Cloning and Characterization of αP Integrin in Embryos of the Sea Urchin Strongylocentrotus purpuratus

Biochemical and Biophysical Research Communications 272, 929 –935 (2000) doi:10.1006/bbrc.2000.2878, available online at http://www.idealibrary.com on

Cloning and Characterization of ␣P Integrin in Embryos of the Sea Urchin Strongylocentrotus purpuratus Janine M. Susan, Margaret L. Just, 1 and William J. Lennarz 2 Department of Biochemistry and Cell Biology, and Institute for Cell and Developmental Biology, State University of New York at Stony Brook, Stony Brook, New York 11794-5215

Received May 15, 2000

Differentially expressed integrins have been shown to be involved in the intricate cell movements that occur during early development. Because the migration and movement of cells have been well characterized in sea urchin embryos, we searched for ␣-integrin subunits in this organism. An ␣ integrin subunit, ␣P, was cloned from Strongylocentrotus purpuratus mesenchyme blastula stage mRNA by RT-PCR and RACE and found to exhibit 74 –77% sequence similarity to mammalian ␣ 5, ␣ 8, ␣ IIb, and ␣ v integrin. The 8-kb transcript was most abundant at the prism stage, although low levels could be detected at all stages by Northern blot analysis and RT-PCR. A polyclonal antibody to this novel integrin was generated against a 100-aminoacid ␣P fragment fused to glutathione S-transferase and shown to recognize a 180-kDa ␣-integrin in the egg and in all stages of embryogenesis studied. © 2000 Academic Press

Key Words: sea urchin embryogenesis; ␣-integrin; cell migration.

Integrins are heterodimeric proteins consisting of ␣ and ␤ subunits, both of which are single spanning transmembrane glycoproteins. Most integrins have short cytoplasmic tails of 50 amino acids or less, except for ␤ 4, which has over 1000 residues in the cytoplasmic tail. Only the extracellular domains are required for noncovalent dimer formation because truncated forms lacking transmembrane and cytoplasmic domains still form functional dimers (1, 2). The ␣ subunits bind divalent cations and in some heterodimers this binding process is necessary for dimerization. As seen in electron micrographic images, both integrin subunits consist of globular N-terminal domains which associate to form the ligand binding region (3). These highly folded 1 Present address: Department of Pediatrics, Whittier Institute, University of California at San Diego, La Jolla, CA 92037. 2 To whom correspondence should be addressed. Fax: (631) 6328575. E-mail: [email protected].

domains are stabilized by extensive intrachain disulfide bonds (3, 4). The most distinct feature of all ␤ subunits is the absolute conservation of the positions of 56 Cys residues. Most of the Cys residues are arranged into four repeating segments thought to be internally disulfide bonded. In addition, a Cys residue near the amino terminus is linked via a disulfide bond to a Cys residue in the first repeat, further stabilizing the globular head domain (5, 6). Some of the ␣ subunits are posttranslationally cleaved near the transmembrane domain, but the 25to 30-kDa transmembrane chain remains associated to the much larger extracellular domain by a disulfide bond. All ␣ subunits contain seven tandem repeats. The divalent cation binding sites, consisting of the sequence DxDxDGxxD (or a similar sequence), are found in the third or fourth of these repeats. The nature of the bound cations can affect both the affinity and the specificity of the integrin for its ligands (7–9). Some ␣ subunits contain an extra segment of approximately 180 amino acids, known as an I domain, inserted before the cation-binding sites. The function of the I domain is unknown, but it may also contribute to ligand-binding specificity (10). Several lines of evidence have implicated integrin– ligand interactions as important elements in early embryonic development in mammals, frog and flies (11– 16). In the sea urchin it has been shown that gastrulation is interrupted by peptides corresponding to integrin ligand-binding domains (RGDS and/or PASS) introduced into the blastocoel (17). Also, the known integrin ligands, fibronectin and collagen, have been shown to be necessary for normal gastrulation in the sea urchin. Several ␤-integrins have been identified in embryos of the sea urchin, Strongylocentrotus purpuratus (18, 19). In the current study we have identified an ␣-integrin in the embryo of the sea urchin S. purpuratus. After this work was completed another sea urchin ␣-integrin (␣SU2), a laminin receptor, was described in Lytechinus variegatus embryos (20).

