- Email: [email protected]
Cloning and characterization of two Campoletis chlorideae ichnovirus vankyrin genes expressed in parasitized host Helicoverpa armigera
ARTICLE IN PRESS
Journal of Insect Physiology 53 (2007) 699–707 www.elsevier.com/locate/jinsphys
Cloning and characterization of two Campoletis chlorideae ichnovirus vankyrin genes expressed in parasitized host Helicoverpa armigera Shen-Peng Tiana,b, Ji-Hong Zhanga, Chen-Zhu Wanga, a
State Key Laboratory of Integrated Management of Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100080, China b Graduate School of the Chinese Academy of Sciences, Beijing 100039, China Received 25 November 2006; received in revised form 29 March 2007; accepted 29 March 2007
Abstract Polydnaviruses, symbionts of parasitic ichneumonid (ichnoviruses, IVs) and braconid (bracoviruses, BVs), are injected into hosts along with wasp eggs. Within the host, PDV genes are expressed and their products function to alter lepidopteran host physiology and enable endoparasitoid development. In the present study, we describe two Campoletis chlorideae ichnovirus (CcIV) viral ankyrin (vankyrin) genes and their transcription. The CcIV vankyrin genes possess ankyrin repeat domains that resemble the inhibitory domains of the Drosophila melanogaster NF-kB transcription factor inhibitor (IkB) cactus. The expression of CcIV vankyrin genes could be detected in Helicoverpa armigera during the whole course of parasitization with two expression peaks, 30 min post-parasitization (p.p.) and 2 days p.p. Our data indicate that the CcIV vankyrin genes are differentially expressed in the tissues of parasitized hosts and both are mainly expressed in hemocytes. The temporal and spatial variation in expression of the two CcIV vankyrin genes suggests that CcIV vankyrin genes could be involved in early protection of parasitoid eggs from host cellular immune response by suppressing NF-kB signaling cascades, thereby altering development and immune responses of parasitized lepidopteran hosts. r 2007 Elsevier Ltd. All rights reserved. Keywords: Cloning; Campoletis chlorideae ichnovirus; Vankyrin; Transcription; Quantitative real-time PCR
1. Introduction Polydnaviruses (PDVs) are a group of symbiotic viruses carried by parasitic wasps in the families Braconidae and Ichneumonidae and called bracoviruses (BVs) and ichnoviruses (IVs), respectively (Webb, 1998; Turnbull and Webb, 2002; Kroemer and Webb, 2004). During wasp oviposition, virions are injected into the parasitoid’s host larva along with eggs, ovarian proteins and venom. Compared to other viruses, PDV has a unique genome comprised of multi-segmented double-stranded DNA (Webb, 1998; Webb and Strand, 2005), which is integrated in the wasp genome as a provirus (Fleming and Summers, 1991; Belle et al., 2002). Proviral segments are excised and replicated exclusively in virogenic stroma within the calyx cell nuclei of female wasps (Volkoff et al., 1995; Wyler and Lanzrein, 2003). In the wasp hosts, PDVs do not replicate, Corresponding author. Tel.: +86 10 64807115; fax: +86 10 64807099.
E-mail address: [email protected] (C.-Z. Wang). 0022-1910/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2007.03.015
but host-specific viral genes are expressed. The expression of viral genes in the parasitized host triggers a set of changes in host physiology, which are essential to the survival of the endoparasitoid (Strand and Pech, 1995; Shelby and Webb, 1999; Kroemer and Webb, 2004; Webb and Strand, 2005). These physiological alterations include host developmental disruption and growth inhibition, immunosuppression, hormone changes in the host associated with metamorphosis, and mobilization of host protein stores for parasitoid utilization (Li and Webb, 1994; Cui et al., 1997; Beckage, 1998; Shelby et al., 1998; Shelby and Webb, 1999; Yin et al., 2003; Zhang et al., 2003; Fath-Goodin et al., 2006). Some PDV gene families, such as cys-motif, rep, vinnexin, PTP gene families, have previously been described (Theilmann and Summers, 1988; Cui and Webb, 1996; Turnbull et al., 2005; Gundersen-Rindal and Pedroni, 2006). These gene families have been characterized based on similarities in sequence, protein structure, expression patterns, and function. Recently, another gene family, the
ARTICLE IN PRESS 700
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
vankyrin gene family, was found in Campoletis sonorensis ichnovirus (CsIV) and Microplitis demolitor bracovirus (MdBV) (Kroemer and Webb, 2005; Thoetkiattikul et al., 2005). These genes encode proteins similar to the ankyrin repeat domains (ARD) of the Drosophila melanogaster dorsal/NF-kB transcription factor inhibitor cactus, a member of the IkB gene family. Recombinant MdBV vankyrin gene expression greatly reduced expression of drosomycin and attacin reporter constructs, which are under NF-kB regulation (Thoetkiattikul et al., 2005). NF-kB proteins comprise a family of structurally related eukaryotic transcription factors that are involved in the control of a large number of normal cellular and organismal processes, such as immune responses, developmental processes, cellular growth, and apoptosis (Gillespie et al., 1997; Ghosh et al., 1998; Lavine and Strand, 2002; Hoffmann, 2003; Loker et al., 2004). The promoters for many insect antimicrobial and antifungal peptide genes contain variations of the insect NF-kB transcription factor consensus DNA binding sequence (Dushay and Beckage, 1993; Engstrom et al., 1993; Kappler et al., 1993; Manfruelli et al., 1999; Meng et al., 1999; Kimbrell and Beutler, 2001; Naitza and Ligoxygakis, 2004). Several genes involved in cellular immunity and developmental cascades are also regulated by NF-kB (Belvin and Anderson, 1996; Ghosh et al., 1998; Ghosh and Karin, 2002). In Drosophila, three NF-kB-like factors (Dif, Dorsal, and Relish) regulate expression of antimicrobial peptide genes (Campbell and Wilson, 2002) and numerous other immune molecules (De Gregorio et al., 2001). Therefore, it is widely assumed that NF-kBs play a conserved role in immune regulation because of similarities in the inducible expression of effector molecules across many invertebrates (Hoffmann, 2003; Loker et al., 2004). PDV and PDV gene encoded proteins play important roles in host immune suppression. The presence of IkBrelated genes in PDVs indicates that the PDV infections