reprod. 66, 1881 /1892. Ministry of Environment, Japan, 2001. Report on the test results of endocrine disrupting effects of nonylphenol on fish. Mosselman, S., Polman, J., Dijkema, R., 1996. ER beta: identification and characterization of a novel human estrogen receptor. FEBS Lett. 392, 49 /53. Nakai, M., Tabira, Y., Asai, D., Yakabe, Y., Shinmyozu, T., Noguchi, M., Takatsuki, M., Shimohigashi, Y., 1999. Binding characteristics of dialkyl phthalates for the estrogen receptor. Biophys. Biochem. Res. Commun. 254, 311 /314. Nakamura, M., 1984. Effects of estradiol-17b on gonadal sex differentiation in two species of salmonids, the masu salmon, Onchorinchus masou , and the Chum salmon, O. keta . Aquaculture 43, 83 /90. Nishimura, N., Fukazawa, Y., Uchiyama, H., Iguchi, T., 1997. Effects of estrogenic hormones on early development of Xenopus laevis . J. Exp. Zool. 278, 221 /233. Pakdel, F., Le Gac, F., Le Goff, P., Valotaire, Y., 1990. Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell. Endocrinol. 71, 195 /204. Pakdel, F., Metivier, R., Flouriot, G., Valotaire, Y., 2000. Two estrogen receptor (ER) isoforms with different estrogen dependencies are generated from the trout ER gene. Endocrinology 141, 571 /580. Schwabe, J.W., Chapman, L., Finch, J.T., Rhodes, D., 1993. The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: how receptors discriminate between their response elements. Cell 75, 567 /578.
Shimizu, A., 1997. Reproductive cycles in a reared strain of the mummichog, a daily spawner. J. Fish Biol. 51, 724 /737. Socorro, S., Power, D.M., Olsson, P.E., Canario, A.V., 2000. Two estrogen receptors expressed in the teleost fish, Sparus aurata : cDNA cloning, characterization and tissue distribution. J. Endocrinol. 166, 293 /306. Soto, A.M., Justicia, H., Wray, J.W., Sonnenschein, C., 1991. p Nonyl-phenol: an estrogenic xenobiotic released from ‘‘modified’’ polystyrene. Environ. Health Perspect. 92, 167 /173. Tabira, Y., Nakai, M., Asai, D., Yakabe, Y., Tahara, Y., Shinmyozu, T., Noguchi, M., Takatsuki, M., Shimohigashi, Y., 1999. Structural requirements of para -alkylphenols to bind to estrogen receptor. Eur. J. Biochem. 262, 240 /245. Tchoudakova, A., Pathak, S., Callard, G.V., 1999. Molecular cloning of an estrogen receptor beta subtype from the goldfish, Carassius auratus . Gen. Comp. Endocrinol. 113, 388 /400. Todo, T., Adachi, S., Yamauchi, K., 1996. Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell. Endocrinol. 119, 37 /45. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., Chambon, P., 1989. The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59, 477 /487. Tremblay, G.B., Tremblay, A., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Labrie, F., Giguere, V., 1997. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol. Endocrinol. 11, 353 /365. Truss, M., Beato, M., 1993. Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14, 459 /479. Urushitani, H., Shimizu, A., Fukazawa, Y., Sato, T., Iguchi, T., 1997. Developmental effect on gonadal differentiation and bones in Fundulus heteroclitus . In: Kawashima, S., Kikuyama, S. (Eds.), Advances in Comparative Endocrinology, pp. 311 /315. Urushitani, H., Shimizu, A., Katsu, Y., Iguchi, T., 2002. Early estrogen exposure induces abnormal development of Fundulus heteroclitus . J. Exp. Zool. 293, 693 /702. Van Der Kraak, G.J., Hewitt, M., Lister, A., McMaster, M., Mankkittrick, K., 2001. Endocrine toxicicants and reproductive success in fish. Hum. Ecol. Risk Assess. 7, 1017 /1025. Weiler, I.J., Lew, D., Shapiro, D.J., 1987. The Xenopus laevis estrogen receptor: sequence homology with human and avian receptors and identification of multiple estrogen receptor messenger ribonucleic acids. Mol. Endocrinol. 1, 355 /362. White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175 /182. White, R., Lees, J.A., Needham, M., Ham, J., Parker, M., 1987. Structural organization and expression of the mouse estrogen receptor. Mol. Endocrinol. 1 (10), 735 /744. Willingham, E., Crews, D., 1999. Sex reversal effects of environmentally relevant xenobiotic concentrations on the red-eared slider turtle, a species with temperature-dependent sex determination. Gen. Comp. Endocrinol. 113, 429 /435. Xia, Z., Patino, R., Gale, W.L., Maule, A.G., Densmore, L.D., 1999. Cloning, in vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor. Gen. Comp. Endocrinol. 113, 360 /368. Yamasaki, K., Takeyoshi, M., Yakabe, Y., Sawaki, M., Imatanaka, N., Takatsuki, M., 2002. Comparison of reporter gene assay and immature rat uterotrophic assay of 23 chemicals. Toxicology 170, 21 /30.
