Cloning and characterization of human TNFα promoter region

Gene, 131 (1993) 307-308 0 1993 Elsevier Science Publishers

B.V. All rights reserved.

307

0378-l 119/93/$06.00

GENE 07253

of human TNFa promoter region

Cloning and characterization

(Recombinant DNA; sequencing; polymerase chain reaction; tumor necrosis factor; transcription factors)

Shogo Takashiba, Lior Shapira, Salomon Amar and Thomas E. Van Dyke Department oj”Periodontology,

Eastman Dental Center, Rochester,

Received by J.A. Engler: 20 January

1993; Revised/Accepted:

NY14620,

3 I March/3

USA

1 March

1993; Received at publishers:

6 May 1993

SUMMARY

We report the sequence of a 1.2-kb human tumor necrosis factor alpha (TNFcr) promoter region, which was cloned using PCR. The sequence has several variations from two previous reports and exhibits many potential DNA-binding sites specific to mammalian gene regulatory proteins inducible by lipopolysaccharides.

The regulation of TNFa synthesis by monocytes/ macrophages in response to lipopolysaccharide (LPS) is an important proximal mediator of the immune response and tissue destruction processes. LPS has been shown to activate mouse TNFc( promoter via a DNA-binding protein NFKB (Collart et al., 1990; Shakhov et al., 1990; Drouet et al., 1991; Vincenti et al., 1992). Therefore NFKB has been believed to be important in the transcription of TNFa. However, it is not clear that LPS activates the human TNFcl transcription followed by the same pathway, since NFKB does not seem to participate in the LPSinduced activation of the human TNFcx promoter (Goldfeld et al., 1990). Furthermore, the two reports on nt sequences of the human TNFa promoter region are not identical (Nedwin et al., 1985; Nedospasov et al., 1986), suggesting individual sequence heterogeneity. We report the sequence of the human TNFcl promoter region cloned using PCR, which varies from those of Nedwin et al. (1985) and Nedospasov et al. (1986), and shows many Correspondence to: Dr. S. Takashiba, Department of Periodontology, Eastman Dental Center, 625 Elmwood Avenue, Rochester, NY 14620, USA. Tel. (716) 275-5038;

Fax (716) 244-7483.

Abbreviations: AP, activator protein; bp, base CCAAT/enhancer-binding protein; Egr-1, product

pair(s); C/EBP, of early growth

response gene 1; H-APF-I, hepatocyte-specific nuclear protein-l; kb, kilobase or 1000 bp; LPS, lipopolysaccharide(s); NF-IL6, nuclear factor IL6; NFKB, nuclear factor KB,; nt, nucleotide(s); Ott-2, octamerbinding transcription protein-2; PCR, polymerase chain reaction; SPI, common mammalian transcription factor binding to GC box; TNFa, tumor necrosis factor alpha; TNFa, gene (DNA) encoding TNFa.

potential binding sites specific to human gene regulatory proteins inducible by LPS (Faisst and Meyer, 1992). The S-flanking sequences of the human TNFcx, approximately 1.2-kb promoter region (-1052 to + 126), was cloned using PCR from genomic DNA extracted from peripheral leukocytes of a healthy individual, and compared to the published sequences (Nedwin et al., 1985; Nedospasov et al., 1986: Fig. 1). Sequence alternations (bp insertions, deletions, and changes) have been identified, but we could not completely exclude the possibility of PCR artifacts. However, this possibility seems remote, since three clones have been sequenced up to 300 bp from the S-end and were found to be identical. Comparison between our sequence and’ the published sequences of DNA-binding sites specific to gene regulatory proteins (Faisst and Meyer, 1992) revealed the existence of several potential DNA-binding sites specific to DNA-binding proteins (AP- 1, AP-2, C/EBP, Egr- 1, H-APF-1, NF-IL& Ott-2, Spl, and NFKB) in addition to three reported NFKB-binding sequences. Some of these proteins (Egr-1, NF-IL6, NFKB, and Ott-2) were seen to be LPS-inducible factors (Faisst and Meyer, 1992). Our data show the existence of individual sequence alterations in the human TNFu promoter region. Mralvig et al. (1988) showed stable individual variations in TNFc( secretion by human monocytes stimulated with LPS. They divided their study populations to ‘low’ and ‘high’ TNFa producers, and speculated that individual susceptibility to Gram-negative infection might be dependent on these variations. Our data demonstrates that sequence

Fig. I. The nt sequence 1985) and the potential (bold characters). published forward

Dots denote

NFKB-binding direction

of human TNFr promoter transcription factor-binding nt identical

sequences

(~1,

of specific sequence,

~2,

(STL) compared to previous reports (pTNFI: Nedospdsov regions. There are some sequence variations and potential

et al., 1986; pTNF2: Nedwin et al.. transcription factor-binding regions

to STL sequence, dashes denote gaps in the sequence to optimize the alignment. The three previously and ~3) are shown by bold characters with underline (Goldfeld et al., 1990). (-) or (+) shows reverse or

respectively.

The nt of PCR primers

are shown

with lower-case

letters. ‘rsp’ shows

transcription

start

point.