may target NF-kB mediated activities for disruption, which benefit parasitization by preventing hemocytic immune reactions to the endoparasitic egg and larvae as well as altering host development to support endoparasite survival and development (Kroemer and Webb, 2005; Thoetkiattikul et al., 2005). Cellular encapsulation of foreign objects can be very rapid, sometimes as rapid as 30 min postparasitization (p.p.) (Webb and Luckhart, 1996). As a key immunosuppression factor in ichneumonids, PDV could play a role in protecting the wasp egg at the very beginning of parasitization. However, most studies so far have not shown PDV-encoded protein production in lepidopteran host before 2 h p.p. Although venoms (Asgari et al., 2003a, b), ovarian proteins (Webb and Luckhart, 1996; Asgari et al., 1998; Cui et al., 2000) and other factors may be involved in suppression of the host immune response during the first 2 h, we still have questions about PDV’s function. Our previous study showed that Campoletis chlorideae ichnovirus (CcIV) genes are expressed abundantly in its host, Helicoverpa armigera, during the first
2 days p.p., and their expression peak coincides with protection of the parasitoid egg against encapsulation (Yin et al., 2003). To further explore the role of CcIV in early suppression of the host immune system, we report here two new CcIV vankyrin genes and their expression patterns in H. armigera larvae. We show that these two genes are fully expressed 30 min p.p., which suggests that PDVs can produce virusencoded proteins in hosts much faster than earlier anticipated. Considering the high transcription level, CcIV vankyrin proteins are likely to play a major role in the initial steps of host manipulation. 2. Materials and methods 2.1. Insect culture H. armigera, the lepidopteran host of C. chlorideae, were reared at 2671 1C and a 16-h light (L):8-h dark (D) photoperiod on artificial diets as described in Wang and Dong (2001). A colony of the parasitoid C. chlorideae was started with cocoons collected from Zhengzhou in the Henan province of China. The colony was maintained on H. armigera larvae fed with artificial diet. The host larvae at late second or early third instar were stung by mated female wasps one or two times, and the parasitized host larvae were further reared in an incubator under the same condition until cocoon formation. Fifteen cocoons were collected and kept in a glass tube (2 cm diameter, 10 cm length) plugged with cotton wool until adult emergence. Twenty adults were kept in a cage (10 cm diameter, 20 cm length) with a sex ratio of 1:1. Honey solution (20%) was provided every day as a food source. 2.2. RNA isolation Parasitized H. armigera larvae were frozen in liquid nitrogen and ground as powder for RNA extraction at various time intervals (30 min, 1, 2, 6, 12 h, 1, 2, 3, 4, 5, 6, 7 days) p.p. RNeasy Mini Kit (RNA extraction kit, QIAGEN) was used for total RNA isolation according to the manufacturer’s instructions. After determining the concentrations of RNA samples by measuring the absorbance at 260 nm, the samples were stored at 80 1C for further analysis. As controls, RNA samples were also collected from nonparasitized larvae. The quality of the RNA was analyzed by agarose gel electrophoresis in the presence of 1% formaldehyde. For analysis of CcIV vankyrin gene expression in different tissues, 2 days p.p. H. armigera larvae were anesthetized by immersion in ice-cold phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4 7H2O, 1.4 mM KH2PO4, pH 7.4) for 20 min prior to dissection. Hemolymph was drawn from the parasitized larvae with a capillary tube through an opening made by cutting off a hindleg and bled into 200 ml ice-cold PBS. Hemocytes were collected by centrifugation at
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
800 g and washed three times in PBS. After collecting hemocytes, the parasitized H. armigera larvae were dissected in PBS under a stereo light microscope. Fat body, nerve cord, epidermal layer (including muscle, trachea, and epidermis), and digestive tract (including gut and Malphigian tubules) tissues were collected and placed in ice-cold PBS separately. To prevent contamination with hemolymph, purified tissues were centrifuged at 800 g for 5 min and washed with PBS three times prior to RNA extraction. The procedures of RNA extraction were the same as described above. All RNA samples were treated with DNase I (QIAGEN) prior to real-time quantitative RT-PCR. The absence of contaminating genomic DNA in the RNA samples was verified by running PCR directly without reverse transcription. 2.3. Cloning of full length CcIV vankyrin cDNA 2.3.1. CcIV vankyrin cDNA fragments amplification by RT-PCR To clone the CcIV vankyrin cDNA fragment, 2 mg total RNA from 10 parasitized third instar H. armigera larvae at 2 days p.p. was reverse-transcribed using a cDNA synthesis kit (ThermoScripte RT-PCR system, Invitrogen) according to the manufacturer’s protocol. We used 1 ml of the reverse transcript (RT) products for PCR. According to the comparison between the published CsIV vankyrin cDNA sequences, four degenerate primers, VK-F, VK-R1, VK-R2 and VK-R3 were designed and synthesized by Invitrogen (details in Table 1). Following a 5-min denaturation at 94 1C, PCR was run for 35 cycles (each cycle: 30 s of denaturation at 94 1C, 30 s of annealing at 50 1C and 30 s of extension at 72 1C), followed by 10 min at 72 1C. To visualize gene fragments, 5 ml of PCR product was electrophoresed on a 2% agarose gel. 2.3.2. Cloning and sequencing of CcIV vankyrin cDNA fragments PCR products from a 1.2% agarose gel were purified with the QIAquicks Gel Extraction kit (QIAGEN) and ligated into the pGEM-T Easy cloning vector (Promega). The ligation mixture was transformed into DH5a competent cells for propagation of the recombinant plasmid. Positive clones were picked for PCR under abovementioned conditions, and appropriate colonies were sequenced to confirm that no mutation or error had occurred during PCR or other experimental processes. 2.3.3. Cloning of full length CcIV vankyrin cDNA by 30 - and 50 -RACE After determining the nucleotide sequence of the partial clone of vankyrin cDNA from the PCR products induced by degenerate primers, vankyrin gene-specific primers (GSP) were designed for 30 -RACE and 50 -RACE, respectively (details in Table 1).