929

0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

MATERIALS AND METHODS Embryo cultures. Strongylocentrotus purpuratus were obtained from Marinus Corp. (Long Beach, CA). Gametes were collected and embryos cultured as described by Heifetz and Lennarz (21). RNA isolation and Northern analysis. Two hundred milliliters of a 0.5% embryo culture was centrifuged, and RNA was extracted from the embryo pellet (22). Ten to 20 ␮g of total RNA was separated by formaldehyde agarose gel electrophoresis and transferred to Hybond NX nylon membrane (Amersham Co.). The membranes were prehybridized for 1 h at 42°C in 50% formamide, 5⫻ SSC, 5⫻ Denhardt’s, 0.5 mg/ml salmon sperm DNA, 0.2% SDS, 50 mM NaPO 4 , pH 7.4. Hybridization was conducted in prehybridization buffer with 10% w/v dextran sulfate and 32 P-labeled probe overnight at 68°C for riboprobes. Blots were washed and exposed to XAR5 film (Kodak) at ⫺70°C. Riboprobes for the 38A141M integrin clone were synthesized according to Maxiscript Kit (Ambion Co.), with addition of 50 ␮Ci [␣- 32 P]UTP (DuPont NEN), and 10 units RNAsin (Promega Co.). cDNA synthesis and PCR. The initial identification of integrin ␣ subunits from sea urchin embryos was achieved using the method described by Whittaker and DeSimone (23) using degenerate oligonucleotide primers to amplify ␣ subunits from Xenopus. First strand cDNA was synthesized from 10 ␮g total RNA from a single developmental stage using 50 ng oligo dT 27 primer, 200 units Superscript II Reverse Transcriptase (Gibco BRL Corp.) as per the company protocol. The reaction mix was subjected to 40 rounds of amplification of hot start PCR using the following conditions: 94°C for 1 min, 48°C for 2 min, and 72°C for 3 min and 2.5 units Taq polymerase (Roche). The resultant product was termed 6T3. To extend the 6T3 product, RACE (both 5⬘ and 3⬘) was performed according to Frohman (24) using the Expand Long Template System (Roche). For 3⬘ ends: the first round reactions were done using 6T3FN primer (5⬘-GCTGGTAGGAGCACCCATGTTTAC-3⬘) and the second round with 6T3F1 (5⬘-GCTAGAAGCAGGACGGTGTACG-3⬘) and the proper RACE primers (24). This generated the PCR product termed 141. For 5⬘ ends the 5⬘ cDNA pool was amplified with primers 6T3R1 (5⬘-GCCCTGATCTTCTTTCCTG-3⬘) and 6T3R2 (5⬘-GCTATACACCCGTCCTGCTTCCC-3⬘) for rounds 1 and 2, respectively. The product was termed the 38 fragment. To extend the 38 fragment, the same 5⬘ cDNA pool was amplified with 6T3R2 (5⬘-GCTATACACCCGTCCTGCTTCCC-3⬘) for round 1 and 38.6R (5⬘-GCTAAGAGCTTGCCAGCGTAGCTC-3⬘) for round 2. This resulted in a clone named 70 fragment. RT-PCR primers used to generate clone 38A141M were TTGTGGAAGCAGRACTCATG and the reverse primer GTCAAAGATGGCCACCAGTC. For the clone 70A38Y, the forward and reverse primers used were ATAATCATGTCGAACGCCCG and TTCCAGGAGCTCCCATGACC, respectively. All PCR primers were synthesized by Operon or by BioSynthesis. PCR products were ligated into the pCR II vector (Invitrogen) following the manufacturer’s instructions. Plasmid DNA, purified using Qiagen columns was sequenced in the SUNY Stony Brook Sequencing Facility using the dideoxy chain termination method of Sanger et al. (25) using the ABI PRISM Dye Terminator Cycle Sequencing Kit (Applied Biosystems). The sequence was analyzed using MacVector Software. Antibody production. To prepare an anti-integrin antibody, the 6T3 PCR fragment was ligated into the EcoRI site of pGEX1 (Amersham-Pharmacia Biotech Inc.) to create a glutathione S-transferase fusion protein (GST-6T3). The same fragment was ligated into the EcoRI site of pMal-p2 (New England Biolabs) to create maltose binding protein fusion protein (MBP-6T3). The fusion proteins were purified using glutathione beads (Molecular Probes) or maltose beads (New England Biolabs) and polyclonal antibodies were generated at the Pocono Rabbit Farm and Laboratory (Canadensis, PA) by inoculating two rabbits with GST-6T3 protein.

