Cloning and characterization of rat neuronal apoptosis inhibitory protein cDNA

Neurochemistry International 42 (2003) 481–491

Cloning and characterization of rat neuronal apoptosis inhibitory protein cDNA夽 Song-Woo Shin a , Min-Young Lee a , Gee-Youn Kwon b , Jong-Wook Park c , Min Yoo d , Soo-Kyung Kim b , Tae-Hwan Oh e , Byung-Kil Choe a,∗ a

College of Medicine, Institute for Medical Science, Kosin University, 34 Amnamdong, Seo-Gu, Busan 602-702, South Korea b Department of Pharmacology, School of Medicine, Keimyung University, Daegu, South Korea c Department of Immunology, Keimyung University, Daegu, South Korea d Department of Biology, College of Natural Science, Keimyung University, Daegu, South Korea e Department of Anatomy, School of Medicine, University of Maryland, Baltimore, MD, USA Received 3 July 2001; received in revised form 12 September 2002; accepted 12 September 2002

Abstract The human neuronal apoptosis inhibitory protein (NAIP) gene was originally discovered because of its deletion in infantile spinal muscular atrophy (SMA), a childhood genetic disorder characterized by motor neuron loss and progressive paralysis with muscular atrophy. Although SMA is now known to be caused by deletions of survival motor neuron (SMN), the fact that NAIP is an anti-apoptotic protein is consistent with the NAIP gene modifying SMA severity. Here we report the cloning of a 1.5 kb rat NAIP cDNA fragment which contains BIR-3 (third baculovirus inhibitory repeat) domain. This fragment shows 78% homology to the human NAIP and 86% homology to the murine counterpart. We have investigated the distribution of NAIP mRNA expressing neurons by in situ RT-PCR technique in the rat central nervous system (CNS). Although all of the neurons appeared to express NAIP mRNA ubiquitously, pronounced elevation of NAIP mRNA expression was observed in the areas innervated by glutamatergic neurons after kainic acid (KA) injection. We have raised an anti-rat NAIP antiserum in rabbits using NAIP cDNA and recombinant rat NAIP, and carried out an immunohistological investigation. We observed highly immunoreactive neuronal subpopulations in the retinal ganglion, cerebral cortex, hippocampus, basal forebrain, thalamus, areas of midbrain, Purkinje cells of the cerebellum, and motor neurons in the spinal cord. Increased immunoreactivity of glutamatergic neurons was also observed broadly in the CNS after KA treatment. This study provides additional evidence that expression of mRNA and gene products of NAIP seem to be regulated in response to excessive stimuli or injuries in rat CNS, and these results are compatible with an anti-apoptotic role of NAIP in acute SMA as well as in brain injuries. © 2002 Elsevier Science Ltd. All rights reserved. Keywords: Rat NAIP cDNA; In situ RT-PCR; Immunohistochemistry

1. Introduction Spinal muscular atrophy (SMA) is one of the most common childhood hereditary neurodegenerative disorder and is characterized by early degeneration of motor neurons in the spinal cord and brain stem (Dubowitz, 1978). The major clinical finding is proximal, symmetrical limb and trunk muscle weakness, and this disorder affects 1 in 10,000 live births. Murayama et al. (1991) reported that the chromatolysis of the motor neurons in the SMA spinal cord resembles the apoptotic cells. In 1995, two candidate genes for SMA, survival motor neuron (SMN, Lefebvre et al., 1995) 夽

Genbank accession number for the rat NAIP is AF361881. Corresponding author. Tel.: +82-51-990-6619; fax: +82-51-990-3029. E-mail address: [email protected] (B.-K. Choe).

∗

and neuronal apoptosis inhibitory protein (NAIP, Roy et al., 1995), were identified. Mutations of SMN gene are found in nearly 100% of affected SMA individuals (Crawford and Pardo, 1996; Lefebvre et al., 1995). Gene ablation of the single mouse SMN gene resulted in massive cell death early in embryonic development (Schrank et al., 1997). Therefore, it has been established that SMN is the SMA causing gene. However, acute SMA is also associated with deletion of NAIP gene (Roy et al., 1995). The NAIP was so named because of its sequence homology with baculoviral apoptosis inhibitory proteins (Cp-IAP: Crook et al., 1993; Op-IAP: Birnbaum et al., 1994). Overexpression of NAIP and other apoptosis inhibitory proteins has been demonstrated to prevent apoptosis induced by a variety of death signals (Liston et al., 1996; Xu et al., 1997a,b; Simons et al., 1999; Mercer et al., 2000; Perrelet

