- Email: [email protected]
Cloning and characterization of the cDNA and gene encoding the γ-subunit of cGMP-phosphodiesterase in canine retinal rod photoreceptor cells
GENE AN i N T E R N A T I O N A L , J O U R N A L ON G~NE5 AND OENOMES
ELSEVIER
Gene 181 (1996) 1-5
Cloning and characterization of the cDNA and gene encoding the 7-subunit of cGMP-phosphodiesterase in canine retinal rod photoreceptor cells Weiquan Wang, Gregory M. Acland, Gustavo D. Aguirre, Kunal Ray * James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, N Y 14853, USA Received 6 March 1996; revised 5 April 1996; accepted 8 April 1996
Abstract
Rod photoreceptor cyclic GMP-phosphodiesterase (cGMP-PDE) is one of the key enzymes of the visual phototransduction cascade in the vertebrate retina. The enzyme is composed of ~- and [~-catalytic subunits and two identical inhibitory 7-subunits. A defect in any of the subunits may potentially alter the activity of the enzyme, leading to aberration in the visual phototransduction. We have cloned and sequenced both the cDNA and gene for the canine 7-subunit of cGMP-PDE (PDE7). The 952-bp cDNA has a coding region of 261 bp which is very similar to those of the PDE 7 cDNAs from human, mouse and bovine retinas. Among the 87 amino acids encoded by the transcribed region, differences in only three residues located within the first 17 amino acids were identified. The carboxyl terminus of PDE7, involved in interaction with the catalytic subunits of cGMP-PDE and the ct-subunit of transducin, is conserved through evolution. The single polyadenylation signal (AATAAA) present in human and bovine PDE 7 cDNAs is replaced by AGTAAA in the canine sequence. The canine gene (2.8 kb) consists of four exons and is much smaller than the human gene (6 kb). The larger size of the human gene is primarily due to the presence of AluI repetitive elements in its first two introns. Keywords: Exon-intron structure; Canine photoreceptors; Retinal degeneration; Retinitis pigmentosa; Visual transduction
1. Introduction
The retinal-specific cyclic GMP-phosphodiesterase ( c G M P - P D E , EC 3.1.4.17) enzyme mediates the final transduction step in photoreceptor cells. We are interested in the 7-subunit of c G M P - P D E for two reasons. Firstly, it is one of three subunits forming the c G M P P D E heterotetramer complex in retinal rods, and its inhibitory properties regulate c G M P - P D E activity (Hurley and Stryer, 1982). Secondly, aberration in function of this enzyme is causally associated with retinal * Corresponding author. Tel. + 1 607 2565681; Fax + 1 607 2565689; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA; cGMP-PDE, cyclic GMP-phosphodiesterase; kb, kilobase(s) or 1000 bp; kDa, kilodalton; nt, nucleotide(s); ORF, open reading frame; PCR, polymerase chain reaction; PDEy, 7-subunit of cGMP-PDE; PDEA, gene for ct-subunit of cGMP-PDE; PDE6B, gene for ~-subunit of rod-specific cGMP-PDE; PDEG, gene for 7-subunit of cGMP-PDE; rd, retinal degeneration; RP, retinitis pigrnentosa; RT, reverse transcription; UTR, untranslated region. 0378-1119/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved PH S 0 3 7 8 - 1 1 1 9 ( 9 6 ) 0 0 3 1 9 - 8
degenerative diseases in man and animals. Mutations in the genes for ~- and ~-subunits of c G M P - P D E (PDEA and PDE6B, respectively) cause retinitis pigmentosa (RP) in man (Huang et al., 1995; McLaughlin et al., 1995; Danciger et al., 1995). Defects in PDE6B cause retinal degeneration in the rdl mouse (Bowes et al., 1990; Pittler and Baehr, 1991) and rcdl dog (Suber et al., 1993; Ray et al., 1994). PDEG is one of the candidate genes located in the region of h u m a n chromosome 17 containing the RP 17 locus (Bardien et al., 1995). Recently, it has been reported that the phenotype of transgenic mice homozygous for a null mutation at the PDEG locus resembles that of the rdl mouse and models early-onset forms of h u m a n RP (Tsang et al., 1996; Yamashita et al., 1996). Collie dogs affected with rod cone degeneration 2 (rcd2) have elevated levels of retinal c G M P secondary to deficient c G M P - P D E activity (Woodford et al., 1982), but rcd2 is not caused by a defect in PDE6B (Acland et al., 1989). Thus, it is likely that defects in either PDEA, PDEG or other genes in the phototransduction cascade leading to the activation of c G M P - P D E could result in rcd2 disease. P D E 7 c D N A has been characterized in
2
W. Wang et al./Gene 181 (1996) 1 5
cow (Ovchinnikov et al., 1986), mouse (Tuteja and Farber, 1988), and m a n (Tuteja et al., 1990), but the gene has been characterized only in m a n (Piriev et al., 1994). N o information has been available previously on either the canine P D E ? c D N A or gene. Therefore, we cloned and characterized the canine P D E y c D N A and gene to further pursue the possible role of this gene in hereditary retinal degenerations in general, and rcd2 in particular.
2. Experimental and discussion 2.1. Identification and sequence analysis of canine PDEy cDNA Initially a segment of canine P D E y c D N A was obtained by reverse transcription (RT) and polymerase chain reaction (PCR) using total retinal R N A and consensus primers ( P D E G - 2 and P D E G - 4 ) based on the coding regions of k n o w n P D E ? c D N A sequences from other species. This R T - P C R amplified fragment was cloned and sequenced to confirm the authenticity of the retina-specific P D E 7 c D N A sequence. F r o m the confirmed canine P D E ? c D N A sequence, new caninespecific primers were designed to PCR-amplify b o t h the 5'- and 3'-ends of canine P D E 7 c D N A from a canine retinal c D N A library (Fig. 1). To amplify the 5'-end of the c D N A , a forward vector-specific primer ( p B K - I I I ) and PDEG-specific reverse primer ( P D E G - 3 ) were used. F r o m the P C R products, the largest fragment showing evidence for PDEG specificity, based on P C R using additional internal primers, was cloned. To amplify the 3'-end of the c D N A , gene-specific forward primer ( P D E G - 5 ) and vector-specific reverse primer (T7) were used, and the amplified D N A fragment was cloned. F r o m these three overlapping clones (Fig. 1) the entire sequence of the canine P D E 7 c D N A sequence was obtained. The full length of canine rod P D E y c D N A is 952 nt including the polyA tail (Fig. 2A). The length of canine P D E 7 m R N A determined by northern blot (Tuteja et al., 1990) is in g o o d agreement with the length of the canine P D E 7 c D N A described here. We have not formally determined the transcription start site; however, the clone containing the most upstream 5'-noncoding region contains 169 nt in the 5'-UTR followed by the A T G c o d o n for initiation of translation. The stop c o d o n (TAG) corresponds to the position from 431 to 433 of the c D N A sequence. The conceptually translated protein would have 87 aa, and calculated molecular mass of 9.65 kDa.