IgG’s were purified from sera and preimmune sera by binding to Protein A agarose (Sigma) as described by Harlow and Lane (26). Immunospecific antibodies were purified by adsorption of IgG’s to MBP-6T3 fusion protein immobilized on nitrocellulose filters. Antibodies were eluted from the nitrocellulose with 1 mM EGTA, 2 mM glycine pH 2.8 and neutralized to 10 mM Tris pH 8. Protein isolation and Western analysis. Embryos were suspended in 4 volumes of 10 mM Tris–HCl, pH 8.0 with 1 ␮l/ml each protease inhibitor cocktails PIC I and PIC II (27) and suspensions were sonicated. To separate the membrane and soluble fractions, the samples were centrifuged 1 h at 100,000g. The supernatant was decanted and saved, and the pellets were extracted overnight at 4°C in 10 mM Tris–HCl, pH 8.0 containing PIC I, PIC II, and 2% deoxycholic acid. The deoxycholate extracts were centrifuged to pellet any remaining insoluble material and the supernatants were used for Western analysis. The protein samples (10 ␮g) were separated by SDS–PAGE and electrophoretically transferred to PROTRAN BA-83 nitrocellulose membrane (Schleicher & Schuell) in Towbin’s solution (28). The nitrocellulose membranes were blocked with 5% non-fat dry milk in TBST (20 mM Tris–HCl, pH 7.6, 137 mM NaCl and 0.1% Tween 20) for 1 h at RT. The blots were incubated with primary antibody in 0.5% non-fat dry milk (NFDM) in TBST for 1.5 h, RT. The blots were washed three times with 0.5% NFDM/TBST and incubated with peroxidase-conjugated goat anti-rabbit IgG secondary antibody (Roche) at 1:3000 dilution for 1.5 h, RT. After washing, the immune complexes were detected by chemiluminescence with LumiGLO (Kirkegaard and Perry Laboratory).

RESULTS Identification of an integrin ␣ subunit in the egg and embryos of S. purpuratus. To search for integrin ␣ subunits expressed in sea urchin embryos, degenerate oligonucleotides were used to amplify cDNA by homology PCR. The nucleotide consensus sequences for the primers were derived from conserved regions of previously identified ␣ subunits. X1 (forward primer) lies just 5⬘ to the third calcium binding motif, and X2 (reverse primer) includes the 3⬘- one-third of the fourth calcium binding domain (23). As diagrammed in Fig. 1 the primer pair, X1/X2, yielded a PCR amplification product of approximately 300 bp, termed 6T3, from a variety of templates: RNA from L. pictus gastrula stage, L. variegatus gastrula stage, and S. purpuratus unfertilized egg, 16-cell stage, blastula stage, early mesenchyme blastula stage, late mesenchyme blastula stage, gastrula stage, prism stage and pluteus stage (data not shown). The PCR product from S. purpuratus late mesenchyme blastula stage was subcloned and sequenced. Only 3 of 60 inserts were identical to each other and were similar to known ␣ integrins. Several other products were putative calcium binding proteins, one of which was shown to be calreticulin (data not shown). The cDNA fragment, 6T3, contains conserved ␣ integrin elements including portions of 2 divalent cation-binding motifs and a Gly-Ala-Pro (GAP) sequence (Figs. 1 and 2). Both the 5⬘ and 3⬘ ends of the gene corresponding to the 6T3 PCR ␣ integrin fragment were generated by classical RACE (24). Four independent 3⬘ RACE products (141.1, 141.4, 141.7, and 141.9) were cloned and