0197-0186/02/$ – see front matter © 2002 Elsevier Science Ltd. All rights reserved. PII: S 0 1 9 7 - 0 1 8 6 ( 0 2 ) 0 0 1 4 2 - 0

482

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

et al., 2000). Unlike SMN gene ablation, NAIP knock-out mice were shown to develop normally. However, the hippocampal pyramidal neurons of such mice were shown to be highly vulnerable to kainic acid (KA)-induced limbic seizures (Holcik et al., 2000). There have been reports indicating the correlation between the neurons showing high level NAIP-immunoreactivity and those neuronal subpopulations that have been reported to display histopathological alterations in severe forms of SMA (Xu et al., 1997a,b; Pari et al., 2000). Expression of NAIP has been reported also in other non-neuronal tissue cells (Roy et al., 1995; Magun et al., 1998; Diez et al., 2000). To elucidate the function of NAIP protein and its role in the pathogenesis of SMA, we are using the rat as an experimental model. As the first step toward this goal, we report a 1.5 kb rat NAIP cDNA fragment and describe the expression of NAIP mRNA and protein in the rat central nervous system (CNS). We report that NAIP mRNA and protein are highly upregulated in the glutamatergic neurons after KA injections. 2. Experimental procedures 2.1. Animals Young Sprague–Dawley rats weighing 50–70 g were housed in a temperature-controlled environment with a 12 h light/12 h dark cycle and were given free access to food and water. All animal procedures conformed to the Guidelines for the Care and Use of Experimental Animals endorsed by the Korean Society of Experimental Animals. 2.2. Molecular biological methods

Table 1 List of oligonucleotide primers used Primer

Sequence

Direction

P1 P2 P3 P4 P5

GCATGCCAAGTGGTTCCCCAAATG CACCTATGGCTGTTGAAGCTCTGGT TGGGCGGTGAATTTGCTCATCAAGC CCCACTGTAGTCATCCAACAG GATCATCGTGGTTGCTTTCACTTGTG

Sense Sense Antisense Antisense Antisense

embedded in the molten paraffin in metallic blocks, covered with flexible plastic molds. Coronal sections with 7 ␮m thickness were made from each sample and serially mounted on 3-aminopropyltriethoxysilane (Sigma, St. Louis, MO, USA)-coated slides. For the preparation of brain and spinal cord cDNA library, brains and spinal cords were immediately processed after the transcardiac perfusion and decapitation. 2.4. Oligonucleotide primers The sequences of oligonucleotide primers used in this study are shown in Table 1. All nucleotides were synthesized by and purchased from Bioneer (Taejon, South Korea). 2.5. In situ RT-PCR Details of the methods such as tissue preparation, slide preparation, and cycling condition have been described elsewhere (Shin et al., 1998). In brief, rat brain was cryosectioned at a thickness of 10 ␮m. Then sections were mounted onto 3-aminopropyltriethoxysilane-coated slides. Sections were fixed in 4% paraformaldehyde for 20 min, washed three times in PBS. Sections were then treated with RNase-free

For the standard molecular biological techniques such as nucleic acid extraction, cDNA cloning, DNA sequencing, recombinant protein production, and Western blotting, methodologies described by Ausubel et al. (1995) were followed. 2.3. Tissue preparation Experimental rats were divided into two groups: salinetreated normal group and KA (10 mg/kg, i.p.)-injected group. Rats were sacrificed at 4 and 24 h after KA treatment. Animals were anesthetized with pentobarbital sodium and perfused transcardially with heparinized phosphate-buffered saline (PBS) followed by 10% phosphate-buffered formalin (PBF) for immunohistochemical investigation. For in situ RT-PCR, the brains were removed, snap-frozen in isopentane (−70 ◦ C), and cryosectioned at 10 ␮m thickness. For immunohistochemistry, the brains were removed, postfixed for 1–2 days in 10% PBF. The fixed brain tissues were processed in an automatic tissue processor and carefully

Fig. 1. Agarose gel electrophoresis of PCR products from a rat brain cDNA library. PCR primers used for lanes 1–6 were P1/P3 (1554 bp), P1/P4 (1018 bp), P1/P5 (488 bp), P2/P3 (1327 bp), P2/P4 (791 bp), P2/P5 (261 bp), respectively. M represents the 100 bp DNA ladder size maker.