701
Table 1 Oligodeoxynucleotide primers used for synthesis and amplification of partial, 30 -RACE, 50 -RACE and real-time PCR of CcIV vankyrin cDNA Fragments Primers
Sequences
CcIV vankyrin fragment
VK-F VK-R1 VK-R2 VK-R3
AMYATATTNCACGAGMTTG GVAAMATDHYYATCATCT TACTTTCAWTCACTTTCGG CCACWTYGYSAGSRYGTAAT
CcIV vank-1 30 Region
30 GSP1 30 GSP2 AP-dT AP
ATCGTTCCATTCTATCCTGC GAGCCGATCTGAATGGCACAA CTGATCTAGAGGTACCGGATCC(T)18 CTGATCTAGAGGTACCGGATCC
CcIV vank-1 50 Reigon
RT S1 S2 A1 A2
TATGCCGTTAGTCC GTCAGGCTGTACTGTGCTCCA AAGGGTGGTACGGACTAACG TGCCATTCAGATCGGCTCC GCAATCTCGTGGAATATGGT
CcIV vank-2 30 Reigon
30 GSP1 30 GSP2 AP-dT AP
GAATATGACTGTCCTCCACCTTG CAGCAGCCAATTCTTGATATCAATG CTGATCTAGAGGTACCGGATCC(T)18 CTGATCTAGAGGTACCGGATCC
CcIV vank-2 50 Region
RT S1 S2 A1 A2
TCGCCCGTTGAGT GAATATGACTGTCCTCCACCTTGCG ATGGGCTTTGATGGAACGACTG AAATCCAATGGCCCGCCGTAGTTAT CCAGTTCGGACAAGCTCGTGTAAT
Real-time PCR
vank-1-F vank-1-R vank-2-F vank-2-R 18S-F 18S-R
ACATATTCCACGAACTTGCGG TCAGATCGGCTCCCATTGAC CGAGGACGTCGTGCAATACTC CCATCAAAGCCCATTGCATT GTGTAAACGCAAGACGCGAC TTGATTGTTAACGAACGCGTG
In order to amplify the 30 end of CcIV vank-1 and vank2, nest-PCR was used. In the first round of PCR, 1 ml RT products were used as template and GSP1 and AP were used as primers; 30 cycles of amplification were performed using a cycle profile of 94 1C for 30 s, 56 1C for 30 s, and 72 1C for 2 min. Then, 1 ml of 100-fold diluted first-round PCR product was subjected to a nest-PCR, and the primers were GSP2 and AUAP; 30 cycles of amplification were performed using the same cycle profile as that using for the first round PCR. 50 -Full RACE Core Set kit (TaKaRa Biotechnology) was used to amplify the 50 end of CcIV vank-1 and vank-2 according to the instructions of the manufacturer. The obtained PCR products were cloned into the pGEM-T easy vector (Promega) for sequencing. Nucleotide sequences were analyzed using DNAMAN. Alignments of PDV vankyrin proteins were performed using Clustal X software (http:// www-igbmc.u-strasbg.fr/Bioinfo/). Alignments were bootstrapped from 10,000 independent trials using a random number generator of 200 for vankyrin proteins. Phylogenetic trees were constructed from alignments using MEGA software (Version 3.1) with nodal placement of bootstrap values and a ladderise left orientation of branches.
ARTICLE IN PRESS 702
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
2.4. Quantitative real-time PCR (qRT-PCR) Primers for CcIV vank-1, CcIV vank-2 and 18S rRNA were designed using Primer Express version 2.0 (PE Applied Biosystems). Primers for CcIV vank-1, CcIV vank-2 and 18S rRNA gene were designed to amplify less than 250 bp PCR products (the detailed sequence of primers is showed in Table 1). The obtained vank-1 PCR products were cloned into pGEM-T easy vector (Promega). The recombinant plasmid was prepared using a QIAprep Spin Miniprep Kit (QIAGEN), using 10-fold dilutions, ranging from 109 to 102 copies. cDNA pools created for the CcIV vankyrin gene clone (1 ml cDNA synthesized from 2 mg total RNA/reaction)
were subjected to 40 rounds of PCR in the presence of SYBRs Premix Ex TaqTM (TaKaRa) according to manufacturer’s instructions. The fluorescence intensity was monitored after each PCR cycle with mean threshold cycles determined for all unknowns and a serially diluted plasmid standard testing positive for amplification of each gene. Reactions were performed in triplicate for standards and cDNA from each unknown tissue and time point of postparasitization. Starting quantities for all unknown cDNA samples were calculated on the basis of the linear standard equation formulated from starting quantities and mean log threshold fluorescence values obtained from standards. Mean starting quantities of unknowns were calculated
Fig. 1. Protein sequence alignment of the CcIV vankyrin genes with other IV vankyrins and some typical IkBs. Locations of Drosophila cactus ankyrin repeats 1–6 have been denoted according to Dushay et al. (1996). Alignments were created with Clustal X software (http://www.igbmc.u-strasbg.fr/ Bioinfo/). NCBI accession numbers: Drosophila cactus (A44269), IkBe human (O00221), IkBa human (A39935), IkBa pig (CAA84619), CsIV I2-vank-1 (AAX56957), CsIV I2-vank-2(AAX56958), CsIV I2-vank-3 (AAX56959), CsIV P-vank-1 (AAX56953), CsIV P-vank-2 (AAX56954), CsIV P-vank-3 (AAX56955), CsIV P-vank-4 (AAX56956), HfIV vankyrin 1 (AAS90270), HfIV vankyrin 2 (AAX24120), TrIV vankyrin 1 and TrIV vankyrin 2 (AY940454).