2.2. Nucleotide and amino acid similarities with human, mouse, and bovine PDEy A c o m p a r i s o n of the nucleotides in the open reading frame ( O R F ) of the canine P D E y c D N A with other
5' vector DNA
2-PDEG (371 bp) P~EG-4
PDEG-~ pBK-11~
3' vector DNA
PDE~ cDNA
5'-PDEG (460 bp)
PD~EG.3
PDEG-~
3'-PDEG (750 bp)
"~7
Fig. 1. Strategy for cloning the canine PDEy cDNA. Clones containing different overlapping regions of the cDNA are identified as 2-PDEG, 5'-PDEG, and 3'-PDEG. The first clone (2-PDEG) was obtained by reverse transcription and polymerase chain reaction (RT-PCR) from canine retinal total RNA using a RT-PCR kit (Perkin-Elmer, Foster City, CA) as recommended by the manufacturer. Primers PDEG-2 (5'-CCCTAAATTTAAGCAGCGACA-3') and PDEG-4 (5'-TCCTAGAGGGAGGTGGTGGGCTCCT-3') were designed from the region of the human sequence which is highly conserved between the human, bovine, and mouse PDE 7 cDNAs. PCR was done at 94°C for 1 min, 56°C for 1 min, 72°C for 1.5 min for 35 cycles; then at 72°C for 10 min. The PCR product was analyzed by electrophoresis in a 6% polyacrylamide gel, and the DNA band of expected length (371 bp) was isolated and cloned in the TA cloning vector pCRII (Invitrogen, San Diego, CA). Authenticity of the canine clone for PDE7 cDNA was confirmed by sequencing. 5'-PDEG and 3'-PDEG clones were obtained by screening a canine retinal cDNA library using a PCR-based method. 5'-PDEG was obtained by amplification of the DNA from the library using a vector-specific forward primer, pBK-III (5'-GGTCGA CACTAGTGGATCCAAAG-3'), and the canine PDE7 cDNA-specific reverse primer, PDEG-3 (5'-GATGATGCCATATTGGGCCAG-3'). 3'-PDEG was obtained similarly from the library by PCR using a canine PDE 7 cDNA-specific forward primer, PDEG-5 (5'CAAGAAAGGCGTCCAAGGGTTTG-3') and vector-specificreverse primer, T7 (5'-CGACTCACTATAGGGCGAATT-3'). PCR was done for 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1.5 min; followed by completion of the reaction at 72°C for 10 min. The specificity of the PCR product was checked by PCR using additional PDE 7 cDNA internal primers. The fragments were cloned in vector pCRII as described a/home/PKV/sgml/pag/sgmgeni915.gmlfor each PCR fragment. The cDNA was characterized by sequencing the clones, containing overlapping fragments, from both directions.
species shows that it has highest nucleotide identity with the bovine sequence (95.8%), followed by h u m a n (91.7%) and mouse (90.9%). Furthermore, the total n u m b e r of nt in the open reading frame (261 nt) and the n u m b e r of deduced aa (87 residues) are also conserved in all these four species. The similarity at the aa level between the canine and other species is higher than at the nt level; thus the canine P D E y aa sequence is 98.9% identical to bovine and mouse, and 97.7% to the human. The differences in P D E y sequence between these four species are limited to only 3 aa in the amino terminal region (Fig. 2B); these are at position 8 (Gly in mouse, and Ala in others); position 10 (Phe in human, and Ile in others); and position 17 (Ala in human, Met in bovine, and Ile in mouse and canine). The carboxyl terminus of the P D E y subunit is highly conserved and no change in any aa has been observed. This region contains distinct sites of interaction with the c G M P P D E enzyme catalytic
W. Wang et al./Gene 181 (1996) 1-5
3
A GAGCACACCCGTGACCCTGAGACCTGCCCAGGGCTTGGACTTCCTCTGTTCAGCTGGTTG
60
PDEG-9 AGACCTGCAAGGGGGCCAGCCGCAGGGGGGCTGACTGGTGTGCCCCCAGCCCACAGCGTG AGGGAGTCTAGAAGCCAGACGTCGCCGTGGGTTCTCTGCCAACCTGGGC
ATG
120
AAC
Met Asn CTG
GAG
CCA
CCG
AAG
GCC
GAG
ATC
CGG
TCG
GCC ACC
AGG
GTG ATT
Leu Glu Pro Pro Lys Ala Glu Ile A r g Ser Ala Thr A r g Val Ile GGG
GGG
CCC
GTC
ACT
CCC
AGA
AAA
GGG
CCC
CCC
AAA
TTT
AAG
CAG
G I y GIy Pro Val Thr Pro A r g Lys G I y Pro Pro Lys Phe Lys Gln CGG
CAA
ACC
AGG
CAG
TTC AAG
AGC
AAG
CCC
CCC AAG
AAA
GGC
GTC
A r g Gln Thr A r g Gln Phe Lys Ser Lys Pro Pro Lys Lys G l y Val CAA
GGG
TTT
GGG
GAC
GAC ATC
CCT
GGA
ATG
GAA
GGC
CTG
GGG
ACA
Gln G I y Phe G l y A s p A s p Ile Pro G I y Met Glu Gly Leu G l y Thr GAC
ATC
ACG
GTC
ATC
TGC
CCT
TGG
GAG
GCC
TTC
AAC
CAC
CTG
GAG
A s p Ile Thr Val Ile Cys Pro Trp Glu Ala Phe A s n His Leu GIu CTG
CAC
GAG
CTG
GCC
CAG
TAC
GGC ATC
ATC
TAG
CGCCAGAGCCTGACCC
175
2 220 17 265 32 310 47 355 62 400 77
Leu His Glu Leu Ala Gln Tyr G l y Ile Ile ***
449 87
AGAGGCTTGGGGCCAGGGTCCCTGCCGCCCACTCCGCTCCCTGCTCCGGGTGCCTGCGAG GAGGCCGGCCCCCCCCCGCGGTGTCCAGATGGCCCAGTGTGTGTCTGGAGACCCTCGCAG GGTGGCAGCCTCAGCCCCCAGACGCCCATTACCAGAAGCCCACCAGCTCCCTGCAGGACC CCTCGGGCCCTGCTTCACTACCACAAACACCGGCCCACAGACCTTCTCTTAGGGCAGGAA GGCCAGGCAGGTGTCCCAGGAATGTGCATCACACCCCGCTCCCCTCCTTTGGTCTAGTGA CGAGGACGAGCCCCCCTCACTAGTCTTCCCAGCTGGCGCCCTTGAGCTGAGTGGGCAAGG GGGGGGGGTCCCCGGCGGCCTCAGAGCAGCAGCCCTCTGAAGCCAACACAGCAGCAGGAA GCATCCTGTCCAGCATTGCCCATGCTTGCTGTCCCTGTTTCAGAGTAAAGTTAGTGTGG
509 569 629 689 749 809 869 928
PDEG-8 CCCCCAAAAAAAAAAAAAAAAAAA
952
B Canine: Bovine: Human: Mouse:
I0 20 MNLEPPKAEIRSATRVIGGP .......... MNLEPPKAEIRSATRVMGGP .......... MNLE PPKAEFRSATRVAGGP .......... MNLEPPKGEIRSATRVIGGP ..........