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

DNase (8 U/100 ␮l; Promega, USA) for 3 h at 37 ◦ C to get rid of genomic DNA, followed by heating at 94 ◦ C for 2 min. The cDNA was generated in a solution containing 6 ␮l of 5× RT buffer, 6 ␮l of 10 mM dNTPs, 100 pmol of oligo (dT)16 , 20 U of RNasin, 100 U of M-MLV reverse transcriptase (Promega, USA) and DEPC-treated RNase-free deionized water to a total volume of 30 ␮l. Sections were covered with plastic coverslips and incubated for 1 h at 42 ◦ C on a thermocycler OmniGene (Hybaid, UK). After RT reaction sections were washed with deionized water and dehydrated with absolute ethanol. Slide seal for in situ PCR (TaKaRa, Japan) was located around the section on the slide and covered with PCR mixture. In situ PCR was carried out in a solution containing 3 ␮l of 10× buffer, 3 ␮l of 10× PCR

483

dig labeling mix (Roche, Germany), 25 pmol of sense and antisense primers, 2.5 U of Taq DNA polymerase and deionized water to a total volume of 30 ␮l. Cycling conditions were as follows: denaturation at 94 ◦ C for 30 s, annealing at 65 ◦ C for 30 s and extension at 72 ◦ C for 30 s, total 30 cycles. 2.6. Antiserum to rat NAIP A polyclonal rabbit antibody was used to detect NAIP-immunoreactivity. This antibody was generated from the recombinant NAIP in the following manner. Rat NAIP cDNA fragment (1–488 bp in Fig. 2) was subcloned into the pET-28C (Novagen, USA) and into the pcDNA-3 (Novagen,

Fig. 2. Nucleotide and amino acid sequences of the rat NAIP deduced from pT7/13 plasmid. Total 1554 bp matched up to the corresponding region of mouse NAIP cDNA sequence (Yaraghi et al., 1998). PCR primers used (P1–P5) are underlined and labeled as boxed numbers 1–5. BIR-3 domain is boxed (185–450 bp).

484

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

USA) utilizing the BamHI and HindIII sites. Rabbits were first immunized with 300 ␮g of pcDNA-3-NAIP and 30 days later boosted twice with affinity purified pET-28C recombinant protein in incomplete Freund’s adjuvant. Titers of anti-NAIP antibody were monitored by Western blot analysis using SDS-PAGE and purified recombinant NAIP. 2.7. Immunohistochemistry Immunohistochemistry was performed by using a standard procedure described by Choe and Cho (1994). Briefly, coronal sections were deparaffinized in xylene, hydrated in a graded series of ethanol (100, 95, 80 and 70%) and PBS. Sections were incubated for 30 min in methanol containing 0.3% H2 O2 to block endogenous peroxidase activity. Then, the tissue sections were washed in PBS and antigen retrieval was done with microwave irradiation

Fig. 3. SDS-PAGE of recombinant rat NAIP (1554 bp fragment). Each lane represents different batches of NAIP purified by the his-tag affinity column chromatography. The molecular weight of recombinant proteins is approximately 58 kDa, and M represents wide-range protein molecular weight size maker.

Fig. 4. (A) Expression of NAIP mRNA in normal rat CNS. M: molecular weight marker, 1: spinal cord, 2: cerebellum, 3: brain stem, 4: cerebrum, 5: retina. After reverse transcription at 42 ◦ C for 1 h, PCR was carried out according to the following cycling parameters: 94 ◦ C for 30 s, 65 ◦ C for 30 s, 72 ◦ C for 30 s, total 30 cycles. (B) In situ RT-PCR profiles of normal rat CNS. 1: hippocampal neurons (CA3), 2: cortical neurons of cerebrum, 3: single file of Purkinje cells (large faintly stained cells) and granule cells (small deeply stained cells in the cerebellum), 4: gigantic cells in the deep nuclei of the cerebellum, 5: motoneurons (faintly stained large cells) in the spinal cord, 6: retina (ganglion cell layer, interneuron layer, photoreceptor cell layer). Magnification: 200×.

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

485

Fig. 5. Immunoblot showing the 27 kDa recombinant rat NAIP (cDNA: 1–488 bp) polypeptide by the anti-rat NAIP antiserum (B). Each lane was loaded with 20 ␮g of different batches of partially purified NAIP preparations. Panel (A) is a representative picture of SDS-PAGE.