930

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 1. Diagrammatic representation of ␣ integrin RT-PCR and RACE clones. The top line represents a compilation of all the sequences. Nucleotides 289 –3459 code for the deduced open reading frame (ORF) of ␣P integrin. 6T3 is the initial RT-PCR clone obtained with degenerate primers X1 and X2; 141 is the 3253-bp 3⬘ RACE product of 6T3; 38 is the 678-bp 5⬘ RACE product of 6T3; 70 is the 649-bp 5⬘ RACE product of 38; 70A38Y and 38A141M are independent RT-PCR products linking the RACE clones.

sequenced. All 4 clones (represented collectively as 141 in Fig. 1) are 3253 bp in length, and contain 143 bp’s of overlap with 6T3. A number of 5⬘ RACE products of varying lengths were obtained; the 2 longest products were cloned and sequenced. Since the longest 5⬘ clone, 38, still lacked an initiating methionine, further amplifications were performed to extend the 5⬘ end. Using the same 5⬘ cDNA pool, 2 more rounds of amplifications were performed using the 38 clone as a starting point. This resulted in PCR product 70, which is 649 bp in length and contained the initiating methionine in addition to 5⬘ untranslated sequence. Additional RT-PCR clones were generated for two reasons: (a) to obtain independent clones to confirm the 5⬘ end nucleotide sequence and (b) to demonstrate that a single ␣-integrin product could be obtained by linking the 4 independent clones, 70, 38, 6T3, and 141. These reactions were done by performing 2 rounds of amplifications using nested primers of known sequence. This process linked the two 5⬘-most clones 70 and 38 in a PCR product termed 70A38Y (Fig. 1). The second “hookup experiment” linked all 3 RACE clones and encompassed 6T3. Four independent RT-PCR products (depicted collectively as 38A141M in Fig. 1) were cloned and sequenced, thereby confirming that the individual clones represent a single transcript. The S. purpuratus ␣P integrin transcript contains 288 bp of 5⬘ untranslated region (UTR) and 1099 bp of 3⬘ UTR (Fig. 2). According to Kozak’s rules, the atg codon at bp 289 (ACTatgG) occurs in a strong context (RNNatgG) for translational initiation (29). The de-

duced amino acid sequence using this start site codes for a cleavable N-terminal signal sequence of 16 residues as determined by PSORT using the vonHeijne method (http://psort.nibb.ac.jp:8800/). The 3⬘ UTR contains 3 potential polyadenylation signals (AAUAAA). Notable features present in the deduced amino acid sequence include 7 potential N-linked glycosylation sites, 4 potential calcium-binding motifs and a potential transmembrane domain (bp 968 –985). The predicted cytoplasmic tail is relatively short, 53 amino acids, and contains the highly conserved sequence KCGFFER. These features are highlighted in Fig. 2. A BLASTP search (30) of the deduced sequence of the sea urchin integrin ␣P full-length ORF shows that it is approximately 58% similar to chick integrin ␣ 8, 59% similar to human integrin ␣ 5, and 73% identical to the recently described ␣SU2 from L. variegatus (20). Expression of S. purpuratus integrin ␣P mRNA. A riboprobe of the 1088 bp RT-PCR fragment, 38A141M (see Fig. 1) was used to probe a Northern blot of 10 ␮g total RNA. A 5-day X-ray film exposure revealed a single message of approximately 8 kb (Fig. 3A). The message was detected at extremely low levels in the unfertilized egg, and not at all in early cleavage stages of development, but the level of expression then increased dramatically. When compared to the amount of ethidium bromide stained-ribosomal RNA in the corresponding lanes (Fig. 3B), it appears that the level of expression begins to increase at the gastrula stage, and reaches a maximum level at the prism stage.

931

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Nucleotide and deduced amino acid sequence of S. purpuratus integrin ␣P (su␣P). The nucleotide sequence and the deduced amino acid sequence (su␣P) are shown. The N-terminal signal sequence and the transmembrane domain (amino acid residues 968 –985) are underlined. Four calcium-binding motifs are highlighted with boxes. Seven potential N-glycosylation sites are overlined, and a potential calreticulin binding site is double underlined (GenBank Accession No. AAD55724).