Fig. 2. The nucleotide sequence of P D E y c D N A from canine retina (GenBank accession No. U49359), and the deduced amino acid sequence and its comparison with other species. (A) Canine P D E y cDNA. The position of the nt and the deduced aa are indicated on the right; the aa numbers are shown in bold. The stop codon (TAG) is marked with asterisks (***) and the sequence motif (AGTAAA) present at the polyadenylation site is boldfaced. The location of two primers, P D E G - 8 (forward) and P D E G - 9 (reverse), used for amplification of PDEG from canine genomic DNA, are underlined. (B) Three aa that are not identical in all the four species are boldfaced, and their positions are identified by asterisks. The numbers above the aa denote their locations in PDEy.
subunits (Gt and [3) and the ~-subunit of transducin (Skiba et al., 1995). Unlike the bovine and the human PDEy cDNA (Ovchinnikov et al., 1986; Tuteja et al., 1990), the canine sequence does not contain the canonical polyadenylation signal (AATAAA); instead a similar sequence motif (AGTAAA) is present in the same location (Fig. 2) which may serve as a surrogate polyadenylation signal, albeit of lower efficiency (Wickens, 1990). No information is available for a polyadenylation signal in the published
mouse PDEy cDNA sequence because it lacks a complete 3'-UTR (Tuteja and Farber, 1988).
2.3. Identification and structural analysis of the canine PDEG Based on the canine cDNA sequence, the two primers (PDEG-8 and PDEG-9) shown in Fig. 2 were designed from the 5'- and 3'-ends and used for amplification of PDEG from canine genomic DNA. On amplification, a
4
W. Wanget al./Gene 181 (1996) 1 5 2.8-kb D N A fragment was obtained, a n d its specificity for rod-specific PDEG was e x a m i n e d by nested P C R using i n t e r n a l primers designed from the canine P D E ? c D N A sequence. The 2.8-kb D N A fragment was cloned a n d sequenced from b o t h strands using overlapping primers. The sequencing d a t a indicate that the canine PDEG has four exons i n t e r r u p t e d by three small i n t r o n s (Fig. 3). The first exon (37 nt) a n d part of the second exon (132 of a total 278 nt) represent 5'-UTR. Similarly, a m a j o r p o r t i o n of exon 4 (522 of a total 577 nt) consists of 3 ' - U T R . The sequences of the e x o n - i n t r o n b o r d e r regions for all three i n t r o n s coincides with a splice site canonical sequence (Sharp, 1981), a n d obeys the G T / A G rule for e x o n - i n t r o n j u n c t i o n s (Table 1). I m p o r t a n t features of the canine PDEG, including the locations of the i n t r o n s in the gene, a n d the sizes of the i n t r o n s a n d exons, are s h o w n in Table 1 a n d Fig. 3. The sequence of the entire gene can be accessed from G e n b a n k (Accession No. U49360). Sequence c o m p a r i s o n between the canine P D E 7 c D N A a n d PDEG gene showed only one nucleotide difference located in the 5'-UTR; nt 76 is a C in the c D N A (Fig. 2A), a n d G in the gene. This difference m a y represent a p o l y m o r p h i c change in the gene.
3'
5'
37
278
41
577
2
3
4
205
41
1246
1 5'
3'
44
B ~
31/10
1
~62~ 2
688
491 ~ 3
4
Fig. 3. Genomic organization of PDEG. (A) Canine gene (GenBank accession No. U49360). The canine gene was amplified from genomic DNA by PCR using primers PDEG-8 and PDEG-9 (locations in cDNA shown in Fig. 2) for 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 3.5 min, followed by extension of the reaction at 72°C for 10 min. The PCR was done in 50 p.l containing 10 mM Tris-HCl, pH 8.3, 50 mM KCI, 0.2 mM dNTPs, 1.0 mM MgC12, 10% dimethyl sulfoxide, and 1.25 units Taq polymerase (Life Technologies; Grand Island, NY). The PCR product was cloned in the TA-cloning vector, pCRII (Invitrogen, San Diego, CA). Multiple clones were used for sequencing and both strands of the cloned DNA were sequenced. (B) Human gene (GenBank accession No. U13894). The human gene is shown as described before (Piriev et al., 1994). The numbers of exons are indicated below the exons (boxed). The 5'-UTR and 3'-UTR are indicated by open boxes and the coding region is indicated by the shaded boxes. The numbers of nt in each exon and intron are written above for both the canine and the human genes.
2.4. Comparison between the canine and human PDEG The length of canine PDEG is m u c h shorter (2.8 kb) t h a n the h u m a n gene (6 kb) (Piriev et al., 1994). This
Table 1 Sequence of the intron-exon junctions in the canine PDEG Intron
intron size (bp)
Sequence
at
Exon 5'-splice
I
1246
II
288
III
348
(I)
(2)
(3)
37 CTTG
site
the
sequences
junctions a
Intron 3'-splice
Exon site 1284
gtgagt .......... gtctcctgttccag
1561 CAA GG gtaagc .......... actctgtcctgcag G l n G1 50
ACA rhr
1890 G gtatga .......... cccttctcctgcag A 63 a
Consensus
splice
AG
gt
tt agt ..........
g
(2)
1850 G T T T (3) y Phe 50 2239
AC ATC sp I l e 63
(4)
tttttt tt
CC
GACTT
ncag
G
CCCCCC
aThe capital letters and small letters represent exon and intron sequences, respectively. The terminal nucleotide of each exon present at the splice site junction is numbered above the sequence to indicate its location in the gene. The pair of exons encompassing an intron are identified by numbers in parenthesis. The presence of the splice site canonical sequence gt/ag is boldfaced. Exon 1 is in the 5'-UTR. The triplet codons split by the introns are indicated by showing the encoded amino acids in italics below the codons. The numbers (italicized) of the codons split by the introns are indicated below the amino acid symbols.
W. Wanget al./Gene 181 (1996) 1-5 difference is primarily caused by the smaller size of i n t r o n s 1 a n d 2 in the canine gene. As s h o w n in Fig. 3, the sizes of the first a n d second i n t r o n s of h u m a n PDEG are 2.5 times a n d 5.0 times larger t h a n the c o r r e s p o n d i n g region of the c a n i n e gene, respectively. I n the h u m a n PDEG, the presence of 3 AluI repetitive elements in the first i n t r o n , a n d 2 in the second i n t r o n , c o n t r i b u t e to the relatively larger size of these two i n t r o n s (Piriev et al., 1994).