(370 W, 10 min in 0.01 M citrate buffer, pH 6.0). After two PBS washes, the sections were incubated overnight at 4 ◦ C with the NAIP (diluted 1:200) primary antisera. Immunolabeling was detected using biotinylated universal

immunoglobulins followed by visualization with a streptavidin peroxidase kit (DAKO LSAB kit). The sections were counter-stained in hematoxylin, and mounted with Canada Balsam.

Fig. 6. Immunohistochemistry of NAIP in normal rat CNS: (A) hippocampal neurons (CA3), (B) cortical neurons of cerebrum, (C) Purkinje cells in the cerebellum, (D) neurons of deep cerebellar nuclei, (E) motoneurons of spinal cord, (F) retina (ganglion cell and photoreceptor cell layers are deeply stained while interneuron layer is faintly stained). Magnification: 400×.

486

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

3. Results

molecular size of recombinant NAIP was approximately 58 kDa (Fig. 3).

3.1. Rat NAIP cDNA cloning 3.2. NAIP mRNA expression in the rat CNS For the isolation of rat NAIP cDNA, RT-PCR cloning technique was adopted using total RNA from rat brain and spinal cord, and oligonucleotide primers based on the human NAIP cDNA (Roy et al., 1995; Liston et al., 1996). Initial two primer sequences were selected from the cDNA regions showing the highest homology to the baculoviral anti-apoptosis proteins, Cp-IAP (Cydia promonella, inhibitor of apoptosis; Crook et al., 1993) and Op-IAP (Orgyia pseudotsugata, Birnbaum et al., 1994) (Table 1). From the primer pairs P1/P3, P2/P3, P1/P4, P2/P4, P1/P5, P2/P5, initial RT-PCR resulted in two expected cDNA fragments from P1/P3 and P1/P5 pairs (Fig. 1). However, only one fragment was identified as a presumptive rat NAIP cDNA after the Southern blotting, subcloning, sequencing and homology search (Fig. 2). This rat NAIP fragment, showed 78% homology to the human NAIP (Roy et al., 1995) and 86% homology to the murine NAIP (Yaraghi et al., 1998). This 1554 bp rat NAIP cDNA fragment (Fig. 2) yielded recombinant protein in E. coli BL21(DE3) pLys S, and the

To examine an association between the pattern of NAIP mRNA expressing neuronal population and that of immunohistologically distinctive neuronal population, we investigated NAIP mRNA expressing cells in the normal rat retina, cerebrum, brain stem, cerebellum and spinal cord by RT-PCR (Fig. 4A) and in situ RT-PCR (Fig. 4B) using P1/P5 primers (Table 1). This primer pair amplifies exclusively the BIR-3 domain of the rat NAIP molecule. In case of in situ RT-PCR of the rat brain RNA, thin sections were first transcribed into total cDNA using random hexamers and reverse transcriptase, and P2/P4 primers were then used to amplify the BIR-3 domain sequence of all NAIP transcripts present in each neural cell. Nearly all of the neurons were expressing weak to high level of NAIP mRNA as shown in Fig. 4B. Cortical pyramidal cells and hippocampal neurons displayed high level of NAIP mRNA (Fig. 4B–1 and B–2). In cerebellum, Purkinje cells, granule cells and neurons in the deep nuclei exhibited

Fig. 7. In situ RT-PCR profiles of NAIP in dentate gyrus of KA-treated rat cerebrum: (A, C and E) normal (saline-treated), (B, D and F) KA-treated. Magnifications: (A and B) 2×, (C and D) 40×, (E and F) 100×.

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

moderate to high level of mRNA (Fig. 4B–3 and B–4), also motor neurons and other neurons in the spinal cord appeared to express low to moderate level of NAIP mRNA (Fig. 4B–5). In particular, retinal neurons showed the highest level of NAIP mRNA expression in the rat CNS. All three layers of retinal neurons expressed NAIP (Fig. 4B–6). 3.3. Distribution of NAIP-immunoreactivity in rat CNS We raised an anti-rat NAIP antiserum specific to BIR-3 domain (488 bp, cf. Fig. 2). The immunoblotting shows that this antiserum detects a single band of 27 kDa protein, which recognized the recombinant rat NAIP fragment as well as its partially purified crude NAIP preparations (Fig. 5). In contrast, preimmune sera or pre-absorbed antisera failed to detect this band. These results combined with the preliminary immunohistological labeling of neural cells indicated that the antibody recognizes mostly NAIP in neurons. 3.3.1. Cerebrum and retina Nearly all neurons exhibited immunoreactivity to anti-NAIP antiserum including the choroid plexus. All the pyramidal neurons in the CA1–CA3 subfields and granule