In an alternative approach, RT-PCR was performed using RNA from various stages of development (Fig. 3C) and the PCR primer pair between clone 70 and 141. In contrast to the Northern analysis results, this procedure revealed that the message was present in all developmental stages and only minor differences in the amount of cDNA generated at each stage were seen with this technique. However it is important to note that this is a qualitative, rather than a quantitative method.

Western analysis of S. purpuratus ␣P integrin protein. Using a rabbit polyclonal antibody to the recombinant 6T3 fragment, an immunoreactive band of approximately 180 kDa was detected in the unfertilized egg and in all stages of embryogenesis (Fig. 4). The level of protein appeared to remain constant from the unfertilized egg through the late mesenchyme blastula stage, but then started to increase by the mid-gastrula stage, with a further increase by the prism stage.

932

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. Analysis of ␣P mRNA expression. (A) Hybridization of the 38A141M riboprobe to a blot of total RNA. Stages: UFE, unfertilized egg; 2-4c, 2– 4 cell; 16c, 16 cell; EB, early blastula; HB, hatched blastula; EMB, early mesenchyme blastula; LMB, late mesenchyme blastula; LG, late gastrula stage; Pr, prism. The relative positions of the 28S and 18S ribosomal RNA are indicated by the black diamonds. (B) The ethidium bromide-stained RNA gel before transfer shows the 28S and 18S ribosomes in each corresponding lane. (C) RT-PCR fragments of ␣P and suCalret amplified from an equal amount of cDNA at each stage. no, no template cDNA. Additional stages: B, blastula; MB, mesenchyme blastula; G, gastrula; Pl, pluteus.

DISCUSSION Because of the long term interest of our laboratory in the role of glycoproteins in cell– cell interactions in embryogenesis in the sea urchin, we utilized gene family PCR, which has been employed to identify ␣ integrin subunits in various systems to determine if ␣-integrins were present in the developing sea urchin

embryo. The result of this effort revealed that indeed an ␣-integrin was present in the developing embryo. The single putative ␣ integrin PCR product identified in mesenchyme blastula stage sea urchin embryos was obtained 3 times (clones 6T3, 6T5 and 6T12) out of the 60 fragments that were cloned and sequenced. In comparison, characterization of 100 PCR fragments amplified from stage 17 Xenopus embryos using the identical primer pair yielded 30 clones encoding putative ␣ integrins and these fell into 6 distinct categories (23). The PCR evidence suggests that, in contrast to the frog, in sea urchin embryos both the abundance (i.e., the level expressed) and the diversity (i.e., the number of different types of subunits) of integrins is low or the conservation is minimal. Comparison of the deduced sequence of the S. purpuratus ␣ subunit and corresponding deduced amino acid sequence of ␣ integrins from other species reveals identity scores in the 55–59% range and similarity scores in the 74 –77% range. This is lower than the 88 –92% identities reported for several human and guinea pig sequences across the same region (31) and between human and other rodent sequences (23). Classification within a group is based on similarity values of greater than 85%. One obvious explanation for this difference is the evolutionary divergence of mammals and echinoderms. Alternatively, S. purpuratus ␣P integrin may represent a novel ␣ subunit. Similarly, the other known invertebrate integrin ␣ subunits, ␣ PS1 and ␣ PS2 in D. melanogaster (32) and ␣ I and ␣ III in C. elegans (33), do not fit into the vertebrate classification scheme very well and were independently named. For similar reasons Marsden and Burke (18) named the ␤ integrins identified in S. purpuratus embryos independently. Interestingly, within the invertebrates integrins are not as conserved as mammalian integrins. Assuming the atg codon at bp 289 is the start site, the deduced sequence of S. purpuratus integrin ␣P contains a 16 amino acid cleavable signal sequence as judged by PSORT. The deduced amino acid sequence encodes a protein of 1038 residues with a predicted MW of 113 kDa after cleavage of the signal sequence. Typical ␣ integrin subunits are integral membrane glycoproteins with a single transmembrane domain, a