3. Conclusions (1) We have cloned b o t h the c D N A a n d gene corres p o n d i n g to the c a n i n e rod c G M P - P D E y-subunit. (2) At the nt level, the coding sequence of the c D N A is 95.8%, 91.7%, a n d 90.9% identical with the bovine, h u m a n a n d m o u s e P D E 7 c D N A respectively. The O R F encodes a n 87-aa protein. At the aa level, the differences in P D E y sequence a m o n g these 4 species are limited to only 3 residues at the a m i n o t e r m i n a l (positions 8, 10, a n d 17). (3) The c a n i n e PDEG (2.8 kb), like the h u m a n PDEG, consist of 4 exons. The larger size of the h u m a n gene (6 kb) results p r i m a r i l y from the presence of AluI repetitive elements in the first a n d second introns.
Acknowledgement S u p p o r t e d in part by a Fight for S i g h t / P r e v e n t Blindness A m e r i c a p o s t d o c t o r a l fellowship to Dr. W. Wang, T h e M o r r i s A n i m a l F o u n d a t i o n , The Seeing Eye, Inc., The Collie C l u b of A m e r i c a F o u n d a t i o n , the A M S C / A K C , The F o u n d a t i o n F i g h t i n g Blindness, a n d N E I / N I H G r a n t EY 06855.
References Acland, G.M., Fletcher, R.T., Gentleman, S., Chader, G.J. and Aguirre, G.D. (1989) Non-allelism of three genes (rcdl, rcd2 and erd) for earlyonset hereditary retinal degeneration. Exp. Eye Res. 49, 983-998. Bardien, S., Ebenezer, N., Greenberg, J., Inglehearn, C.F., Bartmann, L., Goliath, R., Beighton, P., Ramesar, R. and Bhattacharya, S.S. (1995) An eighth locus for autosomal dominant retinitis pigmentosa is linked to chromosome 17q. Hum. Mol. Genet. 4, 1459 1462. Bowes, C., Li, T., Danciger, M., Baxter, L.C., Applebury, M.L. and Farber, D.B. (1990) Retinal degeneration in the rd mouse is caused by a defect in the 13subunit of rod cGMP-phosphodiesterase. Nature 347, 677-680.
5
Danciger, M., Blaney, J., Gao, Y.Q., Zhao, D.Y., Heckenlively,J. R., Jacobson, S.G. and Farber, D.B. (1995) Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa. Genomics 30, 1-7. Huang, S.H., Pittler, S.J., Huang, X., Oliveira, L., Berson, E.L. and Dryja, T.P. (1995) Autosomal recessive retinitis pigmentosa caused by mutations in the ~ subunit of rod cGMP phosphodiesterase. Nature Genet. 11,468-471. Hurley, J.B. and Stryer, L. (1982) Purification and characterization of the gamma regulatory subunit of the cGMP phosphodiesterase from retinal rod outer segments. J. Biol. Chem. 257, 11094 11099. McLaughlin, M.E., Ehrhart, T.L., Berson, E.L. and Dryja, T.P. (1995) Mutation spectrum of the gene encoding the 13subunit of rod phosphodiesterase among patients with autosomal recessive retinitis pigmentosa. Proc. Natl. Acad. Sci. USA 92, 3249-3253. Ovchinnikov, Y.A., Lipkin, V.M., Kumarev, V.P., Gubanov, V.V., Khramtsov, N.V., Akhmedov, N.B., Zagranichny, V.E. and Muradov, K.G. (1986) Cyclic GMP phosphodiesterase from cattle retina: amino acid sequence of the y-subunit and nucleotide sequence of the corresponding cDNA. FEBS Lett. 204, 288-292. Piriev, N.I., Khramtsov, N.V. and Lipkin, V.M. (1994) Cloning and characterization of the gene encoding the cGMP-phosphodiesterase y-subunit of human rod photoreceptor cells. Gene 151, 297-301. Pittler, S.J. and Baehr, W. (1991) Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase 13-subunitgene of the rd mouse. Proc. Natl. Acad. Sci. USA 88, 8322-8326. Ray, K., Baldwin, V.J., Acland, G.M., Blanton, S.H. and Aguirre, G.D. (1994) Co-segregation of codon 807 mutation of the rod cGMP phosphodiesterase 13 gene (PDEB) and rcdl. Invest. Ophthalmol. Vis. Sci. 35, 4291-4299. Sharp, P.A. (1981) Speculations on RNA splicing. Cell 23, 643-646. Skiba, N.P., Artemyev, N.O. and Hamm, H.E. (1995) The carboxyl terminus of the y-subunit of rod cGMP phosphodiesterase contains distinct sites of interaction with the enzyme catalytic subunits and the ~-subunit of transducin. J. Biol. Chem. 270, 13210-13215. Suber, M. L., Pittler, S.J., Qin, N., Wright, G.C., Holcombe, V., Lee, R.H., Craft, C.M., Lolley, R.N., Baehr, W. and Hurwitz, R.L. (1993) Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase 13-subunitgene. Proc. Natl. Acad. Sci. USA 90, 3968-3972. Tsang, S.H., Yamashita, C., Tanabe, T., Li, W., Kjeldbye, H., Gouras, P, Farber, D.B. and Goff, S.P. (1996) Gene targeting analysis of the rod cGMP phosphodiesterase inhibitory 7-subunit : morphological and physiological studies. Invest. Ophthalmol. Vis. Sci. 37, $216. Tuteja, N. and Farber, D.B. (1988) y-subunit of mouse retinal cyclicGMP phosphodiesterase: cDNA and corresponding amino acid sequence. FEBS Lett. 232, 182-186. Tuteja, N., Danciger, M., Klisak, I., Tuteja, R., Innana, G., Mohandas, T., Sparkes, R.S. and Farber, D.B. (1990) Isolation and characterization of cDNA encoding the gamma-subunit of cGMP phosphodiesterase in human retina. Gene 88, 227-232. Wickens, M. (1990) How the messenger got its tail: addition of poly (A) in the nucleus. Trends Biochem. Sci. 15, 277-281. Woodford, B.J., Liu, Y., Fletcher, R.T., Chader, G.J., Farber, D.B., Santos-Anderson, R.S. and Tso, M.O.M. (1982) Cyclic nucleotide metabolism in inherited retinopathy in collies: A biochemical and histochemical study. Exp. Eye Res. 34, 703-714. Yamashita, C.K., Tsang, S.H., Gouras, P, Goff, S.P. and Farber, D.B. (1996) Gene targeting of the rod cGMP phosphodiesterase inhibitory y-subunit: biochemical studies of the Pdegtin1 mouse. Invest. Ophthalmol. Vis. Sci. 37, $216.