Cloning and characterization of estrogen receptor a in mummichog, Fundulus heteroclitus Hiroshi Urushitani a,b,c, Makoto Nakai d, Hideko Inanaga e, Yasuyuki Shimohigashi f, Akio Shimizu g, Yoshinao Katsu b,c, Taisen Iguchi a,b,c,* a Graduate School of Integrated Science, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027, Japan Department of Molecular Biomechanics, Center for Integrative Bioscience, Okazaki National Research Institutes, School of Life Science, The Graduate University for Advanced Studies, 5-1 Higashiyama, Myodaiji, Okazaki 444-8585, Japan c Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, Kawaguchi 332-0012, Japan d Chemicals Assessment Center, Chemicals Evaluation and Research Institute, Japan (CERI), 1600 Shimo-Takano, Sugito-machi, Kitakatsushika-gun, Saitama 345-0043, Japan e Kurume Laboratory, Chemicals Evaluation and Research Institute, Japan (CERI), 19-14 Chuo-machi, Kurume, Fukuoka 830-0023, Japan f Laboratory of Structure-Function Biochemistry, Department of Molecular Chemistry, Graduate School of Science, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-8581, Japan g National Research Institute of Fisheries Science, 2-12-4 Fukuura, Kanazawa-ku, Yokohama 236-8643, Japan b
Received 9 December 2002; accepted 20 February 2003
Abstract Developmental exposure to 17b-estradiol (E2) induced the death of embryos and fry, malformations, sex reversal, and incomplete ossification of vertebrae and cranial bones in the cyprinodont fish, the mummichog (Fundulus heteroclitus ). To clarify the mechanism by which exogenous estrogens caused these developmental effects, we determined the sequence of an estrogen receptor (ER) coding region, encoded by 620 amino acid residues. This region shared 80% identity to that of ERa of medaka (Oryzias latipes ). Northern blot analysis showed that two ERa mRNAs with 5.5 and 4 kb were expressed in the liver. These mRNAs were strongly induced by E2 stimulation. The 4 kb mRNA was expressed 8 h after treatment, whereas the 5.5 kb mRNA was not induced until 12 h after E2 stimulation. Vitellogenin (VTG) was expressed 8 h after E2 stimulation in the male liver. Receptor binding assays using the protein of F. heteroclitus ERa (fhERa) ligand binding domain showed that alkylphenols bind to fhERa with a higher affinity (50 times or more) as compared with the human ERa. The present results demonstrate that the fhERa has a sequence very similar to that of medaka, and the mRNA for this receptor was induced by E2-stimulation, followed subsequently by VTG expression. Furthermore, alkylphenols bind to fhERa more efficiently than to human ERa. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Estrogen receptor a; Cloning; Receptor binding assay; Vitellogenin; Fundulus heteroclitus
1. Introduction Many chemicals released into the environment have been reported to have the potential to disrupt the endocrine system of wildlife and humans (Colborn and Clement, 1992; Guillette et al., 1995; Guillette, 2000; McLachlan, 2001). Many of these chemicals have estrogenic activities as they can bind to the estrogen
* Corresponding author. Tel.: /81-564-59-5235; fax: /81-564-595236. E-mail address: [email protected] (T. Iguchi).
receptor (ER) found in various wildlife, humans and various cell lines (Guzelian, 1982; Gray et al., 1989; Soto et al., 1991; White et al., 1994; Flouriot et al., 1995; Guillette, 2000). Many chemicals released into aquatic environment have been suspected to play a causative role in alterations of endocrine and sexual development in aquatic wildlife (Guillette et al., 1995; Crain and Guillette, 1998; Van Der Kraak et al., 2001). In order to establish a model for analyzing the possible influence of estrogenic compounds on marine fish, effects of 17bestradiol (E2) on the development of mummichog was examined. We found that exogenous estrogen induced
0303-7207/03/$ - see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0303-7207(03)00118-7
42
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
death of embryos and fry, malformations, sex reversal, and incomplete ossification of vertebrae and cranial bones (Urushitani et al., 1997, 2002). In vertebrates, steroid hormone actions are mediated by specific receptors. The ER is a member of the steroid/ thyroid hormone receptor superfamily of ligand-activated transcription factors (Evans, 1988; Beato, 1989; Beato et al., 1995; Truss and Beato, 1993; Laudet, 1997). Recently, two types of ERs (ERa and ERb) have been identified by cloning of ER complementary DNA (cDNA) in various vertebrates (Green et al., 1986; Krust et al., 1986; Koike et al., 1987; Weiler et al., 1987; Pakdel et al., 1990; Mosselman et al., 1996; Kuiper et al., 1996; Todo et al., 1996; Tremblay et al., 1997; Xia et al., 1999; Tchoudakova et al., 1999; Socorro et al., 2000; Menuet et al., 2002). ER proteins are divided into six domains, termed A to F from the amino to carboxyl terminus (Krust et al., 1986). The A/B domain at the Nterminal region of ER protein has been demonstrated to contain a ligand-independent transcriptional activation function (AF-1) (Tora et al., 1989; Beato et al., 1995). The C domain (DNA-binding domain) lying in the middle region is most highly conserved among species, and regulates various target genes by binding to an estrogen response element (ERE) (Kumar et al., 1987). The D domain (hinge region) acts as a flexible hinge between the C and E domains. The E domain (ligand binding domain (LBD) is important for ligand-binding, dimerization and ligand-dependent transcriptional activation function (AF-2) (Danielian et al., 1992). In oviparous vertebrates, one of the target genes for estrogens is the hepatic ER that in turn induces the transcription of vitellogenin (VTG), a precursor of yolk protein. VTG synthesis is stimulated by natural estrogens from the ovary. Exogenous estrogenic chemicals also stimulate the liver of male fish, resulting in VTG synthesis. In contrast to its normal functions, exposure to estrogens during embryonic development can have major disruptive effects. Fish fry or embryos exposed to exogenous estrogens show abnormal gonads, alterations in sex steroid hormone levels, and or sex reversal (Nakamura, 1984; Crain et al., 1997; Guillette et al., 1999; Willingham and Crews, 1999). ER is present at early developmental stages in mouse embryos, even as early as the two-cell stage (Gorski and Hou, 1995). In Xenopus laevis embryos, ER mRNAs are also present in unfertilized eggs, and expression patterns of ER mRNAs change throughout the developmental stages and following E2-treatment (Nishimura et al., 1997). These results suggest that exogenous estrogenic xenobiotics could directly affect early embryonic development of many species. In order to clarify the developmental effects of exogenous estrogenic chemicals on fish embryos, we need to further understand the relationship between the
ER from fish and suspected environmental estrogens. We, therefore, determined the sequence of the Fundulus heteroclitus estrogen receptor a (fhERa) and compared the binding affinities of various estrogenic chemicals with the LBD of the fhERa.