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
from the three independent runs, normalized to 18S rRNA, and plotted for each cDNA sample to determine the mean relative starting quantities present in each unknown. Reactions were performed on a Stratagene MX 3000p Real-time PCR Thermalcycler. 3. Results 3.1. Cloning and sequence analyses of CcIV vankyrin genes The 30 - and 50 -RACE revealed two cDNA sequences, named CcIV vank-1 and vank-2, respectively (GenBank accession no. DQ845287 and DQ845288). The full length CcIV vank-1 cDNA consisted of 886 bp with a 108 bp 50 -untranslated region and 278 bp 30 -untranslated region, including a polyadenylation signal (AATAAA) and a poly(A) tail. The full length CcIV vank-2 cDNA consisted of 645 bp with a 102 bp 50 -untranslated region and 36 bp 30 -untranslated region, including a TATA box (37 bp)
703
and a poly(A) tail. Aligned by DNAMAN, the overall identities of CcIV vank-1 and vank-2 to CsIV I2-vank-1 and I2-vank-2 (GenBank accession no. AF362517) were 95.5% and 91.5%, respectively, but the identity between CcIV vank-1 and vank-2 was only 54.9%. The open reading frames (ORF) of CcIV vank-1 (468 bp) and vank-2 (507 bp) encoded 155 and 168 amino acids, respectively, which lacked predicted secretory signal peptides and exhibited variable degrees of similarity to the ARD of Drosophila cactus and mammalian IkBs. All known IkBs have a central ARD that usually consists of six ankyrin repeats (Ghosh et al., 1998; Michel et al., 2001). While predicted CcIV vankyrin proteins had centrally located ARDs comprising four ankyrin repeats that aligned with ankyrin repeats 3–6 of Drosophila cactus and mammalian IkBs, they were much smaller than cactus or mammalian IkB because of a reduced ARD and the absence of regulatory regions in their N and C termini (Fig. 1). Most significant alignment occurs over ankyrin
Fig. 2. Phylogenetic alignments of PDV vankyrin proteins. Phylogenetic tree (bootstrapped from 10,000 replicates; seed ¼ 3000) constructed from alignment of PDV vankyrin proteins, including Campoletis chloridae ichnovirus (CcIV), C. sonorensis IV (CsIV), Micriplitis demolitor BV (MdBV), Cotesia congregata BV (CcBV), Toxoneuron nigriceps BV (TnBV), Tranosema rostrale IV (TrIV), Hyposoter fugitivus IV (HfIV), Glyptapanteles indiensis BV (GiBV) and Hyposoter didymator IV (HdIV), selected mammalian IkB proteins, and the IkB proteins Relish and Cactus from Drosophila. Each vankyrin and IkB along its accession number is listed to the right of the dendrograms.
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
704
repeats 4 and 5 of Drosophila cactus, with less overlap exhibited over repeats 3 and 6 (Fig. 1). Predicted vankyrin genes from C. chlorideae IV were similar to those from the C. sonorensis IV, Hyposoter fugitivus IV, Tranosema rostrale IV and aligned in the same regions. All of them lack two N-terminal ankyrin repeats and N- and C-terminal protease sensitive domains involved with regulation of typical IkB protein activities (Fig. 1). Phylogenetic analysis of the PDV vankyrin and mammalian and Drosophila IkBs was performed at the amino acid level. The phylogenetic tree of the PDV vankyrin and IkB revealed that the vankyrin family was divided into two groups: BVs and IVs (Fig. 2). IV vankyrins are more related to one another than they are to the corresponding genes in BVs. Alignment of all PDV vankyrin proteins using mammalian and Drosophila IkBs as outgroups produced incompletely resolved trees that provide no clear evidence of shared ancestry. 3.2. Temporal transcription of vankyrin genes Using qRT-PCR, we found that CcIV vank-1 and vank-2 had the same expression patterns in the host. The highest
expression levels of both CcIV vankyrin genes occurred at 30 min p.p., then decreased sharply at 2 h p.p., and was maintained at relatively lower levels during the following days of parasitization. Furthermore, a second expression peak gradually emerged at 2 days p.p., which is about 1/5 and 1/8 of the corresponding expression level of vank-1 and vank-2 at 30 min p.p. (Fig. 3A and B).
3.3. Tissue specificity of vankyrin gene transcription To delineate the tissue specificity of CcIV vank-1 and vank-2 transcription in parasitized hosts, total RNA was isolated from various tissues of 2-days-p.p. H. armigera fourth-instar larvae (corresponding to the second expression peak because the first peak was difficult to target) and subjected to qRT-PCR analyses as performed for temporal profiling of gene transcription in parasitized larvae. The two genes were predominantly expressed in hemocytes but could also be detected in fat body, nerve cord, digestive tract, and the epidermal layer. In host head capsules, the two gene transcript levels were very low (Fig. 3C and D).