ELSEVIER
Gene 181 (1996) 1-5
Cloning and characterization of the cDNA and gene encoding the 7-subunit of cGMP-phosphodiesterase in canine retinal rod photoreceptor cells Weiquan Wang, Gregory M. Acland, Gustavo D. Aguirre, Kunal Ray * James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, N Y 14853, USA Received 6 March 1996; revised 5 April 1996; accepted 8 April 1996
Abstract
Rod photoreceptor cyclic GMP-phosphodiesterase (cGMP-PDE) is one of the key enzymes of the visual phototransduction cascade in the vertebrate retina. The enzyme is composed of ~- and [~-catalytic subunits and two identical inhibitory 7-subunits. A defect in any of the subunits may potentially alter the activity of the enzyme, leading to aberration in the visual phototransduction. We have cloned and sequenced both the cDNA and gene for the canine 7-subunit of cGMP-PDE (PDE7). The 952-bp cDNA has a coding region of 261 bp which is very similar to those of the PDE 7 cDNAs from human, mouse and bovine retinas. Among the 87 amino acids encoded by the transcribed region, differences in only three residues located within the first 17 amino acids were identified. The carboxyl terminus of PDE7, involved in interaction with the catalytic subunits of cGMP-PDE and the ct-subunit of transducin, is conserved through evolution. The single polyadenylation signal (AATAAA) present in human and bovine PDE 7 cDNAs is replaced by AGTAAA in the canine sequence. The canine gene (2.8 kb) consists of four exons and is much smaller than the human gene (6 kb). The larger size of the human gene is primarily due to the presence of AluI repetitive elements in its first two introns. Keywords: Exon-intron structure; Canine photoreceptors; Retinal degeneration; Retinitis pigmentosa; Visual transduction
1. Introduction
The retinal-specific cyclic GMP-phosphodiesterase ( c G M P - P D E , EC 3.1.4.17) enzyme mediates the final transduction step in photoreceptor cells. We are interested in the 7-subunit of c G M P - P D E for two reasons. Firstly, it is one of three subunits forming the c G M P P D E heterotetramer complex in retinal rods, and its inhibitory properties regulate c G M P - P D E activity (Hurley and Stryer, 1982). Secondly, aberration in function of this enzyme is causally associated with retinal * Corresponding author. Tel. + 1 607 2565681; Fax + 1 607 2565689; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA; cGMP-PDE, cyclic GMP-phosphodiesterase; kb, kilobase(s) or 1000 bp; kDa, kilodalton; nt, nucleotide(s); ORF, open reading frame; PCR, polymerase chain reaction; PDEy, 7-subunit of cGMP-PDE; PDEA, gene for ct-subunit of cGMP-PDE; PDE6B, gene for ~-subunit of rod-specific cGMP-PDE; PDEG, gene for 7-subunit of cGMP-PDE; rd, retinal degeneration; RP, retinitis pigrnentosa; RT, reverse transcription; UTR, untranslated region. 0378-1119/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved PH S 0 3 7 8 - 1 1 1 9 ( 9 6 ) 0 0 3 1 9 - 8
degenerative diseases in man and animals. Mutations in the genes for ~- and ~-subunits of c G M P - P D E (PDEA and PDE6B, respectively) cause retinitis pigmentosa (RP) in man (Huang et al., 1995; McLaughlin et al., 1995; Danciger et al., 1995). Defects in PDE6B cause retinal degeneration in the rdl mouse (Bowes et al., 1990; Pittler and Baehr, 1991) and rcdl dog (Suber et al., 1993; Ray et al., 1994). PDEG is one of the candidate genes located in the region of h u m a n chromosome 17 containing the RP 17 locus (Bardien et al., 1995). Recently, it has been reported that the phenotype of transgenic mice homozygous for a null mutation at the PDEG locus resembles that of the rdl mouse and models early-onset forms of h u m a n RP (Tsang et al., 1996; Yamashita et al., 1996). Collie dogs affected with rod cone degeneration 2 (rcd2) have elevated levels of retinal c G M P secondary to deficient c G M P - P D E activity (Woodford et al., 1982), but rcd2 is not caused by a defect in PDE6B (Acland et al., 1989). Thus, it is likely that defects in either PDEA, PDEG or other genes in the phototransduction cascade leading to the activation of c G M P - P D E could result in rcd2 disease. P D E 7 c D N A has been characterized in
2
W. Wang et al./Gene 181 (1996) 1 5
cow (Ovchinnikov et al., 1986), mouse (Tuteja and Farber, 1988), and m a n (Tuteja et al., 1990), but the gene has been characterized only in m a n (Piriev et al., 1994). N o information has been available previously on either the canine P D E ? c D N A or gene. Therefore, we cloned and characterized the canine P D E y c D N A and gene to further pursue the possible role of this gene in hereditary retinal degenerations in general, and rcd2 in particular.
2. Experimental and discussion 2.1. Identification and sequence analysis of canine PDEy cDNA Initially a segment of canine P D E y c D N A was obtained by reverse transcription (RT) and polymerase chain reaction (PCR) using total retinal R N A and consensus primers ( P D E G - 2 and P D E G - 4 ) based on the coding regions of k n o w n P D E ? c D N A sequences from other species. This R T - P C R amplified fragment was cloned and sequenced to confirm the authenticity of the retina-specific P D E 7 c D N A sequence. F r o m the confirmed canine P D E ? c D N A sequence, new caninespecific primers were designed to PCR-amplify b o t h the 5'- and 3'-ends of canine P D E 7 c D N A from a canine retinal c D N A library (Fig. 1). To amplify the 5'-end of the c D N A , a forward vector-specific primer ( p B K - I I I ) and PDEG-specific reverse primer ( P D E G - 3 ) were used. F r o m the P C R products, the largest fragment showing evidence for PDEG specificity, based on P C R using additional internal primers, was cloned. To amplify the 3'-end of the c D N A , gene-specific forward primer ( P D E G - 5 ) and vector-specific reverse primer (T7) were used, and the amplified D N A fragment was cloned. F r o m these three overlapping clones (Fig. 1) the entire sequence of the canine P D E 7 c D N A sequence was obtained. The full length of canine rod P D E y c D N A is 952 nt including the polyA tail (Fig. 2A). The length of canine P D E 7 m R N A determined by northern blot (Tuteja et al., 1990) is in g o o d agreement with the length of the canine P D E 7 c D N A described here. We have not formally determined the transcription start site; however, the clone containing the most upstream 5'-noncoding region contains 169 nt in the 5'-UTR followed by the A T G c o d o n for initiation of translation. The stop c o d o n (TAG) corresponds to the position from 431 to 433 of the c D N A sequence. The conceptually translated protein would have 87 aa, and calculated molecular mass of 9.65 kDa.