FIG. 4. Western analysis with polyclonal ␣-6T3 antibody to su␣P. Hybridization of ␣-6T3 antibody to a blot of protein extracts. Stages: UFE, unfertilized egg; 16c, 16-cell; EB, early blastula; HB, hatched blastula; EMB, early mesenchyme blastula; LMB, late mesenchyme blastula; G, gastrula; Pr, prism; Pl, pluteus. 933

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

short cytoplasmic domain, and a large highly folded extracellular domain. The predicted open reading frame of ␣P contains all the expected features for a non-I domain type ␣ integrin subunit including the conserved Cys residues and motifs. PSORT also predicts that sea urchin ␣P is a integral membrane protein based on the presence of a putative transmembrane domain of 18 amino acids (bp 968 –985). Other features characteristic of ␣ integrins found in the deduced sequence of sea urchin ␣P include 7 potential N-glycosylation sites and 4 calcium-binding motifs. These are presumably important to the function of integrin receptors, because all known ␣ subunits evaluated biochemically have been shown to be glycosylated and to bind calcium. Receptor function has been shown to be affected by divalent cation binding to the ␣ subunit because this binding is necessary for dimerization with the ␤ subunit and for subsequent ligand binding. Since this work was completed, an ␣-integrin from L. variegatus has been cloned and sequenced and several lines of evidence for its role as a laminin receptor have been reported (20). A comparison of L. variegatus sequence with that of the S. purpuratus ␣-integrin indicates a sequence identity of 73%. It is not known if these urchin integrins are functionally similar, but it would be interesting to determine if ␣P is a laminin receptor for S. purpuratus. Integrin sequences typically code for proteins with short cytoplasmic tails, approximately 50 amino acid residues in length, containing a highly conserved amino acid motif close to the transmembrane domain. Sea urchin ␣P codes for a deduced cytoplasmic domain of 53 amino acids and contains the sequence KCGFFER beginning 4 residues beyond the putative transmembrane domain. Previously, it was thought that the cytoplasmic domain did not contribute to the regulation or function of the integrin receptor. However, recent evidence indicates that control of receptorligand interactions may be regulated not only by the binding to cytoskeletal proteins, but also by binding of the KxGFFxR domain of the tail to calreticulin or other novel calcium-binding proteins (34). Northern blot and RT-PCR analysis reveals that ␣P is a maternally and zygotically expressed transcript. The mRNA level begins to increase at the gastrula stage and is maximal by the prism stage. Qualitative analysis using RT-PCR connecting fragments 70, 38, 6T3, and 141 revealed a message of the expected size from egg through pluteus stage cDNA. Likewise, immunoblots indicate that the ␣P protein is present in low abundance in eggs and throughout early development until the late mesenchyme blastula stage. The amount of ␣P integrin protein begins to increase thereafter and is most abundant by the prism stage. The developmental expression of the L. variegatus (20) ␣-integrin is different than that of S. purpuratus, since the L. variegatus protein is present at highest level in

eggs and then diminishes somewhat over development. It is interesting to note that Marsden and Burke (18, and personal communication) have found a similar pattern of expression for the S. purpuratus integrin ␤G subunit. Northern blot analysis revealed that ␤G was a maternally expressed transcript and could be detected at low levels during early development. However, in the case of ␤G the message abundance peaks earlier than that seen for ␣P, namely at the gastrula stage, and then declines slightly after gastrulation. Immunoblots indicate that ␤G expression parallels its mRNA expression in that it is present in low abundance in eggs and early developmental stages and it increases after initiation of gastrulation. However, unlike the mRNA expression levels, the protein level remains high through the pluteus stage. It is known that in the vertebrate systems several ␤ subunits associate with more than one ␣ subunit and vice versa. This results in a high degree of diversity in the integrin family of receptors because the subunit composition dictates the reciprocal ligand for a particular combination, and this in turn ultimately determines the function of the receptor. In this context it is of interest that in addition to ␤G, two other ␤ subunits, ␤C and ␤L have been identified in the sea urchin (18, and personal communication, R. Burke). Further studies will be necessary to characterize their mode of interaction with ␣P and the possible function of such complexes in embryogenesis. ACKNOWLEDGMENTS This work was supported by a NIH grant (HD18590) to W.J.L. Lorraine Conroy is acknowledged for preparation of this manuscript.