2. Materials and methods 2.1. Animals Mummichog was maintained under natural condition as previously described (see Urushitani et al., 2002). Mummichog (Arasaki Strain) originating from Chesapeake Bay (USA) were introduced to the National Research Institute of Fisheries Science (Yokosuka, Kanagawa, Japan) from the Ocean Research Institute of the University of Tokyo (Tokyo, Japan) in 1985. These fish, which maintained under Natural condition, spawn eggs daily from April through August (Shimizu, 1997). Mature male and female fish were given an intra peritoneal injection of 17b-estradiol (E2) (0.01 mg/g body weight) dissolved in sesame oil. Fish were killed before injections began (time 0) and 2, 4, 6, 8, 12 and 24 h after injection; the liver was removed from all fish. Tissues were frozen in liquid nitrogen and stored at /80 8C for RNA isolation. Materials otherwise mentioned were purchased from Wako Pure Chemical, Osaka, Japan. 2.2. RNA isolation Total RNA was isolated from liver and ovary using a RNeasy total RNA isolation kit (QIAGEN, Chatsworth, CA) according to the manufacturer’s protocol. The concentrations and quality of isolated RNA were estimated by spectrophotometric measurement at 260 nm and checked by formaldehyde gel electrophoresis, then stored at /80 8C until used. Total RNAs were used for Northern blot analysis and reverse transcriptionpolymerase chain reaction (RT-PCR). Each RNA samples for RT-PCR were treated with ribonucleasefree deoxyribonuclease I (Nippongene, Tokyo, Japan). 2.3. Reverse transcription-polymerase chain reaction (RT-PCR) amplification and complementary DNA (cDNA) cloning RT-PCR was performed using a Takara RNA PCR kit (Takara, Ohtsu, Japan) according to the manufacturer’s protocol with minor modifications. Total RNA (1 mg/100 ml of PCR reaction) from female liver was reverse transcribed with Avian Myeloblastomas Virus (AMV) reverse transcriptase and oligo(dT)12 18 (GibcoBRL, Gland Island, NY) at 42 8C for 50 min, and PCR was subsequently performed with the Program Temp
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Control System PC-700 (ASTEC, Fukuoka, Japan) with the following profile: 30 s at 94 8C, 1 min at 54 8C, 2 min at 72 8C; 30 cycles. Finally the reaction mixtures were kept at 72 8C for 10 min to achieve complete extension. Primers were also kept at 72 8C for 10 min to achieve complete extension. Primers were designed according to the Oryzias sp. ER (D28954) (see Table 1). Major RT-PCR products resolved on a low melting point agarose gel, NuSieve GTG (FMC BioProducts, Rockland, ME), were purified by the standard phenol extraction method. Purified RT-PCR products were ligated to the TA cloning site of the pCR II vector using the TA Cloning Kit Dual Promoter (Invitrogen, San Diego, CA), and then transfected into INVaF cells (Invitrogen). Nucleotide sequence analysis was performed by the dideoxy chain terminating method using the SequiThern Long-Read Cycle Sequencing Kit-LC (Epicentre Technologies, Madison, WI) according to the manufacture’s protocol. The reaction was carried out by cycling the reactions 30 times for 30 s at 95 8C, 30 s at 60 8C and 1 min at 70 8C with Program Temp Control System PC700 (ASTEC), then heat-denatured products were separated on a poly acrylamide/urea gel using DNA Sequencer Model 400L (LI-COR, Lincoln, NE). The sequence alignments and phylogenetic trees were carried out using GENE WORKS software (Oxford Molecular Group, Campbell, CA) containing the CLUSTAL V computer program for multiple sequence alignment and construction of phylogenetic tree. The computer program constructs phylogenetic trees according to the UPGMA method. 2.4. Digoxigenin (DIG)-dUTP labeled probe synthesis DIG-dUTP labeled probe synthesis was performed using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s protocol. Cloned plasmid DNA (Primer No. ER1 and ER-2; 100 pg/50 ml of PCR reaction) was used as the template DNA. After heat-denaturation (4 min at Table 1 PCR primers for the cloning of fhER mRNA Name Position of 5? residues Sequences (5? /3?) ER-1 ER-2 ER-3 ER-4 ER-5 ER-6 ER-7 ER-8
709 /729 1542 /1562 1010 /1030 1708 /1730 799 /821 1101 /1123 133 /153 752 /772
CTTCAAGAGGAGCATCCAGG CCGACGCTCTCATACATCAT TCTGTGACCAGCATACCTCC CCTCCTACTGGAGATGCTCGAT GGCTTGTCGTCTTAGGAAGTGC CCTACACCGAGGTCACCATGAT ACTCAGATCCAGGATCAGCC GCGACCAATCAGTGCACTAT
*Numbers of besides the primer sequences indicated the most 5?-end nucleotide of the primer corresponding to the sequence for which the GenBank accession number (Oryzias sp. ER: D28954) is given.
43
95 8C) of the template DNA, PCR was carried out by cycling the reactions 30 times for 45 s at 94 8C, 1 min at 56 8C and 2 min at 72 8C with Program Temp Control System PC-700 (ASTEC). Finally the reaction mixtures were kept at 72 8C for 10 min to achieve complete extension. 2.5. Construction of a cDNA library Poly(A) RNA was prepared total RNA from female liver using Oligotex-dT30 super (Takara) according to the manufacturer’s protocol. cDNA was synthesized from 5 mg of poly(A) RNA with oligo (dT)18-Xho I linker primer as a primer using SuperScript II RNase H reverse transcriptase (Gibco-BRL), followed by addition of Eco RI adaptor according to the manufacturer’s protocol. The cDNA was ligated into Eco RI and Xho I restriction sites of lamda ZAP II vector (Stratagene, La Jolla, CA) and then packaged at 22 8C for 2 h using Gigapack III GOLD phage extract (Stratagene). For screening of the cDNA library, approximately 5 /105 plaques were screened by plaque hybridization with a DIG-dUTP labeled cDNA probe prepared by the manufacturer’s protocol. Hybridization was carried out in a solution containing 5 /SSC, 1% blocking reagent (Roche Diagnostics), 0.1% sodium N -lauroylsarcosine, 0.02% SDS and the probe (10 ng/ml) at 50 8C overnight. The membranes were washed with 2 /SSC /0.1% SDS at room temperature and 0.1 /SSC /0.1% SDS at 65 8C for 15 min twice, and then positive clones were detected immunologically with anti-DIG-AP and nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer’s protocol. Two cDNA clones, 4-1 and 12-2, were chosen, subcloned into plasmids and sequenced. 2.6. Northern blot analysis Poly(A) RNA was isolated from total RNA of control and E2-stimulated male liver using OligotexdT30 super (Takara) according to the manufacturer’s protocol. Poly(A) RNA (1 or 0.5 mg) was denatured in 1 /3-(N -morpholino) propanesulfonic acid (MOPS) loading buffer (0.04 M MOPS, 0.01 mM sodium acetate, 1 mM EDTA), 2.2 M formaldehyde, 50% formamide by heating at 65 8C for 10 min and electrophoresed in 2.2 M formaldehyde /1.0% agarose gel. After electrophoresis, the RNA was transferred to a nylon membrane, Hybond-N/ (Amersham Pharmacia Biotech, Buckinghamshire, UK) by capillary blot with 10/SSC (0.15 M NaCl, 15 mM sodium citrate) and was cross-linked to the membrane by UV irradiation. These membranes were hybridized with DIG-dUTP labeled probes (10 ng/ ml) at 50 8C in 5 /SSC, 50 mM sodium phosphate buffer (pH 7.0), 50% formamide, 2% blocking reagent