4.50E+06
7.00E+04
4.00E+06 3.50E+06 Mean Copies (18S rRNA normalized)
Mean Copies (18S rRNA normalized)
6.00E+04 5.00E+04 4.00E+04 3.00E+04 2.00E+04
3.00E+06 2.50E+06 2.00E+06 1.50E+06 1.00E+06
1.00E+04
5.00E+05
0.00E+00 Ct1 30min 60min 2h
6h 12h 24h 2d
3d
4d
5d
6d
0.00E+00
7d
1.60E+05
NC
FB
DT
EL
Head
HC
NC
FB
DT
EL
Head
4.00E+05
1.40E+05
3.50E+05
1.20E+05 Mean Copies (18S rRNA normalized)
Mean Copies (18S rRNA normalized)
HC
1.00E+05 8.00E+04 6.00E+04 4.00E+04 2.00E+04
3.00E+05 2.50E+05 2.00E+05 1.50E+05 1.00E+05 5.00E+04
0.00E+00 Ct1 30min60min2h 6h 12h 24h 2d
3d
4d
5d
6d
7d
0.00E+00
Fig. 3. The temporal and spatial variations of CcIV vankyrin genes transcription. Quantitative real-time PCR for (A) CcIV vank-1 from 30-min to 7-day time course of parasitization; (B) CcIV vank-2 from 30-min to 7-day time course of parasitization; (C) CcIV vank-1 in selected tissues of 3-day-p.p. H. armigera larvae; (D) CcIV vank-2 in selected tissues of 3-day-p.p. H. armigera larvae. All values for viral genes were normalized to 18S rRNA controls to account for variations in cDNA pools. Error bars represent +1 S.D. from the mean. Ctl, control H. armigera; min, minutes p.p.; h, hours p.p.; d, days p.p.; HC, 2-day-p.p. hemocytes; NC, 2-day-p.p. nerve cord; FB, 2-day-p.p. fat body; DT, 2-day-p.p. digestive tract (including gut and malpighian tubules); EL, 2-day-p.p. epidermal layer (including trachea, muscles, and epidermis).
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
4. Discussion In the present study, two vankyrin genes in CcIV were characterized, named CcIV vank-1 and vank-2. Their predicted proteins exhibit variable degrees of similarity to the ankyrin repeat domains of Drosophila cactus and mammalian IkBs, the inhibitor of NF-kB. In most cells, NF-kB functions as latent gene regulatory proteins and are retained due to complex formation with IkB proteins in the cytoplasm of cells (Huxford et al., 1998; Jacobs and Harrison, 1998; Michel et al., 2001; Ghosh and Karin, 2002). Previous studies suggest that ARD is essential for IkB-NF-kB binding (Ghosh et al., 1998; Huxford et al., 1998; Jacobs and Harrison, 1998; Michel et al., 2001). Within the ARD, ankyrin repeats 3–6 form the largest number of interactions with NF-kBs, which suggests that four ankyrin repeats may be sufficient to form stable complexes with NF-kBs (Huxford et al., 1998). Predicted CcIV vankyrin proteins consisted of four ankyrin repeats that aligned with ankyrin repeats 3–6 of Drosophila cactus and mammalian IkBs. The African swine fever virus (ASFV) encodes an IkB-like gene, comprised of four ankyrin repeats too, which can disrupt the function of mammalian NF-kB p50/p65 (Revilla et al., 1998). This suggests that PDV vankyrin proteins may also possess the function of suppressing NF-kB activity during immune responses and developmental regulatory cascades in parasitized lepidopteran host. It has been shown that recombinant MdBV H4 and N5 with PDV vankyrin genes greatly reduces expression of drosomycin and attacin reporter constructs, which are under NF-kB regulation through the Toll and Imd pathways (Thoetkiattikul et al., 2005). IkBs have a central ARD that usually consists of six ankyrin repeats (Ghosh et al., 1998; Michel et al., 2001). Drosophila cactus, one of the family members, has signalreceiving domains (SRDs), N-terminal to the ARD, that accept phosphorylation and ubiquitination signals, whereas the C-terminal domains contain proline, glutamic acid, serine, and threonine (PEST) residues implicated in protein turnover (Ghosh et al., 1998; Ghosh and Karin, 2002). Vankyrin proteins in CcIV and other PDV genomes are much smaller than Drosophila cactus and mammalian IkBs because of a reduced ARD and absence of the N-terminal and C-terminal regulatory domains. This may be due to the fact that parasitoid-derived proteins abolish host function by blocking immune proteins without having to respond to other regulatory functions. In previous studies, Yin et al. (2003) detected CcIV transcripts 1 day p.p. and continued for 5 days in host hemocytes as indicated by cDNA hybridization. We found that CcIV vank-1 and vank-2 could be detected in the host 30 min p.p. and continued all thorough parasitization. There were two expression peaks, 30 min p.p. and 2 days p.p., respectively. The first expression peak at 30 min p.p. was more than 100-fold higher than that at 7 days p.p., and then the expression level declined sharply at 2 h p.p. These results suggest that the two CcIV vankyrin genes could be
705
early viral genes expressed rapidly and involved in early protection of parasitoid eggs from host immune response. Kroemer and Webb (2005) detected CsIV vankyrin gene expression within 2–4 h p.p. in H. virescens hosts and reached peak levels by 3 days p.p., but they did not test earlier time points of post-parasitization. Considering the difference in the study systems and rearing condition, the second expression peak (2 days p.p.) in CcIV may coincide with the CsIV vankyrin genes’ expression peak. Later, other immune-related genes may possibly have been activated, and then vankyrin gene expression level declined steeply. Suppression of the host immune response after parasitization is essential for the survival of the parasitoid wasp. Cellular encapsulation of foreign objects can be very rapid, possibly as rapid as 30 min p.p. (Webb and Luckhart, 1996). This forces the parasitoid to mobilize its immunesuppression system functions immediately after laying eggs into the host. In H. virescens larvae parasitized by C. sonorensis, ovarian proteins are introduced with the parasite egg and rapidly but transiently alter hemocyte morphology and disable the immune response (Webb and Luckhart, 1996). Asgari et al. (1998) reported that an ovary protein (Crp32) inhibited host immune response by coating the wasp egg surface. Wasp egg surface could interact with host hemolymph proteins that provide surface protection (Kinuthia et al., 1999). Venom and viral envelop proteins in the female ovary may also be involved in wasp egg protection (Webb and Luckhart, 1994). The previous study in our lab showed that washed C. chlorideae eggs alone were protected from host hemocytes encapsulation to a certain degree, and injecting female wasp calyx fluid further protected the washed wasp eggs from encapsulation (Yin et al., 2003). Treated with proteinase K, all the washed wasp eggs were encapsulated at 1 day post-injection (data not published). Together with the results here we hypothesize that ovarian proteins, venoms or other surface molecules of the C. chlorideae egg may cooperate with CcIV encoded proteins to initiate the rapid immunosuppression toward host. Temporal expression studies revealed another expression peak of CcIV vankyrin genes at 2 days p.p. The development of the parasitoid may explain this phenomenon. Based on our dissection results, the C. chlorideae egg hatched at about 2 days p.p. Emerging from the egg shell, the wasp larvae would face the challenge of host encapsulation again. The higher expression level of vankyrin genes at this time point is presumably beneficial to protect the development of wasp larvae. The persistence of PDV transcripts in parasitized insects varied significantly. Expression of some PDV viral genes appeared to be highly transient while other viral genes remained at constant levels throughout endoparasite development. Expression of BV genes has been reported to be transient or decreasing in later stages of parasitization (Asgari et al., 1996; Strand et al., 1997). In both PDV genera, viruses were able to persist without viral replication in parasitized insects to late stages of parasitoid development. The
ARTICLE IN PRESS 706
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
presence of CcIV vankyrin transcripts through the parasitization process suggests that CcIV vankyrin genes may have a continuous function in the protection of the developing endoparasitoid. CcIV vank-1 and vank-2 could be detected at hemocytes, fat body, nerve cord, epidermal layer, and digestive tract 2 days p.p., and both are mainly expressed in hemocytes. Kroemer and Webb (2005) detected that CsIV vankyrin genes were differently expressed in parasitized host tissues and can be divided into two subclasses: those that target the host fat body and those that target host hemocytes. The P-vank-1, I2-vank-2, and I2-vank-3 genes exhibit the highest levels of transcription in the parasitized fat body relative to other tissues, while transcription of P-vank-2, P-vank-3, P-vank-4, and I2-vank-1 predominantly was expressed in hemocytes (Kroemer and Webb, 2005). Some MdBV vankyrin gene family members are preferentially expressed in host hemocytes and fat body, whereas others are expressed elsewhere (Thoetkiattikul et al., 2005). Although PDV virions enter a variety of tissues, hemocytes are almost always the most heavily infected tissue in terms of the amount of detectable viral DNA (Strand et al., 1992; Li and Webb, 1994; Yin et al., 2003). Preferential infection of hemocytes could be due to the fact that wasps oviposit directly into the hemocoel, and hemocytes are the first cells virions encounter and play a key role in immunity. Lacking a basement membrane, hemocytes may further facilitate infection. The fact that the vankyrin genes have diversified to form multiple gene variants may be due to the possibility that vankyrin proteins have functional activities that differ among insect tissues. The variation in temporal and spatial gene expression p.p. in different host tissues suggested that the two CcIV vankyrin genes may be involved in suppressing host immune response, or the host regulatory system affecting viral expression during parasitism. Further studies of the CcIV vankyrin gene encoded proteins and their interactions with host proteins may have physiological relevance to understanding host regulatory processes. Acknowledgments We thank Professor B.A. Webb (University of Kentucky, USA) and Dr. Li-Wang Cui (University of Pennsylvania, USA) for suggestions during this study; thank Dr. HongSheng Wang and Cheng-Song Zhou for providing excellent technical assistance. This work was supported by the innovation program of Chinese Academy of Sciences (Grant no. KSCX2-YW-N-006), National Natural Science Foundation of China (Grant no. 30621003), and Beijing Natural Science Foundation (Grant no. 5052020). Appendix A. Supplementary materials Supplementary data associated with this article can be found in the online version at doi:10.1016/j.jinsphys.2007.03.015
References Asgari, S., Hellers, M., Schmidt, O., 1996. Host haemocyte inactivation by an insect parasitoid: transient expression of a polydnavirus gene. Journal of General Virology 77, 2653–2662. Asgari, S., Theopold, U., Wellby, C., Schmidt, O., 1998. A protein with protective properties against the cellular defense reactions in insects. Proceedings of the National Academy of Sciences of the United States of America 95, 3690–3695. Asgari, S., Zareie, R., Zhang, G.M., Schmidt, O., 2003a. Isolation and characterization of a novel venom protein from an endoparasitoid, Cotesia rubecula (Hym: Braconidae). Archives of Insect Biochemistry and Physiology 53, 92–100. Asgari, S., Zhang, G.M., Zareie, R., Schmidt, O., 2003b. A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph. Insect Biochemistry and Molecular Biology 33, 1017–1024. Beckage, N.E., 1998. Modulation of immune responses to parasitoids by polydnaviruses. Parasitology 116, S57–S64. Belle, E., Beckage, N.E., Rousselet, J., Poirie, M., Lemeunier, F., Drezen, J.M., 