REFERENCES 1. Bodary, S. C., Lipari, T., Muir, C., Napier, M., Pitti, R., and McLean, J. S. (1991) J. Cell Biol. 115(Suppl.), 289a. 2. Dana, N., Fathallah, D. M., and Arnaout, M. A. (1991) Proc. Natl. Acad. Sci. USA 88(8), 3106 –3110. 3. Nermut, M. V., Green, N. M., Eason, P., Yamada, S. S., and Yamada, K. M. (1988) EMBO J. 7(13), 4093– 4099. 4. Beer, J., and Coller, B. S. (1989) J. Biol. Chem. 264(29), 17564 – 17573. 5. Albelda, S. M., and Buck, C. A. (1990) FASEB J. 4(11), 2868 – 2880. 6. Hynes, R. O. (1992) Cell 69, 11–25. 7. Gailit, J., and Ruoslahti, E. (1988) J. Biol. Chem. 263(26), 12927–12932. 8. Kirchhofer, D., Gailit, J., Ruoslahti, E., Grzesiak, J., and Pierschbacher, M. D. (1990) J. Biol. Chem. 265(30), 18525–18530. 9. Kirchhofer, D., Grzesiak, J., and Pierschbacher, M. D. (1991) J. Biol. Chem. 266(7), 4471– 4477. 10. Hemler, M. E. (1990) Annu. Rev. Immunol. 8, 365– 400. 11. Alfandari, D., Whittaker, C. A., DeSimone, D. W., and Darribere, T. (1995) Dev. Biol. 170(2), 249 –261. 12. Boucaut, J. C., Clavilier, L., Darribere, T., Delarue, M., Riou, J. F., and Shi, D. L. (1996) Int. J. Dev. Biol. 40(4), 675– 683.

934

Vol. 272, No. 3, 2000

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

13. Gawantka, V., Joos, T. O., and Hausen, P. (1994) Mech. Dev. 47(3), 199 –211. 14. Ramos, J. W., Whittaker, C. A., and DeSimone, D. W. (1996) Development 122(9), 2873–2883. 15. Roote, C. E., and Zusman, S. (1995) Dev. Biol. 169(1), 322–336. 16. Yang, J. T., Bader, B. L., Kreidberg, J. A., Ullman-Cullere, M., Trevithick, J. E., and Hynes, R. O. (1999) Dev. Biol. 215(2), 264 –277. 17. Katow, H., Yazawa, S., and Sofuku, S. (1990) Exp. Cell Res. 190, 17–24. 18. Marsden, M., and Burke, R. D. (1997) Dev. Biol. 181, 234 –245. 19. Marsden, M., and Burke, R. D. (1998) Dev. Biol. 203(1), 134 –148. 20. Hertzler, P. L., and McClay, D. R. (1999) Dev. Biol. 207(1), 1–13. 21. Heifetz, A., and Lennarz, W. J. (1979) J. Biol. Chem. 254(13), 6119 – 6127. 22. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156 –159. 23. Whittaker, C. A., and DeSimone, D. W. (1993) Development 117(4), 1239 –1249.

24. Frohman, M. A. (1994) PCR Methods Appl. 4(1), S40 –58. 25. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74(12), 5463–5467. 26. Harlow, E., and Lane, D. (1988) in Antibodies: A Laboratory Manual, p. 310, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 27. Foltz, K. R., and Lennarz, W. J. (1992) J. Cell Biol. 116(3), 647– 658. 28. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. USA 76(9), 4350 – 4354. 29. Kozak, M. (1996) Mamm. Genome 7(8), 563–574. 30. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215(3), 403– 410. 31. Erle, D., Sheppard, D., Bruess, J., Ruegg, C., and Pytela, R. (1991) Am. J. Res. Cell Mol. Biol. 5, 170 –177. 32. Brown, N. H. (1993) BioEssays 15(6), 383–390. 33. Wilson, R., et al. (1994) Nature 368, 32–38. 34. Naik, U. P., Patel, P. M., and Parise, L. V. (1997) J. Biol. Chem. 272(8), 4651– 4654.

935