44
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
(Roche Molecular Biochemicals), 0.1% sodium N -lauroyl sarcosinate and 7% SDS. They were washed to a final stringency of 0.1 /SSC, 0.1% SDS at 65 8C. Then detected immunologically with anti-DIG-AP and CDPStar (Roche Molecular Biochemicals) according to the manufacturer’s protocol. These signals were exposed to X-ray film, X-OMAT AR (Kodak, Rochester, NY). After detection, these membranes were stripped at 68 8C in 1% SDS, 50 mM Tris /HCl (pH 8.0) and 50% formamide, and then were hybridized again. 2.6.1. Chemicals 4-t-Octylphenol, benzophenone, di-n -butyl phthalate, dicyclohexyl phthalate, di-2-ethylhexyl phthalate, octachlorostyrene, and tributyltin chloride were obtained from Wako Pure Chemical Industries. 4-Nonylphenol was purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). 2.6.2. Construction of receptor expression plasmid and expression of the fusion protein The LBD of fhERa was ligated with the prokaryotic expression vector pGEX-4T1 (Amersham Pharmacia Biotech) in Bam H I and Not I sites. Escherichia coli DH5a transformed with the expression plasmid was cultured in 250 ml of L-broth containing 50 mg/ml of ampicillin and protein expression was induced in the presence of isopropyl 1-thio-b-D-galactoside. The cells were harvested by centrifugation and resuspended in 4 ml of 50 mM Tris /HCl (pH 8.0) containing 50 mM NaCl, 1 mM EDTA, and 1 mM DTT. After sonication and centrifugation, a soluble fraction was loaded to the affinity resin, Glutathione-Sepharose 4B (Amarsham Pharmacia Biotech). After incubation for 30 min at 4 8C, the resin was washed three times with phosphate buffered saline containing 0.5% (v/v) Triton X-100 (PBST) and the fusion protein was eluted with PBST containing 16 mM of reduced glutathione. 2.6.3. Receptor binding assay The receptor binding assay was carried out as reported previously (Nakai et al., 1999). A solution (10 ml) of recombinant fhERa LBD fusion protein was dissolved in Tris /HCl (pH 7.4, 70 ml) containing 1 mM EDTA, 1 mM EGTA, 1 mM NaVO3, 10% glycerol, 10 mg/ml bovine serum albumin, 0.5 mM phenylmethylsulfonyl fluoride, and 0.2 mM leupeptin. After a test solution (10 ml) of various concentration (1 /10 4 /1/ 1011 M) and 5 nM [2,4,6,7,16,17-3H] 17b-estradiol (10 ml) were added, the solution was incubated for 1 h at 25 8C. Free radiolabelled ligand was removed by incubation with 0.2% activated charcoal and 0.02% dextran in PBS (pH 7.4) for 10 min at 4 8C and centrifugation for 10 min at 15 000 rpm. The residual radioactivity of radioligand bound to the receptor was measured by liquid scintillation counting. The receptor
binding assay was repeated three times and data were analyzed by the computer program GRAPHPAD PRISM Ver. 3 (GraphPad Software, Inc.).
3. Results 3.1. Screening of the cDNA library Using RT-PCR, one PCR product (ca. 850 base pairs) was isolated, cloned and sequenced. The nucleotide sequences of this clone indicated high homology with medaka ERa (data not shown). This PCR product was used to screen the cDNA library made from the liver of a mature female mummichog. Two positive cDNA clones, clone 4-1 and 12-2, were obtained. These fragments containing about 2000 nucleotides were cloned, and found to encoded 620 amino acid residues (Fig. 1) (DDBJ/EMBL/GenBank accession number AB097197). 3.2. Sequence homology with other species’ ERs To infer a phylogeny of ER subtypes, the deduced amino acid sequence of fhER cDNA was compared with other species’ ERs (human, mouse rat, chicken, X. laevis , channel catfish, goldfish, tilapia, red sea bream, gilthead seabream, rainbow trout, medaka, Atlantic croaker and Japanese eel) (Fig. 2). As previously reported, the analysis indicates that there are two major groups of ERs: ERa and ERb clusters. The ERa and ERb clusters shared about 45/80 and 40 /43%, respectively, the overall identity of their amino acid residues when compared with fhER. The fhER shared about 80, 74 and 72% overall identity to amino acid residues of medaka (Oryzias latipes ) ERa, tilapia (Oreochromis aureus ) type 1 ER and red seabream (Chrysophirus ) ERa, respectively. The deduced amino acid residues of fhER contained a highly conserved region (Fig. 3). Using the nomenclature for domain structure by Krust et al. (1986), the DNA binding domain (C domain) and LBD (E domain) showed high homology with other ERs. The homology with the C domain of medaka ER is 95%, and it is conserved among other species’ ER, exhibiting 90% homology. In the C domain of the fhER, two zinc finger motifs with eight cysteine residues were conserved. The homology with the E domain of the medaka ER was most conserved (92%). 3.3. Northern blot analysis Northern blot analysis showed that two ER mRNA transcripts of 5.5 and 4 kb were expressed in male and female liver (Fig. 4). Northern blot analysis of time course showed that the both mRNA transcripts were
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
45
Fig. 1. The nucleotide and deduced amino acid sequence of the clone 12-2. The numbers on the right refer to the nucleotide and amino acid sequences. The eight cysteine residues within zinc-finger motifs in C domain are boxed.
expressed at 0 h following treatment of males with exogenous estrogen (Fig. 5). Then, only 4 kb transcript was expressed from 2 to 8 h after E2-stimulation. The 5.5 kb transcript was observed from 12 h, and seemed to be expressed strongly at 24 h after E2 stimulation. VTG mRNA expression was observed from 8 h after E2 stimulation. It seemed to be expressed strongly 24 h after E2-stimulation.