2.2. Nucleotide and amino acid similarities with human, mouse, and bovine PDEy A c o m p a r i s o n of the nucleotides in the open reading frame ( O R F ) of the canine P D E y c D N A with other
5' vector DNA
2-PDEG (371 bp) P~EG-4
PDEG-~ pBK-11~
3' vector DNA
PDE~ cDNA
5'-PDEG (460 bp)
PD~EG.3
PDEG-~
3'-PDEG (750 bp)
"~7
Fig. 1. Strategy for cloning the canine PDEy cDNA. Clones containing different overlapping regions of the cDNA are identified as 2-PDEG, 5'-PDEG, and 3'-PDEG. The first clone (2-PDEG) was obtained by reverse transcription and polymerase chain reaction (RT-PCR) from canine retinal total RNA using a RT-PCR kit (Perkin-Elmer, Foster City, CA) as recommended by the manufacturer. Primers PDEG-2 (5'-CCCTAAATTTAAGCAGCGACA-3') and PDEG-4 (5'-TCCTAGAGGGAGGTGGTGGGCTCCT-3') were designed from the region of the human sequence which is highly conserved between the human, bovine, and mouse PDE 7 cDNAs. PCR was done at 94°C for 1 min, 56°C for 1 min, 72°C for 1.5 min for 35 cycles; then at 72°C for 10 min. The PCR product was analyzed by electrophoresis in a 6% polyacrylamide gel, and the DNA band of expected length (371 bp) was isolated and cloned in the TA cloning vector pCRII (Invitrogen, San Diego, CA). Authenticity of the canine clone for PDE7 cDNA was confirmed by sequencing. 5'-PDEG and 3'-PDEG clones were obtained by screening a canine retinal cDNA library using a PCR-based method. 5'-PDEG was obtained by amplification of the DNA from the library using a vector-specific forward primer, pBK-III (5'-GGTCGA CACTAGTGGATCCAAAG-3'), and the canine PDE7 cDNA-specific reverse primer, PDEG-3 (5'-GATGATGCCATATTGGGCCAG-3'). 3'-PDEG was obtained similarly from the library by PCR using a canine PDE 7 cDNA-specific forward primer, PDEG-5 (5'CAAGAAAGGCGTCCAAGGGTTTG-3') and vector-specificreverse primer, T7 (5'-CGACTCACTATAGGGCGAATT-3'). PCR was done for 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1.5 min; followed by completion of the reaction at 72°C for 10 min. The specificity of the PCR product was checked by PCR using additional PDE 7 cDNA internal primers. The fragments were cloned in vector pCRII as described a/home/PKV/sgml/pag/sgmgeni915.gmlfor each PCR fragment. The cDNA was characterized by sequencing the clones, containing overlapping fragments, from both directions.
species shows that it has highest nucleotide identity with the bovine sequence (95.8%), followed by h u m a n (91.7%) and mouse (90.9%). Furthermore, the total n u m b e r of nt in the open reading frame (261 nt) and the n u m b e r of deduced aa (87 residues) are also conserved in all these four species. The similarity at the aa level between the canine and other species is higher than at the nt level; thus the canine P D E y aa sequence is 98.9% identical to bovine and mouse, and 97.7% to the human. The differences in P D E y sequence between these four species are limited to only 3 aa in the amino terminal region (Fig. 2B); these are at position 8 (Gly in mouse, and Ala in others); position 10 (Phe in human, and Ile in others); and position 17 (Ala in human, Met in bovine, and Ile in mouse and canine). The carboxyl terminus of the P D E y subunit is highly conserved and no change in any aa has been observed. This region contains distinct sites of interaction with the c G M P P D E enzyme catalytic
W. Wang et al./Gene 181 (1996) 1-5
3
A GAGCACACCCGTGACCCTGAGACCTGCCCAGGGCTTGGACTTCCTCTGTTCAGCTGGTTG
60
PDEG-9 AGACCTGCAAGGGGGCCAGCCGCAGGGGGGCTGACTGGTGTGCCCCCAGCCCACAGCGTG AGGGAGTCTAGAAGCCAGACGTCGCCGTGGGTTCTCTGCCAACCTGGGC
ATG
120
AAC
Met Asn CTG
GAG
CCA
CCG
AAG
GCC
GAG
ATC
CGG
TCG
GCC ACC
AGG
GTG ATT
Leu Glu Pro Pro Lys Ala Glu Ile A r g Ser Ala Thr A r g Val Ile GGG
GGG
CCC
GTC
ACT
CCC
AGA
AAA
GGG
CCC
CCC
AAA
TTT
AAG
CAG
G I y GIy Pro Val Thr Pro A r g Lys G I y Pro Pro Lys Phe Lys Gln CGG
CAA
ACC
AGG
CAG
TTC AAG
AGC
AAG
CCC
CCC AAG
AAA
GGC
GTC
A r g Gln Thr A r g Gln Phe Lys Ser Lys Pro Pro Lys Lys G l y Val CAA
GGG
TTT
GGG
GAC
GAC ATC
CCT
GGA
ATG
GAA
GGC
CTG
GGG
ACA
Gln G I y Phe G l y A s p A s p Ile Pro G I y Met Glu Gly Leu G l y Thr GAC
ATC
ACG
GTC
ATC
TGC
CCT
TGG
GAG
GCC
TTC
AAC
CAC
CTG
GAG
A s p Ile Thr Val Ile Cys Pro Trp Glu Ala Phe A s n His Leu GIu CTG
CAC
GAG
CTG
GCC
CAG
TAC
GGC ATC
ATC
TAG
CGCCAGAGCCTGACCC
175
2 220 17 265 32 310 47 355 62 400 77
Leu His Glu Leu Ala Gln Tyr G l y Ile Ile ***
449 87
AGAGGCTTGGGGCCAGGGTCCCTGCCGCCCACTCCGCTCCCTGCTCCGGGTGCCTGCGAG GAGGCCGGCCCCCCCCCGCGGTGTCCAGATGGCCCAGTGTGTGTCTGGAGACCCTCGCAG GGTGGCAGCCTCAGCCCCCAGACGCCCATTACCAGAAGCCCACCAGCTCCCTGCAGGACC CCTCGGGCCCTGCTTCACTACCACAAACACCGGCCCACAGACCTTCTCTTAGGGCAGGAA GGCCAGGCAGGTGTCCCAGGAATGTGCATCACACCCCGCTCCCCTCCTTTGGTCTAGTGA CGAGGACGAGCCCCCCTCACTAGTCTTCCCAGCTGGCGCCCTTGAGCTGAGTGGGCAAGG GGGGGGGGTCCCCGGCGGCCTCAGAGCAGCAGCCCTCTGAAGCCAACACAGCAGCAGGAA GCATCCTGTCCAGCATTGCCCATGCTTGCTGTCCCTGTTTCAGAGTAAAGTTAGTGTGG
509 569 629 689 749 809 869 928
PDEG-8 CCCCCAAAAAAAAAAAAAAAAAAA
952
B Canine: Bovine: Human: Mouse:
I0 20 MNLEPPKAEIRSATRVIGGP .......... MNLEPPKAEIRSATRVMGGP .......... MNLE PPKAEFRSATRVAGGP .......... MNLEPPKGEIRSATRVIGGP ..........