2002. Visualization of polydnavirus sequences in a parasitoid wasp chromosome. Journal of Virology 76, 5793–5796. Belvin, M.P., Anderson, K.V., 1996. A conserved signaling pathway: the Drosophila Toll-Dorsal pathway. Annual Review of Cell and Developmental Biology 12, 393–416. Campbell, C.L., Wilson, W.C., 2002. Differentially expressed midgut transcripts in Culicoides sonorensis (Diptera: Ceratopogonidae) following Orbivirus (Reoviridae) oral feeding. Insect Molecular Biology 11, 595–604. Cui, L.W., Webb, B.A., 1996. Isolation and characterization of a member of the cysteine-rich gene family from Campoletis sonorensis polydnavirus. Journal of General Virology 77, 797–809. Cui, L.W., Soldevila, A., Webb, B.A., 1997. Expression and hemocytetargeting of a Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens larvae. Archives of Insect Biochemistry and Physiology 36, 251–271. Cui, L.W., Soldevila, A.I., Webb, B.A., 2000. Relationships between polydnavirus gene expression and host range of the parasitoid wasp Campoletis sonorensis. Journal of Insect Physiology 46, 1397–1407. De Gregorio, E., Spellman, P.T., Rubin, G.M., Lemaitre, B., 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proceedings of the National Academy of Sciences of the United States of America 98, 12590–12595. Dushay, M.S., Beckage, N.E., 1993. Dose-dependent separation of Cotesia congregata associated polydnavirus effects on Manduca sexta larval development and immunity. Journal of Insect Physiology 39, 1029–1040. Dushay, M.S., Asling, B., Hultmark, D., 1996. Origins of immunity: relish, a compound Rel-like gene in the antibacterial defense of Drosophila. Proceedings of the National Academy of Sciences of the United States of America 93, 10343–10347. Engstrom, Y., Kadalayil, L., Sun, S.C., Samakovlis, C., Hultmark, D., Faye, I., 1993. Kappa-B-like motifs regulate the induction of immune genes in Drosophila. Journal of Molecular Biology 232, 327–333. Fath-Goodin, A., Gill, T.A., Martin, S.B., Webb, B.A., 2006. Effect of Campoletis sonorensis ichnovirus cys-motif proteins on Heliothis virescens larval development. Journal of Insect Physiology 52, 576–585. Fleming, J.A.G.W., Summers, M.D., 1991. Polydnavirus DNA is integrated in the DNA of its parasitoid wasp host. Proceedings of the National Academy of Sciences of the United States of America 88, 9770–9774. Ghosh, S., Karin, M., 2002. Missing pieces in the NF-kappa B puzzle. Cell 109, S81–S96. Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-kappa B and rel proteins: evolutionarily conserved mediators of immune responses. Annual Review of Immunology 16, 225–260.
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707 Gillespie, J.P., Kanost, M.R., Trenczek, T., 1997. Biological mediators of insect immunity. Annual Review of Entomology 42, 611–643. Gundersen-Rindal, D.E., Pedroni, M.J., 2006. Characterization and transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the parasitized host. Journal of General Virology 87, 311–322. Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38. Huxford, T., Huang, D.B., Malek, S., Ghosh, G., 1998. The crystal structure of the I kappa B alpha/NF-kappa B complex reveals mechanisms of NF-kappa B inactivation. Cell 95, 759–770. Jacobs, M.D., Harrison, S.C., 1998. Structure of an I kappa B alpha/NFkappa B complex. Cell 95, 749–758. Kappler, C., Meister, M., Lagueux, M., Gateff, E., Hoffmann, J.A., Reichhart, J.M., 1993. Insect immunity. Two 17 bp repeats nesting a Kappa-B-related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteria-challenged Drosophila. Embo Journal 12, 1561–1568. Kimbrell, D.A., Beutler, B., 2001. The evolution and genetics of innate immunity. Nature Reviews Genetics 2, 256–267. Kinuthia, W., Li, D., Schmidt, O., Theopold, U., 1999. Journal of Insect Physiology 45, 501–506. Kroemer, J.A., Webb, B.A., 2004. Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annual Review of Entomology 49, 431–456. Kroemer, J.A., Webb, B.A., 2005. I kappa beta-related vankytin genes in the Campoletis sonorensis Ichnovirus: temporal and tissue-specific patterns of expression in parasitized Heliothis virescens lepidopteran hosts. Journal of Virology 79, 7617–7628. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochemistry and Molecular Biology 32, 1295–1309. Li, X.S., Webb, B.A., 1994. Apparent functional-role for a cysteine-rich polydnavirus protein in suppression of thei insect cellular immuneresponse. Journal of Virology 68, 7482–7489. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune system—not homogeneous, not simple, not well understood. Immunological Reviews 198, 10–24. Manfruelli, P., Reichhart, J.M., Steward, R., Hoffmann, J.A., Lemaitre, B., 1999. A mosaic analysis in Drosophila fat body cells of the control of antimicrobial peptide genes by the Rel proteins Dorsal and Dif. Embo Journal 18, 3380–3391. Meng, X.J., Khanuja, B.S., Ip, Y.T., 1999. Toll receptor-mediated Drosophila immune response requires Dif, an NF-kappa B factor. Genes and Development 13, 792–797. Michel, F., Soler-Lopez, M., Petosa, C., Cramer, P., Siebenlist, U., Muller, C.W., 2001. Crystal structure of the ankyrin repeat domain of Bcl-3: a unique member of the I kappa B protein family. EMBO Journal 20, 6180–6190. Naitza, S., Ligoxygakis, P., 2004. Antimicrobial defences in Drosophila: the story so far. Molecular Immunology 40, 887–896. Revilla, Y., Callejo, M., Rodriguez, J.M., Culebras, E., Nogal, M.L., Salas, M.L., Vinuela, E., Fresno, M., 1998. Inhibition of nuclear factor kappa B activation by a virus-encoded I kappa B-like protein. Journal of Biological Chemistry 273, 5405–5411. Shelby, K.S., Webb, B.A., 1999. Polydnavirus-mediated suppression of insect immunity. Journal of Insect Physiology 45, 507–514.