3.4. Receptor binding assay FhERa binding affinities to 4-t-octylphenol, 4-nonylphenol, benzophenone, di-n-butyl phthalate, dicyclohexyl phthalate, di-2-ethylhexyl phthalate, octachlorostyrene, and tributyltin chloride were measured. The chemicals were tested as they were designated priority substances for risk assessments by the Japanese
46
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Fig. 3. Domain structure of Fh (F. heteroclitus ) ER. Using the nomenclature of Krust et al. (1986), the five to six domains of ER (A-F domains) are indicated. Sequence identity with Medaka (NCBI BLAST identification number: Gi-1706707), chicken (Krust et al., 1986), mouse (White et al., 1987), human (Green et al., 1986) ERs. The overall identity of each region is shown as a percentage compared with the clone.
Fig. 2. Phylogenetic analysis of ER amino acid sequences including F. heteroclitus ER. This tree was constructed according to the clustal W method. The lengths of the vertical lines indicate reciprocal sequence similarities. NCBI BLAST identification numbers for each sequence are Atlantic croaker (A. Croaker) beta, Gi-10312208; A. Croaker gamma, Gi-10312210; catfish alpha, Gi-10945423; catfish beta, Gi7527468; chicken alpha, Gi-119597; chicken beta, Gi-13124227; Japanese eel, Gi-2073113; goldfish alpha, Gi-16118451; goldfish beta1, Gi-4666318; goldfish bata2, 7012683; gilthead seabream (GS) alpha, Gi-12643248; GS beta, Gi-13124245; human alpha, Gi-544257; human beta, Gi-1518263; medaka alpha, Gi-3915675; medaka beta, Gi18143643; mouse alpha, Gi-119599; mouse beta, Gi-1912468; rainbow trout (R. Trout) alpha, Gi-12643267; R. Trout beta, Gi-13124194; rat alpha, Gi-119600; rat beta, Gi-1373281; red seabream, Gi-2447038; tilapia type1, Gi-4098199; tilapia type2, Gi-4098201; X. laevis , Gi625330.
government in the ‘‘Strategic Programs on Environmental Endocrine Disrupters ’98 (SPEED’98)’’. The binding curves of chemicals are illustrated in Fig. 6. E2 bound to fhERa with an IC50 value of 5.5 /109 M. The binding affinities of the other chemicals are represented as relative binding affinity (RBA), which was calculated as a percent ratio of the IC50 values of test substances relative to E2. Table 2 shows the mean of RBA values of chemicals for fhERa. RBA values of 4-toctylphenol and 4-nonylphenol for fhERa were approximately 0.0067- and 0.0042-fold of E2, respectively. Benzophenone exhibited weak binding affinity, approximately 0.008% of E2. Phthalates also showed weak binding affinities (0.01/0.02% of E2). Di-n-butyl phtha-
Fig. 4. Transcriptional sizes and expressions of ER and VTG mRNA as analyzed by Northern blot analysis. The poly(A) RNA (1 mg each lanes), isolated from male (M) and female (F) livers, were separated on a denaturing formaldehyde agarose gel (1%).
late showed slightly higher receptor binding ability for the fhERa. Binding potency of octachlorostyrene to fhERa was estimated as 0.02% of E2.
4. Discussion Man-made chemicals have the potential to health and reproduction problems in human and wildlife (Colborn
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Fig. 5. Northern blot analysis of ER and VTG mRNA expressions in time series. The poly(A) RNA isolated from male liver at 0, 2, 4, 8, 12 and 24 h after E2 stimulation. Amounts of poly(A) RNA loaded on a denaturing formaldehyde agarose gel (1%) were 0.5 mg each lanes. Table 2 IC50 and RBA values of each chemical to fhERa Chemicals 17b-Estradiol Dibutyl phthalate Di(2-ethylhexyl) halate Dicyclohexyl phthalate 4-t -Octylphenol 4-Nonylphenol Benzophenone Octachlorostyrene Tributyltin chloride
IC50 (M) 9
5.5/10 5.3/10 5 3.2/10 5 3.8/10 5 8.5/10 7 1.3/10 6 7.3/10 5 2.9/10 5 3.3/10 6
RBA (%) 100 0.010 0.017 0.014 0.65 0.42 0.0075 0.019 0.17
47
et al., 1993). These chemicals, can act as hormonal agonists or antagonists, and have been called endocrinedisrupting chemicals (EDCs). Recent surveys have reported that many chemicals exhibiting ER affinity are widely distributed in the aquatic environment. It is the widespread nature of these contaminants and reports documenting that exposure to ecologically relevant concentrations of EDCs and or exogenous hormones early in development can cause permanent alterations of the reproductive, immune, and neurological systems that require further studies on the mechanisms by which these changes occur (Guillette et al., 1995; Iguchi et al., 2002a). A number of studies have revealed a risk of exposure of estrogens or estrogenic compounds during their early development (Crain et al., 1997; Willingham and Crews, 1999; Guillette et al., 1999; McLachlan, 2001; Iguchi et al., 2002a). We reported that exposure to estrogen early in the development of the mummichog (F. heteroclitus ), caused malformations, growth retardation, incomplete ossification, sex reversal and death of fry (Urushitani et al., 2002). In X. laevis , similar results have been reported by Nishimura et al. (1997). Furthermore, they demonstrated there was an effect of estrogen on ER mRNA expression during development. In mice, ER was expressed in the oocytes and fertilized eggs (Gorski and Hou, 1995). These findings suggested that estrogen can affect early development, and may have a specific direct effect on early osteogenesis through an ER-mediated mechanism. In the present study, fhER cDNA was isolated to further
Fig. 6. Concentration-dependent curves of chemicals in the receptor binding assay to measure the abilities to displace [3H]17b-estradiol. Abbreviations of chemicals were as follows; DBP, dibutyl phthalate; DEHP, di(2-ethylhexyl) phthalate; DCHP, dicyclohexyl phthalate; t -OP, 4-t octylphenol; NP, 4-nonylphenol; BP, benzophenone; OCS, octachlorostyrene; TBTCl, tributyltin chloride.