487

cells of dentate gyrus showed immunoreactivity just like the NAIP mRNA profile of hippocampus (Fig. 6A). Most layers of the neocortical pyramidal neurons were prominently stained (Fig. 6B). Deeply stained neurons were observed in the globus pallidus, thalamus, habenula and hypothalamus. Rest of the brain subfields contained numerous weakly to moderately stained neurons. All of the retinal neurons were prominently stained except interneurons (Fig. 6F). The immunoreactivity of ganglion cells and photoreceptor segment of rod and cone cells suggested the highest concentration of NAIP in the rat CNS. 3.3.2. Cerebellum and pons Purkinje cells were predominantly immunoreactive whereas the granule cell population appeared to have very little NAIP (Fig. 6C). Most cells in the vicinity of ventricular canal and pons, presumably neurons in the cerebellar deep nuclei, were prominently immunoreactive (Fig. 6D). Also, pons contained numerous large immunoreactive neurons. 3.3.3. Spinal cord The most prominently immunostained cells in ventral horn were very large neurons, presumably motoneurons

Fig. 8. In situ RT-PCR profiles of NAIP in KA-treated rat cerebellum: (A, C and E) normal (saline-treated), (B, D and F) KA-treated. Magnifications: (A and B) 2×, (C and D) 40×, (E and F) 100×.

488

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

(Fig. 6E). However, a large number of weakly stained small neurons, presumably interneurons and sensory neurons were also observed. Numerous fiber staining was also observable within white matter of the spinal cord. 3.4. Modulation of NAIP mRNA and protein expression Although their expression levels were variable, the expression of NAIP mRNA and protein in normal rat CNS was ubiquitous by in situ RT-PCR or immunohistochemistry. Therefore, inducibility of NAIP mRNA or gene product was investigated after the application of neuronal stress or injury using a glutamate agonist, KA. Rats were injected intraperitoneally with KA (10 mg/kg) and brains were examined at 4, 24, 48, and 72 h for the expression of NAIP

mRNA by in situ RT-PCR and gene product by immunohistochemistry. Some of the representative in situ RT-PCR data are shown in Figs. 7 and 8. NAIP mRNA expression was enhanced with a progressive increase during the first 4–24 h, and remained constant over 48–72 h in the brain areas packed with glutamatergic neurons. For example, some of those cell populations included cortical pyramidal cells, hippocampal neurons at the subfields (Fig. 7), cerebellar granule cells (Fig. 8), and interneurons in the spinal cord. We observed comparable results in the immunohistochemical investigation of the same series of experiments (Fig. 9). Cortical pyramidal cells, CA3 subfields, dentate gyrus neurons (Fig. 9A and B), cerebellar granule cells (Fig. 9C and D) and interneurons in the spinal cord (Fig. 9E and F) as well as the retinal interneurons (Fig. 9G and H) showed enhanced immunohistochemical staining over

Fig. 9. Immunohistochemistry of NAIP in KA-treated rat CNS: (A, C, E and G) normal (saline-treated), (B, D, F and H) KA-treated. Arrows indicate the areas rich in glutamatergic neurons, particularly KA-sensitive neurons. (A and B) Hippocampal neurons (CA3), (C and D) cerebellum, (E and F) interneurons of the spinal cord, (G and H) some KA-sensitive interneurons in the retina. Magnification: 400×.

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491 Table 2 A summary: NAIP mRNA and antigen expressing areas of rat CNS Areas examined