The nt sequence is avaiiable from GenBank under accession No. L 11698. Methods: PCR was performed in 50-pil reaction mixture containing 20 mM TriseHCI pH 8.2/10 mM KCI,!6 mM (NH&SO,/2 mM MgCI,:O.I% Triton X-100/l ug BSA/I ug human genomic DNA/ZOO uM each deoxynucleotide/l uM sense primer (5’GAGGCCGCCAGACTGCTGCAG) and antisense primer (5’-AGAACCTGCCTGGCAGCTTGTCA): 1.25 units of 7>1[/ DNA polymerase (Perkin Elmer Cetus. Norwalk, CT. USA) at the following thermal cycle: 3 min at 95 C for I cycle. 30 s at 95 C, 30 s 70 C, and 30 s (automatically elongated at I sjcycle after 20 cycles) at 74’ C for 40 cycles, then 74 ‘C for 7.5 min. The PCR-amplified DNA fragment (at 70 C‘ annealing

temperature)

and sequenced

following

was cloned

into Ml3mpl8

the dideoxynucieotjde

phage vector (Boehringer Chopin-termination

method

Mannheim.

Indianapolis.

using Seyuenase,

IN. USA). Single-stranded

2.0 (US Biochemical,

Cleveland,

DNA was rescued OH.

LJSAj with [.r-

35S]dATP (NEN Research Products. Boston. MA, USA). To eliminate PCR artifacts. the sequences of three clones which were chosen from 61 positive clones (90%) were verified to be same up to 300 nt from 5’.side of the cloned TNFr* promoter. Nine deletants (starting at -1052. -1007. single-stranded DNA -840. -641. -520, -477, -36,. 1 - 181. -123, --45 nt from rsp) were obtained from one clone and used for sequencing sequentially analysis

in one directron.

was performed

Each base was sequenced

using MacVector

(Kodak,

at least three times, The nt sequence

Rochester.

was compared

to published

sequences

and sequence

NY. USA)

alterations also exist in potential DNA-binding sites for human regulatory proteins which have been reported to be LPS-inducible by in leukocytes (Faisst and Meyer, 1992). These alterations might be at least partially responsible for the variations in individual responsiveness to LPS. The function of the potential DNA-binding proteins and their importance in the individual variations in TNFa transcription should be further investigated in human monocytes and macrophages.

Faisst, S. and Meyer. S.: Compilation of vertebrate-encoded tion factors, Nucleic Acids Res. 20 (1992) 3326.

transcrip-

Goldfeld, A.E., Doyle. C. and Maniatis, T.: Human tumor necrosis factor a gene regulation by virus and lipopolysaccharide. Proc. Natl. Acad. Sci. USA 87 (1990) 9769.-9773. Molvig, J., Baek, L., Christensen, P., Manogue. K.R.. Vlassara. H.. Platz, P., Nielsen, L.S., Svejgaard, A. and Nerup, J.: Endotoxin-stimulated human monocyte secretion of interleukin I. tumor necrosis factor alpha, and prostaglandin

E, shows stable interindividual

Stand. J. Immunol. 27 (1988) 7055716. Nedospasov, S.A., Shakhov. A.N., Turetskaya,

differences.

R.L.. Mett. V.A., Azizov.

M.M.. Ceorgiev, G.P., Korobko. V.G., Dobrynin, V.N., Filippov. S.A., Bystrov. N.S., Boldyreva, E.F., Chuvpilo. S.A.. Chumak(~v~ ACKNOWLEDGEMENTS

A.M.. Shingarova. L.N. and Ovchinnikov, ment of genes coding for tumor necrosis

This work was supported by NIH grant DE06436 and Pfizer Inc.

photoxin

REFERENCES Collart,

M.A., Baeuerle,

P. and Vassalli, P.: Regulation

of tumor

necro-

sis factor alpha transcription in macrophages: involvement of four KB-like motifs and of constitutive and inducible forms of NF-K-B. Mol. Cell. Biol. IO (1990) 1498t506. Drouet, C.. Shakhov, A.N. and Jongeneel, C.V.: Enhancers and transcription factors controlling the inducibility of the tumor necrosis factor-cl promoter in primary macrophages. J. Immunol. 147 (1991) I694- 1700.

(TNF-B) in the human

genome.

Y.A.: Tandem arrangefactor (TNF-r) and lymCold Spring Harbor

Symp.

Biol. 551 (19X6) 61 l-~624. Nedwin, G.E.. Nayler. S.L.. Sakaguchi. A.Y.. Smith. D.. JarrcttNedwin. J., Pennica. D.. Goeddel. D.V. and Gray. P.: Human lymphotoxin and tumor necrosis factor genes: structure. homology 13 (1485) and chromosomal localization. Nucleic Acids Rer @an.

636 I-6373. Shakhov. A.N.. Collart, M.A.. Vacsalli. P., Nedospasov,, S.V. and Jongeneel. C.V.: Kg-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor a gene in primary macr~)phages. J. Exp. Med. 17 I (l9YOj 35 37. Vincenti, M.P., Burrell. T.A. and Taffet. S.M.: Regulation of NF-rB activity in murine macrophages: effect of bacterial lipopolysaccharide and phorbol ester. J. Cell. Physiol. I50 (I 992) 204 2 13.