48
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
clarify the mechanisms by which exogenous estrogen affect development of teleost fish. To isolate the fhER, we used a cDNA library from mRNA of the sexually mature female liver during the spawning season. cDNA screening using RT-PCR product resulted in two cDNA clones containing complete open reading frame. Phylogenetic analysis of ER families indicates that fhER belongs to the ERa clusters consisting of tetrapod and fish ERa. Specifically, the fhER was clonally related to medaka ERa, tilapia type-1 ER, red seabream ERa, and gilthead seabream ERa (Fig. 2). These results indicate that the receptor we isolated and cloned in the mummichog should be classified as an ERa. The comparison between the deduced amino acid sequence of fhER and ERs of four species ER shows high levels of identity in the C and E domains. The C (DNA binding) domain is the most highly conserved (90 /95%) among ERs and our observation on the fhERa is consistent with this conclusion. This region is well conserved in the ER family, containing two zincfinger motifs (Schwabe et al., 1993). These structures are necessary for recognizing and binding to the target sites in DNA. These results suggested that fhER might interact with the target sites on DNA by a similar mechanism as reported for other species. The E (ligand binding) domain has high identity with other species’ ER amino acid residues, especially with the medaka ER, as it has 92% amino acid sequence identity. Several amino acid residues of this E domain have been identified as important for ligand binding, dimerization, and transcriptional activation functions (AF-2) (Lees et al., 1990; Danielian et al., 1992). The estradiol-binding studies of human ERa identified a number of amino acid residues (A350, E353, L387, I424, G521, H524, L525 and M628) as involved in ligand binding (Brzozowski et al., 1997; Ekena et al., 1996, 1998). These amino acids were conserved in the fhER (A356, E359, L393, R400, I430, G527, H530, L531 and M534). The His513, which plays an important role for dimerization in human ER, was conserved in the fhER (H519). In transactivation, the AF-2 region is conserved in fhER (L545 to L550), equivalent to the fhER region L539 to L544. The A/B domain shared a high identity with medaka ER (77%), compared with other ERs (15 /23%). The A/ B domain has a cell type and promoter specific transactivation function (AF-1) (Tora et al., 1989). Pakdel et al. (2000) indicated 45 amino acids differences in the A/B domain between short and long isoforms of rainbow trout ERa. These sequence differences in the A/ B domain suggested the presence of species or isoform specific mechanisms in the transactivation of ERs. The Northern blot analysis indicated the presence of two transcripts (5.5 and 4 kb) in the mummichog liver (Fig. 4). The presence of several transcripts of ER has
been reported in many other mammals and fishes (Weiler et al., 1987; Pakdel et al., 1990; Todo et al., 1996; Tchoudakova et al., 1999; Socorro et al., 2000). Moreover, two functional ERa isoforms, which differ by 45 amino acids in the A/B domain, were reported in trout (Pakdel et al., 2000). In Northern blot analysis of time course, the 4 kb transcript was rapidly observed (within 8 h) after exogenous treatment with E2, followed by the 5.5 kb transcript 12 h after E2 stimulation. At 24 h after E2 stimulation, the 5.5 kb transcript seemed to be expressed strongly. VTG mRNA was expressed from 8 h. Then, it tended to be expressed strongly at 24 h after E2 stimulation. Many studies showed that ER levels have been regulated by ligand in various animals and tissues. In trout’s hepatocyte culture, ER mRNA had increased after 2 h, and reached maximum expression 24 h after E2 stimulation. VTG mRNA was induced 8 h after E2 stimulation (Flouriot et al., 1996). In this study, the 4.5 kb transcript was expressed before the inducement of 5.5 kb transcripts and VTG mRNA expression. The 5.5 kb transcript was expressed from 8 h after E2 stimulation, and then VTG mRNA seemed to be expressed strongly. These results suggested that the both of 4 and 5.5 kb transcripts may be functional isoforms and play important roles in transcription of fhER and VTG mRNAs. It has been reported that alkylphenols are xenoestrogens (Soto et al., 1991; White et al., 1994). However, binding affinities of alkylphenols to various ERs from different species showed wide spectrum of responses, i.e. 4-t-octylphenol bound to rainbow trout ERa stronger than human ERa (Matthews et al., 2000), and binding affinity of nonylphenol for the ERa from testicular and liver cytosol of Atlantic croaker was comparable to human ERa (Loomis and Thomas, 1999; Tabira et al., 1999). RBA values of 4-t -octylphenol and 4-nonylphenol for fhERa were approximately 0.0067- and 0.0042fold of E2, respectively, and these values were 20 and 7 times greater in affinity when compared with the interaction between these chemicals and human ERa (Tabira et al., 1999). The binding affinities for the fhERa were similar to those reported for rainbow trout ERa using the same chemicals. Benzophenone exhibited weak binding affinity, approximately 0.008% of E2. Phthalates also showed weak binding affinities and they bound to fhERa at 0.01 / 0.02% the strength of E2. Di-n -butyl phthalate showed a slightly higher receptor binding ability for fhERa when compared with human ERa, however, its RBA value was no more than three times the RBA for human ERa (Nakai et al., 1999). Octachlorostyrene was inactive in both the human ER binding assay (Nakai et al., unpublished data) and immature rat uterotrophic assay (Yamasaki et al., 2002). However, its binding potency to fhERa was detectable (0.02% of E2). These results suggested there
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
are species differences in receptor binding abilities of various environmental pollutants. To resolve the ecotoxic effects of chemicals based on endocrine disruption mediated by receptor binding, it is necessary to measure the binding potencies of chemicals to various receptors, and evaluate the differences among species. Binding affinities of nonylphenol and octylphenol with fish ERa were higher in medaka (O. latipes ) than in the humans (Ministry of Environment, 2001). Breeding experiments performed with medaka exposed to nonylphenol levels reported in natural aquatic system in Japan, revealed increased incidences of ovotestis and decreases in the numbers of males produced. VTG expression was observed in fish exposed to nonylphenol levels of 11.6, 23.5 and 22.5 mg/l, respectively. Recent studies report that the maximum concentration of nonylphenol in Japanese river water is 21 mg/l. Based on these results, the Ministry of the Environment restricted the release of nonylphenol into the aquatic environment in 2001 (Iguchi et al., 2002b). We do not know whether chemicals used present study have a possibility to affect mummichog in the wild, since we have no wild mummichog in Japan. However, some of the chemicals may affect the medaka in Japan. There are species differences in ER binding to chemicals, therefore, we need to consider the species difference in the risk assessment of chemicals especially in fish species (Iguchi et al., 2002b). In conclusion, cDNA of fhERa was cloned, and the protein of the LBD of the fhERa binds E2 as well as alkylphenols which previously have been reported to have estrogenic activity. Interestingly, fhERa binds nonylphenol and octylphenol more than 50 times greater than that observed for the human ERa, suggesting species-specific differences in ligand binding of ERa.