mRNA expressing neurons

Antigen expressing neurons

Normal

KA

Normal

KA

+

++

+++

++

Hippocampus CA1–CA3 Dentate gyrus

+++ ++

+++ ++

++ +

+++ ++

Caudate putamen Globus pallidus Thalamus Hypothalamus Choroidal plexus

++ + ++ + ++

Cerebrum Neocortex

Cerebellum Cortex Purkinje cell Granule cell Cerebellar nuclei

+ +++

+ + + + ++

+++

+

Spinal cord Motoneurons Other neurons

+ +

Retina Ganglion cells Interneurons Photoreceptor cells

+++ +++ +++

+++ ±

+

+++

++

++

+++ ++ +++ ± +++

+++

++

normal controls. Distribution of NAIP mRNA and protein expressing cell populations in the normal and KA-treated rat CNS are summarized in the Table 2 for comparison. As clear from Table 2, the correlation between NAIP mRNA and protein is variable from one area to another. This may reflect differences in the transcript and protein half-lives of intracellular NAIP in each cell population as well as possible differences in translation rates. Furthermore, the inducibility of NAIP mRNA or gene product was evaluated by RT-PCR and immunoblotting using brain homogenates (Fig. 10). As shown in Fig. 10A, NAIP mRNA levels were increased 48–72 h after KA treatment. Similarly, various sizes of anti-NAIP antibody-stained proteins were increased 48–72 h after KA treatment in the same brain homogenates (Fig. 10B). Whether the multiple sized groups of anti-NAIP antibody-reactive proteins represent the mature and incomplete NAIP fragments is not established in this investigation.

4. Discussion In this study, we present the cloning and characterization of a partial sequence of rat NAIP cDNA. This cDNA fragment with an open reading frame (ORF) is 1554 bp long and encodes a protein of 518 amino acids with an approximate molecular mass of 58 kDa. Sequence comparison at the

489

nucleotide level indicated that cDNA is 78% homologous to its human counterpart and 86% homologous to murine NAIP cDNA. The cDNA fragment contains a BIR-3 (baculovirus IAP repeat) domain (Fig. 2), a common structural motif in IAP family. This region is theoretically capable of supporting protein–protein interactions and is believed to play a critical role in mediating cell survival (Mercer et al., 2000). Two approaches were used to characterize the function of rat NAIP. As Xu et al. (1997a,b) had attempted, we have investigated the distribution of NAIP in the rat CNS to determine whether NAIP is concentrated in particular neuronal subpopulations that are at risk in SMA. We have also investigated whether neuronal injuries enhance NAIP gene expression by in situ RT-PCR and immunohistochemistry. Immunohistochemical findings indicated broad distribution of NAIP in the rat CNS, confirming most of the results of NAIP mRNA expressing cell population (Figs. 4 and 6). Immunoreactive neurons were detected in the neocortex, hippocampus, basal forebrain, thalamus, habenula, the globus pallidus and various areas of brain stem. In the cerebellum, NAIP-immunoreactive cells were not limited to Purkinje cells but also included the deep nuclear granule cells. In the spinal cord, prominently immunostained cells were the large motor neurons and weakly immunostained cells were detected in the Clarke’s column. We observed a few different findings compared to the reports made by Xu et al. (1997a,b) and Pari et al. (2000). Our antibody stained not only those neurons reported by them, but also whole masses of granule cells in the cerebellum after KA treatment (Fig. 9). They described ␣-motoneurons as the exclusively immunoreactive cells, however our antibody stained numerous smaller neurons, presumably the interneurons and sensory neurons, in the spinal cord after KA treatment (Fig. 9). Unlike the findings we observed in the rat brain, Pari et al. (2000) could not detect any NAIP-immunoreactive neurons in the hippocampus and cerebellum of the human brain sections. Interesting point is that Xu et al. (1997a,b) studied rat brain with anti-human NAIP antibody and Pari et al. (2000) studied human brain with the same antibody. All of those fine discrepancies may relate to the species specificity of the NAIP, more specifically to variable expression of variable numbers of NAIP isotypes among different neuronal subpopulations. Variable copies of intact and partially deleted forms of the NAIP gene have been found at the 5q13.1 human chromosome, suggesting the presence of variable number of NAIP isoforms and loci in the general population (Roy et al., 1995). Yamamoto et al. (1999) reported that NAIP transcripts are multiple and their expression is ubiquitous in the fetal tissue, and gradually become restricted to relatively small number of tissues and organs in the adult mouse. Similarly, in the recent genomic and transcriptional studies of murine NAIP, Yaraghi et al. (1998) confirmed the presence of six copies of NAIP genes. However, they found only three of the six gene copies were expressed.