Fig. 2. The nucleotide sequence of P D E y c D N A from canine retina (GenBank accession No. U49359), and the deduced amino acid sequence and its comparison with other species. (A) Canine P D E y cDNA. The position of the nt and the deduced aa are indicated on the right; the aa numbers are shown in bold. The stop codon (TAG) is marked with asterisks (***) and the sequence motif (AGTAAA) present at the polyadenylation site is boldfaced. The location of two primers, P D E G - 8 (forward) and P D E G - 9 (reverse), used for amplification of PDEG from canine genomic DNA, are underlined. (B) Three aa that are not identical in all the four species are boldfaced, and their positions are identified by asterisks. The numbers above the aa denote their locations in PDEy.
subunits (Gt and [3) and the ~-subunit of transducin (Skiba et al., 1995). Unlike the bovine and the human PDEy cDNA (Ovchinnikov et al., 1986; Tuteja et al., 1990), the canine sequence does not contain the canonical polyadenylation signal (AATAAA); instead a similar sequence motif (AGTAAA) is present in the same location (Fig. 2) which may serve as a surrogate polyadenylation signal, albeit of lower efficiency (Wickens, 1990). No information is available for a polyadenylation signal in the published
mouse PDEy cDNA sequence because it lacks a complete 3'-UTR (Tuteja and Farber, 1988).
2.3. Identification and structural analysis of the canine PDEG Based on the canine cDNA sequence, the two primers (PDEG-8 and PDEG-9) shown in Fig. 2 were designed from the 5'- and 3'-ends and used for amplification of PDEG from canine genomic DNA. On amplification, a
4
W. Wanget al./Gene 181 (1996) 1 5 2.8-kb D N A fragment was obtained, a n d its specificity for rod-specific PDEG was e x a m i n e d by nested P C R using i n t e r n a l primers designed from the canine P D E ? c D N A sequence. The 2.8-kb D N A fragment was cloned a n d sequenced from b o t h strands using overlapping primers. The sequencing d a t a indicate that the canine PDEG has four exons i n t e r r u p t e d by three small i n t r o n s (Fig. 3). The first exon (37 nt) a n d part of the second exon (132 of a total 278 nt) represent 5'-UTR. Similarly, a m a j o r p o r t i o n of exon 4 (522 of a total 577 nt) consists of 3 ' - U T R . The sequences of the e x o n - i n t r o n b o r d e r regions for all three i n t r o n s coincides with a splice site canonical sequence (Sharp, 1981), a n d obeys the G T / A G rule for e x o n - i n t r o n j u n c t i o n s (Table 1). I m p o r t a n t features of the canine PDEG, including the locations of the i n t r o n s in the gene, a n d the sizes of the i n t r o n s a n d exons, are s h o w n in Table 1 a n d Fig. 3. The sequence of the entire gene can be accessed from G e n b a n k (Accession No. U49360). Sequence c o m p a r i s o n between the canine P D E 7 c D N A a n d PDEG gene showed only one nucleotide difference located in the 5'-UTR; nt 76 is a C in the c D N A (Fig. 2A), a n d G in the gene. This difference m a y represent a p o l y m o r p h i c change in the gene.
3'
5'
37
278
41
577
2
3
4
205
41
1246
1 5'
3'
44
B ~
31/10
1
~62~ 2
688
491 ~ 3
4
Fig. 3. Genomic organization of PDEG. (A) Canine gene (GenBank accession No. U49360). The canine gene was amplified from genomic DNA by PCR using primers PDEG-8 and PDEG-9 (locations in cDNA shown in Fig. 2) for 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 3.5 min, followed by extension of the reaction at 72°C for 10 min. The PCR was done in 50 p.l containing 10 mM Tris-HCl, pH 8.3, 50 mM KCI, 0.2 mM dNTPs, 1.0 mM MgC12, 10% dimethyl sulfoxide, and 1.25 units Taq polymerase (Life Technologies; Grand Island, NY). The PCR product was cloned in the TA-cloning vector, pCRII (Invitrogen, San Diego, CA). Multiple clones were used for sequencing and both strands of the cloned DNA were sequenced. (B) Human gene (GenBank accession No. U13894). The human gene is shown as described before (Piriev et al., 1994). The numbers of exons are indicated below the exons (boxed). The 5'-UTR and 3'-UTR are indicated by open boxes and the coding region is indicated by the shaded boxes. The numbers of nt in each exon and intron are written above for both the canine and the human genes.
2.4. Comparison between the canine and human PDEG The length of canine PDEG is m u c h shorter (2.8 kb) t h a n the h u m a n gene (6 kb) (Piriev et al., 1994). This
Table 1 Sequence of the intron-exon junctions in the canine PDEG Intron
intron size (bp)
Sequence
at
Exon 5'-splice
I
1246
II
288
III
348
(I)
(2)
(3)
37 CTTG
site
the
sequences
junctions a
Intron 3'-splice
Exon site 1284
gtgagt .......... gtctcctgttccag
1561 CAA GG gtaagc .......... actctgtcctgcag G l n G1 50
ACA rhr
1890 G gtatga .......... cccttctcctgcag A 63 a
Consensus
splice
AG
gt
tt agt ..........
g
(2)
1850 G T T T (3) y Phe 50 2239
AC ATC sp I l e 63
(4)
tttttt tt
CC
GACTT
ncag
G
CCCCCC
aThe capital letters and small letters represent exon and intron sequences, respectively. The terminal nucleotide of each exon present at the splice site junction is numbered above the sequence to indicate its location in the gene. The pair of exons encompassing an intron are identified by numbers in parenthesis. The presence of the splice site canonical sequence gt/ag is boldfaced. Exon 1 is in the 5'-UTR. The triplet codons split by the introns are indicated by showing the encoded amino acids in italics below the codons. The numbers (italicized) of the codons split by the introns are indicated below the amino acid symbols.
W. Wanget al./Gene 181 (1996) 1-5 difference is primarily caused by the smaller size of i n t r o n s 1 a n d 2 in the canine gene. As s h o w n in Fig. 3, the sizes of the first a n d second i n t r o n s of h u m a n PDEG are 2.5 times a n d 5.0 times larger t h a n the c o r r e s p o n d i n g region of the c a n i n e gene, respectively. I n the h u m a n PDEG, the presence of 3 AluI repetitive elements in the first i n t r o n , a n d 2 in the second i n t r o n , c o n t r i b u t e to the relatively larger size of these two i n t r o n s (Piriev et al., 1994).