Acknowledgements The authors thank Professor Louis Guillette, University of Florida, for critical reading of this manuscript. This work was partly supported by a Grant-in-Aid for Scientific Research on Priority (A) from the Ministry of Education, Sports, Science, Culture and Technology of Japan and a Research Grant from the Ministry of the Environment. H. Urushitani is a Research Fellow of the Japan Society for the Promotion of Science.
References Beato, M., 1989. Gene regulation by steroid hormones. Cell 56, 335 / 344. Beato, M., Herrlich, P., Schutz, G., 1995. Steroid hormone receptors: many actors in search of a plot. Cell 83, 851 /857. Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.L., Gustafsson, J.A.,
49
Carlquist, M., 1997. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753 /758. Colborn, T., Clement, C. (Eds.), 1992. Chemically-induced alterations in sexual and functional development: the wildlife/human connection. In: Advances in Modern Environment Toxicology. Princeton Scientific Publishing, Princeton, New Jersey, p. 403. Colborn, T., vom Saal, F.S., Soto, A.M., 1993. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ. Health Perspect. 101, 378 /384. Crain, D.A., Guillette, L.J., Jr, 1998. Reptiles as models of contaminant-induced endocrine disruption. Anim. Reprod. Sci. 53, 77 /86. Crain, D.A., Guillette, L.J., Jr, Rooney, A.A., Pickford, D.B., 1997. Alterations in steroidogenesis in alligators (Alligator mississippiensis ) exposed naturally and experimentally to environmental contaminants. Environ. Health Perspect. 105, 528 /533. Danielian, P.S., White, R., Lees, J.A., Parker, M.G., 1992. Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11, 1025 /1033. Ekena, K., Weis, K.E., Katzenellenbogen, J.A., Katzenellenbogen, B.S., 1996. Identification of amino acids in the hormone binding domain of the human estrogen receptor important in estrogen binding. J. Biol. Chem. 271, 20053 /20059. Ekena, K., Katzenellenbogen, J.A., Katzenellenbogen, B.S., 1998. Determinants of ligand specificity of estrogen receptor-alpha: estrogen versus androgen discrimination. J. Biol. Chem. 273, 693 /699. Evans, R.M., 1988. The steroid and thyroid hormone receptor superfamily. Science 240, 889 /895. Flouriot, G., Pakdel, F., Ducouret, B., Valotaire, Y., 1995. Influence of xenobiotics on rainbow trout liver estrogen receptor and vitellogenin gene expression. J. Mol. Endocrinol. 15, 143 /151. Flouriot, G., Pakdel, F., Valotaire, Y., 1996. Transcriptional and posttranscriptional regulation of rainbow trout estrogen receptor and vitellogenin gene expression. Mol. Cell. Endocrinol. 124, 173 /183. Gorski, J., Hou, Q., 1995. Embryonic estrogen receptors: do they have a physiological function. Environ. Health Perspect. 103 (Suppl. 7), 69 /72. Gray, L.E., Jr, Ostby, J., Ferrell, J., Rehnberg, G., Linder, R., Cooper, R., Goldman, J., Slott, V., Laskey, J., 1989. A dose /response analysis of methoxychlor-induced alterations of reproductive development and function in the rat. Fundam. Appl. Toxicol. 12, 92 /108. Green, S., Walter, P., Greene, G., Krust, A., Goffin, C., Jensen, E., Scrace, G., Waterfield, M., Chambon, P., 1986. Cloning of the human oestrogen receptor cDNA. J. Steroid Biochem. 24, 77 /83. Guillette, L.J., Jr, 2000. Contaminant-induced endocrine disruption in wildlife. Growth Horm. IGF Res. 10 (Suppl. B), S45 /S50. Guillette, L.J., Jr, Crain, D.A., Rooney, A.A., Pickford, D.B., 1995. Organization versus activation: the role of endocrine-disrupting contaminants (EDCs) during embryonic development in wildlife. Environ. Health Perspect. 103 (Suppl. 7), 157 /164. Guillette, L.J., Jr, Woodward, A.R., Crain, D.A., Pickford, D.B., Rooney, A.A., Percival, H.F., 1999. Plasma steroid concentrations and male phallus size in juvenile alligators from seven Florida lakes. Gen. Comp. Endocrinol. 116, 356 /372. Guzelian, P.S., 1982. Comparative toxicology of chlordecone (Kepone) in humans and experimental animals. Annu. Rev. Pharmacol. Toxicol. 22, 89 /113. Iguchi, T., Watanabe, H., Katsu, Y., Mizutani, T., Miyagawa, S., Suzuki, A., Sone, K., Kato, H., 2002a. Developmental toxicity of estrogenic chemicals on rodents and other species. Congen. Anorm. 42, 94 /105. Iguchi, T., Sumi, M., Tanabe, S., 2002b. Endocrine disruptor issues in Japan. Congen. Anorm. 42, 106 /119.