490

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491

Fig. 10. Induction of NAIP mRNA and gene products by the systemic KA treatment. Enhanced expression of NAIP mRNA and gene products were observed by KA treatment: (A) RT-PCR profiles of NAIP and its densitometric tracing. The brains were harvested at a specified time point after treatment with KA (10 mg/kg). Total RNA was reverse transcribed, followed by the amplification of NAIP transcripts. The GAPDH levels are shown as control for differences in sample loading. Lane M: molecular weight marker (1 kb DNA ladder, Promega, USA), lane 1: animals treated with saline only, lane 2: animals harvested 48 h after KA treatment, lane 3: animals harvested 72 h after KA treatment. Data presented are representative of three separate experiments. (B) Immunoblotting profile of NAIP. Various sizes of anti-NAIP antibody-reactive proteins (approximately 130, 90 and 30 kDa) were detected and their signals were increased upon KA treatment.

As for mRNA expression, moderate level of NAIP mRNA expression was observed broadly by nearly every neuron (Fig. 4). However, rats treated with KA exhibited higher levels of NAIP mRNA (Figs. 7, 8 and 10A). Particularly, high levels of NAIP mRNA expression were observed within the areas packed with glutamatergic neurons such as cerebral cortex, hippocampus, granule layer of cerebellum, and interneurons of spinal cord (Hadi et al., 2000; Pizzi et al., 2000), suggesting the inducibility of NAIP gene in the glutamatergic neurons by KA. Our results suggested the inducibility of NAIP gene expression in the central neurons by injuries. The persistently upregulated NAIP-immunoreactivity in the retina and spinal motor neurons of the normal animals is consistent with a possible safe guard role of NAIP for the high risk group neurons such as retinal neurons and motor neurons against oxidative stress and toxic end products from high metabolic activity. Magun et al. (1998) reported dramatic upregulation of NAIP expression during adipocyte differentiation. In summary, the present study demonstrated ubiquitous presence of NAIP mRNA and gene products in the neurons of rat central nervous system. In particular, high levels of NAIP mRNA and gene product were detectable in neuronal subpopulations such as retina, hippocampus, certain

subcortical regions, thalamus, basal ganglia, cerebellum and spinal cord. Neuronal overstimulation by KA enhanced the expression of NAIP mRNA and gene product in those neurons that are specifically susceptible to such excitotoxic injury. Our results suggest that NAIP expression is regulated for survival of each neuron under various physiological or pathological conditions.

Acknowledgements This work was supported in parts by Keimyung University Faculty Research grant (BISA) (to JWP) and grant from Korea Institute of Science and Technology, the Ministry of Science and Technology, Republic of Korea (to THO). References Ausubel, F., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1995. Short Protocols in Molecular Biology, 3rd ed. Wiley, New York. Birnbaum, M.J., Clem, R.J., Miller, L.K., 1994. An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs. J. Virol. 68, 2521–2528.

S.-W. Shin et al. / Neurochemistry International 42 (2003) 481–491 Choe, B.-K., Cho, Y.O., 1994. Immunostaining cells and tissues. In: Malik, V.S., Lillehoj, E.P. (Eds.), Antibody Techniques. Academic Press, New York, pp. 259–272. Crawford, T.O., Pardo, C.A., 1996. The neurobiology of childhood spinal muscular atrophy. Neurobiol. Dis. 3, 97–110. Crook, N.E., Clem, R.J., Miller, L.K., 1993. An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif. J. Virol. 67, 2168–2174. Diez, E., Yaraghi, Z., MacKenzie, A.E., Gros, P., 2000. The neuronal apoptosis inhibitory protein (Naip) is expressed in macrophages and is modulated after phagocytosis and during intracellular infection with Legionella pneumophila. J. Immunol. 164, 1470–1477. Dubowitz, V., 1978. Muscle Disorders in Childhood. Saunders, London, pp. 146–178. Hadi, B., Zhang, Y.P., Burke, D.A., Shields, C.B., Magnuson, D.S., 2000. Lasting paraplegia caused by loss of lumbar spinal cord interneurons in rats: no direct correlation with motor neuron loss. J. Neurosurg. 93, 266–275. Holcik, M., Thompson, C.S., Yaraghi, Z., Lefebvre, C.A., MacKenzie, A.E., Korneluk, R.G., 2000. The hippocampal neurons of neuronal apoptosis inhibitory protein 1 (NAIP1)-deleted mice display increased vulnerability to kainic acid-induced injury. Proc. Natl. Acad. Sci. U.S.A. 97, 2286–2290. Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Benichou, B., Cruaud, C., Millasseau, P., Zeviani, M., Paslier, D., Frezal, F., Cohen, D., Weissenbach, J., Munnich, A., Melki, J., 1995. Identification and characterization of a spinal muscular atrophy-determining gene. Cell 80, 155–165. Liston, P., Roy, N., Tamai, K., Lefebvre, C., Baird, S., Cherton-Horvat, G., Farahani, R., McLean, M., Ikeda, J.E., MacKenzie, A.E., Korneluk, R.G., 1996. Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature 379, 349–353. Magun, R., Gagnon, A., Yaraghi, Z., Sorisky, A., 1998. Expression and regulation of neuronal apoptosis inhibitory protein during adipocyte differentiation. Diabetes 47, 1948–1952. Mercer, E.A., Korhonen, L., Skoglosa, Y., Olsson, P.A., Kukkonen, J.P., Lindholm, D., 2000. NAIP interacts with hippocalcin and protects neurons against calcium-induced cell death through caspase-3dependent and -independent pathways. EMBO J. 19, 3597–3607. Murayama, S., Bouldin, T.W., Suzuki, K., 1991. Immunocytochemical and ultrastructural studies of Werdnig–Hoffmann disease. Acta Neuropathol. (Berl.) 81, 408–417. Pari, G., Berrada, F., Verge, G., Karpati, G., Nalbantoglu, J., 2000. Immunolocalization of NAIP in the human brain and spinal cord. NeuroReport 11, 9–14.