3. Conclusions (1) We have cloned b o t h the c D N A a n d gene corres p o n d i n g to the c a n i n e rod c G M P - P D E y-subunit. (2) At the nt level, the coding sequence of the c D N A is 95.8%, 91.7%, a n d 90.9% identical with the bovine, h u m a n a n d m o u s e P D E 7 c D N A respectively. The O R F encodes a n 87-aa protein. At the aa level, the differences in P D E y sequence a m o n g these 4 species are limited to only 3 residues at the a m i n o t e r m i n a l (positions 8, 10, a n d 17). (3) The c a n i n e PDEG (2.8 kb), like the h u m a n PDEG, consist of 4 exons. The larger size of the h u m a n gene (6 kb) results p r i m a r i l y from the presence of AluI repetitive elements in the first a n d second introns.
Acknowledgement S u p p o r t e d in part by a Fight for S i g h t / P r e v e n t Blindness A m e r i c a p o s t d o c t o r a l fellowship to Dr. W. Wang, T h e M o r r i s A n i m a l F o u n d a t i o n , The Seeing Eye, Inc., The Collie C l u b of A m e r i c a F o u n d a t i o n , the A M S C / A K C , The F o u n d a t i o n F i g h t i n g Blindness, a n d N E I / N I H G r a n t EY 06855.
References Acland, G.M., Fletcher, R.T., Gentleman, S., Chader, G.J. and Aguirre, G.D. (1989) Non-allelism of three genes (rcdl, rcd2 and erd) for earlyonset hereditary retinal degeneration. Exp. Eye Res. 49, 983-998. Bardien, S., Ebenezer, N., Greenberg, J., Inglehearn, C.F., Bartmann, L., Goliath, R., Beighton, P., Ramesar, R. and Bhattacharya, S.S. (1995) An eighth locus for autosomal dominant retinitis pigmentosa is linked to chromosome 17q. Hum. Mol. Genet. 4, 1459 1462. Bowes, C., Li, T., Danciger, M., Baxter, L.C., Applebury, M.L. and Farber, D.B. (1990) Retinal degeneration in the rd mouse is caused by a defect in the 13subunit of rod cGMP-phosphodiesterase. Nature 347, 677-680.
5
Danciger, M., Blaney, J., Gao, Y.Q., Zhao, D.Y., Heckenlively,J. R., Jacobson, S.G. and Farber, D.B. (1995) Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa. Genomics 30, 1-7. Huang, S.H., Pittler, S.J., Huang, X., Oliveira, L., Berson, E.L. and Dryja, T.P. (1995) Autosomal recessive retinitis pigmentosa caused by mutations in the ~ subunit of rod cGMP phosphodiesterase. Nature Genet. 11,468-471. Hurley, J.B. and Stryer, L. (1982) Purification and characterization of the gamma regulatory subunit of the cGMP phosphodiesterase from retinal rod outer segments. J. Biol. Chem. 257, 11094 11099. McLaughlin, M.E., Ehrhart, T.L., Berson, E.L. and Dryja, T.P. (1995) Mutation spectrum of the gene encoding the 13subunit of rod phosphodiesterase among patients with autosomal recessive retinitis pigmentosa. Proc. Natl. Acad. Sci. USA 92, 3249-3253. Ovchinnikov, Y.A., Lipkin, V.M., Kumarev, V.P., Gubanov, V.V., Khramtsov, N.V., Akhmedov, N.B., Zagranichny, V.E. and Muradov, K.G. (1986) Cyclic GMP phosphodiesterase from cattle retina: amino acid sequence of the y-subunit and nucleotide sequence of the corresponding cDNA. FEBS Lett. 204, 288-292. Piriev, N.I., Khramtsov, N.V. and Lipkin, V.M. (1994) Cloning and characterization of the gene encoding the cGMP-phosphodiesterase y-subunit of human rod photoreceptor cells. Gene 151, 297-301. Pittler, S.J. and Baehr, W. (1991) Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase 13-subunitgene of the rd mouse. Proc. Natl. Acad. Sci. USA 88, 8322-8326. Ray, K., Baldwin, V.J., Acland, G.M., Blanton, S.H. and Aguirre, G.D. (1994) Co-segregation of codon 807 mutation of the rod cGMP phosphodiesterase 13 gene (PDEB) and rcdl. Invest. Ophthalmol. Vis. Sci. 35, 4291-4299. Sharp, P.A. (1981) Speculations on RNA splicing. Cell 23, 643-646. Skiba, N.P., Artemyev, N.O. and Hamm, H.E. (1995) The carboxyl terminus of the y-subunit of rod cGMP phosphodiesterase contains distinct sites of interaction with the enzyme catalytic subunits and the ~-subunit of transducin. J. Biol. Chem. 270, 13210-13215. Suber, M. L., Pittler, S.J., Qin, N., Wright, G.C., Holcombe, V., Lee, R.H., Craft, C.M., Lolley, R.N., Baehr, W. and Hurwitz, R.L. (1993) Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase 13-subunitgene. Proc. Natl. Acad. Sci. USA 90, 3968-3972. Tsang, S.H., Yamashita, C., Tanabe, T., Li, W., Kjeldbye, H., Gouras, P, Farber, D.B. and Goff, S.P. (1996) Gene targeting analysis of the rod cGMP phosphodiesterase inhibitory 7-subunit : morphological and physiological studies. Invest. Ophthalmol. Vis. Sci. 37, $216. Tuteja, N. and Farber, D.B. (1988) y-subunit of mouse retinal cyclicGMP phosphodiesterase: cDNA and corresponding amino acid sequence. FEBS Lett. 232, 182-186. Tuteja, N., Danciger, M., Klisak, I., Tuteja, R., Innana, G., Mohandas, T., Sparkes, R.S. and Farber, D.B. (1990) Isolation and characterization of cDNA encoding the gamma-subunit of cGMP phosphodiesterase in human retina. Gene 88, 227-232. Wickens, M. (1990) How the messenger got its tail: addition of poly (A) in the nucleus. Trends Biochem. Sci. 15, 277-281. Woodford, B.J., Liu, Y., Fletcher, R.T., Chader, G.J., Farber, D.B., Santos-Anderson, R.S. and Tso, M.O.M. (1982) Cyclic nucleotide metabolism in inherited retinopathy in collies: A biochemical and histochemical study. Exp. Eye Res. 34, 703-714. Yamashita, C.K., Tsang, S.H., Gouras, P, Goff, S.P. and Farber, D.B. (1996) Gene targeting of the rod cGMP phosphodiesterase inhibitory y-subunit: biochemical studies of the Pdegtin1 mouse. Invest. Ophthalmol. Vis. Sci. 37, $216.