50
H. Urushitani et al. / Molecular and Cellular Endocrinology 203 (2003) 41 /50
Koike, S., Sakai, M., Muramatsu, M., 1987. Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res. 15, 2499 /2513. Krust, A., Green, S., Argos, P., Kumar, V., Walter, P., Bornert, J.M., Chambon, P., 1986. The chicken oestrogen receptor sequence: homology with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J. 5, 891 /897. Kuiper, G.G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J.A., 1996. Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 93, 5925 /5930. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987. Functional domains of the human estrogen receptor. Cell 51, 941 /951. Laudet, V., 1997. Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor. J. Mol. Endocrinol. 19, 207 /226. Lees, J.A., Fawell, S.E., White, R., Parker, M.G., 1990. A 22-aminoacid peptide restores DNA-binding activity to dimerization-defective mutants of the estrogen receptor. Mol. Cell. Biol. 10, 5529 / 5531. Loomis, A.K., Thomas, P., 1999. Binding characteristics of estrogen receptor (ER) in Atlantic croaker (Micropogonias undulatus ) testis: different affinity for estrogens and xenobiotics from that of hepatic ER. Biol. Reprod. 61, 51 /60. Matthews, J., Celius, T., Halgren, R., Zacharewski, T., 2000. Differential estrogen receptor binding of estrogenic substances: a species comparison. J. Steroid Biochem. Mol. Biol. 74, 223 /234. McLachlan, J.A., 2001. Environmental signaling: what embryos and evolution teach us about endocrine disrupting chemicals. Endocr. Rev. 22, 319 /341. Menuet, A., Pellegrini, E., Anglade, I., Blaise, O., Laudet, V., Kah, O., Pakdel, F., 2002. Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biol. Reprod. 66, 1881 /1892. Ministry of Environment, Japan, 2001. Report on the test results of endocrine disrupting effects of nonylphenol on fish. Mosselman, S., Polman, J., Dijkema, R., 1996. ER beta: identification and characterization of a novel human estrogen receptor. FEBS Lett. 392, 49 /53. Nakai, M., Tabira, Y., Asai, D., Yakabe, Y., Shinmyozu, T., Noguchi, M., Takatsuki, M., Shimohigashi, Y., 1999. Binding characteristics of dialkyl phthalates for the estrogen receptor. Biophys. Biochem. Res. Commun. 254, 311 /314. Nakamura, M., 1984. Effects of estradiol-17b on gonadal sex differentiation in two species of salmonids, the masu salmon, Onchorinchus masou , and the Chum salmon, O. keta . Aquaculture 43, 83 /90. Nishimura, N., Fukazawa, Y., Uchiyama, H., Iguchi, T., 1997. Effects of estrogenic hormones on early development of Xenopus laevis . J. Exp. Zool. 278, 221 /233. Pakdel, F., Le Gac, F., Le Goff, P., Valotaire, Y., 1990. Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell. Endocrinol. 71, 195 /204. Pakdel, F., Metivier, R., Flouriot, G., Valotaire, Y., 2000. Two estrogen receptor (ER) isoforms with different estrogen dependencies are generated from the trout ER gene. Endocrinology 141, 571 /580. Schwabe, J.W., Chapman, L., Finch, J.T., Rhodes, D., 1993. The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: how receptors discriminate between their response elements. Cell 75, 567 /578.
Shimizu, A., 1997. Reproductive cycles in a reared strain of the mummichog, a daily spawner. J. Fish Biol. 51, 724 /737. Socorro, S., Power, D.M., Olsson, P.E., Canario, A.V., 2000. Two estrogen receptors expressed in the teleost fish, Sparus aurata : cDNA cloning, characterization and tissue distribution. J. Endocrinol. 166, 293 /306. Soto, A.M., Justicia, H., Wray, J.W., Sonnenschein, C., 1991. p Nonyl-phenol: an estrogenic xenobiotic released from ‘‘modified’’ polystyrene. Environ. Health Perspect. 92, 167 /173. Tabira, Y., Nakai, M., Asai, D., Yakabe, Y., Tahara, Y., Shinmyozu, T., Noguchi, M., Takatsuki, M., Shimohigashi, Y., 1999. Structural requirements of para -alkylphenols to bind to estrogen receptor. Eur. J. Biochem. 262, 240 /245. Tchoudakova, A., Pathak, S., Callard, G.V., 1999. Molecular cloning of an estrogen receptor beta subtype from the goldfish, Carassius auratus . Gen. Comp. Endocrinol. 113, 388 /400. Todo, T., Adachi, S., Yamauchi, K., 1996. Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell. Endocrinol. 119, 37 /45. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., Chambon, P., 1989. The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59, 477 /487. Tremblay, G.B., Tremblay, A., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Labrie, F., Giguere, V., 1997. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol. Endocrinol. 11, 353 /365. Truss, M., Beato, M., 1993. Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14, 459 /479. Urushitani, H., Shimizu, A., Fukazawa, Y., Sato, T., Iguchi, T., 1997. Developmental effect on gonadal differentiation and bones in Fundulus heteroclitus . In: Kawashima, S., Kikuyama, S. (Eds.), Advances in Comparative Endocrinology, pp. 311 /315. Urushitani, H., Shimizu, A., Katsu, Y., Iguchi, T., 2002. Early estrogen exposure induces abnormal development of Fundulus heteroclitus . J. Exp. Zool. 293, 693 /702. Van Der Kraak, G.J., Hewitt, M., Lister, A., McMaster, M., Mankkittrick, K., 2001. Endocrine toxicicants and reproductive success in fish. Hum. Ecol. Risk Assess. 7, 1017 /1025. Weiler, I.J., Lew, D., Shapiro, D.J., 1987. The Xenopus laevis estrogen receptor: sequence homology with human and avian receptors and identification of multiple estrogen receptor messenger ribonucleic acids. Mol. Endocrinol. 1, 355 /362. White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175 /182. White, R., Lees, J.A., Needham, M., Ham, J., Parker, M., 1987. Structural organization and expression of the mouse estrogen receptor. Mol. Endocrinol. 1 (10), 735 /744. Willingham, E., Crews, D., 1999. Sex reversal effects of environmentally relevant xenobiotic concentrations on the red-eared slider turtle, a species with temperature-dependent sex determination. Gen. Comp. Endocrinol. 113, 429 /435. Xia, Z., Patino, R., Gale, W.L., Maule, A.G., Densmore, L.D., 1999. Cloning, in vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor. Gen. Comp. Endocrinol. 113, 360 /368. Yamasaki, K., Takeyoshi, M., Yakabe, Y., Sawaki, M., Imatanaka, N., Takatsuki, M., 2002. Comparison of reporter gene assay and immature rat uterotrophic assay of 23 chemicals. Toxicology 170, 21 /30.