491

Perrelet, D., Ferri, A., MacKenzie, A.E., Smith, G.M., Korneluk, R.G., Liston, P., Sagot, Y., Terrado, J., Monnier, D., Kato, A.C., 2000. IAP family proteins delay motoneuron cell death in vivo. Eur. J. Neurosci. 12, 2059–2067. Pizzi, M., Benarese, M., Boroni, F., Goffi, F., Valerio, A., Spano, P.F., 2000. Neuroprotection by metabotropic glutamate receptor agonists on kainate-induced degeneration of motor neurons in spinal cord slices from adult rat. Neuropharmacology 39, 903–910. Roy, N., Mahadevan, M.S., McLean, M., Shutler, G., Yaraghi, Z., Farahani, R., Baird, S., Besner-Johnston, A., Lefebvre, C., Kang, X., Salih, M., Aubry, H., Tamai, K., Guan, X., Ioannou, P., Crawford, T.O., de Jong, P.J., Surh, L., Ikeda, J., Korneluk, R.G., MacKenzie, A.E., 1995. The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell 80, 167– 178. Schrank, B., Gotz, R., Gunnersen, J.M., Ure, J.M., Toyka, K.V., Smith, A.G., Sendtner, M., 1997. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc. Natl. Acad. Sci. U.S.A. 94, 9920–9925. Shin, S.-W., Park, J.-W., Suh, M.H., Suh, S.I., Choe, B.-K., 1998. Persistent expression of Fas/FasL mRNA in the mouse hippocampus after a single NMDA injection. J. Neurochem. 71, 1773–1776. Simons, M., Beinroth, S., Gleichmann, M., Liston, P., Korneluk, R.G., MacKenzie, A.E., Bahr, M., Klockgether, T., Robertson, G.S., Weller, M., Schulz, J.B., 1999. Adenovirus-mediated gene transfer of inhibitors of apoptosis protein delays apoptosis in cerebellar granule neurons. J. Neurochem. 72, 292–301. Xu, D.G., Crocker, S.J., Doucet, J.P., St-Jean, M., Tamai, K., Hakim, A.M., Ikeda, J.E., Liston, P., Thompson, C.S., Korneluk, R.G., MacKenzie, A.E., Robertson, G.S., 1997a. Elevation of neuronal expression of NAIP reduces ischemic damage in the rat hippocampus. Nat. Med. 3, 997–1004. Xu, D.G., Korneluk, R.G., Tamai, K., Wigle, N., Hakim, A.M., MacKenzie, A.E., Robertson, G.S., 1997b. Distribution of neuronal apoptosis inhibitory protein-like immunoreactivity in the rat central nervous system. J. Comp. Neurol. 382, 247–259. Yamamoto, K., Sakai, H., Hadano, S., Gondo, Y., Ikeda, J.E., 1999. Identification of two distinct transcripts for the neuronal apoptosis inhibitory protein gene. Biochem. Biophys. Res. Commun. 264, 998– 1006. Yaraghi, Z., Korneluk, R.G., MacKenzie, A.E., 1998. Cloning and characterization of the multiple murine homologues of NAIP (neuronal apoptosis inhibitory protein). Genomics 51, 107–113.