707
Shelby, K.S., Cui, L., Webb, B.A., 1998. Polydnavirus-mediated inhibition of lysozyme gene expression and the antibacterial response. Insect Molecular Biology 7, 265–272. Strand, M.R., Pech, L.L., 1995. Immunological basis for compatibility in parasitoid host relationships. Annual Review of Entomology 40, 31–56. Strand, M.R., Mckenzie, D.I., Grassl, V., Dover, B.A., Aiken, J.M., 1992. Persistence and expression of Microplitis demolitor polydnavirus in Pseudoplusia includens. Virology 73, 1627–1635. Strand, M.R., Witherell, R.A., Trudeau, D., 1997. Two Microplitis demolitor polydnavirus mRNAs expressed in hemocytes of Pseudoplusia includens contain a common cysteine-rich domain. Journal of Virology 71, 2146–2156. Theilmann, D.A., Summers, M.D., 1988. Identification and comparison of Campoletis sonorensis virus transcripts expressed from four genomic segments in the insect hosts Campoletis sonorensis and Heliothis virescens. Virology 167, 329–341. Thoetkiattikul, H., Beck, M.H., Strand, M.R., 2005. Inhibitor kappa Blike proteins from a polydnavirus inhibit NF-kappa B activation and suppress the insect immune response. Proceedings of the National Academy of Sciences of the United States of America 102, 11426–11431. Turnbull, M., Webb, B., 2002. Perspectives on polydnavirus origins and evolution. Advances in Virus Research 58, 203–254. Turnbull, M.W., Volkoff, A.N., Webb, B.A., Phelan, P., 2005. Functional gap junction genes are encoded by insect viruses. Current Biology 15, R491–R492. Volkoff, A.N., Ravallec, M., Bossy, J.P., Cerutti, P., Rocher, J., Cerutti, M., Devauchelle, G., 1995. The replication of Hyposoter didymator polydnavirus—cytopathology of the calyx cells in the parasitoid. Biology of the Cell 83, 1–13. Wang, C.Z., Dong, J.F., 2001. Interspecific hybridization of Helicoverpa armigera and H. assulta (Lepidoptera: Noctuidae). Chinese Science Bulletin 46, 489–491. Webb, B.A., 1998. Polydnavirus biology, genome structure, and evolution. In: Miller, L.K., Balls, L.A. (Eds.), The Insect Viruses. Plenum, New York, pp. 105–139. Webb, B.A., Luckhart, S., 1994. Evidence for an early immunosuppressive role for related Campoletis sonorensis venom and ovarian proteins in Heliothis virescens. Archives of Insect Biochemistry and Physiology 26, 147–163. Webb, B.A., Luckhart, S., 1996. Factors mediating short- and long-term immune suppression in a parasitized insect. Journal of Insect Physiology 42, 33–40. Webb, B.A., Strand, M.R., 2005. The biology and genomics of polydnaviruses. In: Lawrence, I.G., Kostas, I., Sarjeet, S.G. (Eds.), Comprehensive Molecular Insect Science. Elsevier, Oxford, pp. 323–360. Wyler, T., Lanzrein, B., 2003. Ovary development and polydnavirus morphogenesis in the parasitic wasp Chelonus inanitus. II. Ultrastructural analysis of calyx cell development, virion formation and release. Journal of General Virology 84, 1151–1163. Yin, L.H., Zhang, C., Qin, J.D., Wang, C.Z., 2003. Polydnavirus of Campoletis chlorideae: characterization and temporal effect on host Helicoverpa armigera cellular immune response. Archives of Insect Biochemistry and Physiology 52, 104–113. Zhang, C., Yan, Y.H., Wang, C.Z., 2003. Degeneration of host prothoracic glands caused by Campoletis chlorideae polydnavirus. Progress in Natural Science 13, 690–695.
Journal of Insect Physiology 53 (2007) 699–707 www.elsevier.com/locate/jinsphys
Cloning and characterization of two Campoletis chlorideae ichnovirus vankyrin genes expressed in parasitized host Helicoverpa armigera Shen-Peng Tiana,b, Ji-Hong Zhanga, Chen-Zhu Wanga, a
State Key Laboratory of Integrated Management of Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100080, China b Graduate School of the Chinese Academy of Sciences, Beijing 100039, China Received 25 November 2006; received in revised form 29 March 2007; accepted 29 March 2007
Abstract Polydnaviruses, symbionts of parasitic ichneumonid (ichnoviruses, IVs) and braconid (bracoviruses, BVs), are injected into hosts along with wasp eggs. Within the host, PDV genes are expressed and their products function to alter lepidopteran host physiology and enable endoparasitoid development. In the present study, we describe two Campoletis chlorideae ichnovirus (CcIV) viral ankyrin (vankyrin) genes and their transcription. The CcIV vankyrin genes possess ankyrin repeat domains that resemble the inhibitory domains of the Drosophila melanogaster NF-kB transcription factor inhibitor (IkB) cactus. The expression of CcIV vankyrin genes could be detected in Helicoverpa armigera during the whole course of parasitization with two expression peaks, 30 min post-parasitization (p.p.) and 2 days p.p. Our data indicate that the CcIV vankyrin genes are differentially expressed in the tissues of parasitized hosts and both are mainly expressed in hemocytes. The temporal and spatial variation in expression of the two CcIV vankyrin genes suggests that CcIV vankyrin genes could be involved in early protection of parasitoid eggs from host cellular immune response by suppressing NF-kB signaling cascades, thereby altering development and immune responses of parasitized lepidopteran hosts. r 2007 Elsevier Ltd. All rights reserved. Keywords: Cloning; Campoletis chlorideae ichnovirus; Vankyrin; Transcription; Quantitative real-time PCR
1. Introduction Polydnaviruses (PDVs) are a group of symbiotic viruses carried by parasitic wasps in the families Braconidae and Ichneumonidae and called bracoviruses (BVs) and ichnoviruses (IVs), respectively (Webb, 1998; Turnbull and Webb, 2002; Kroemer and Webb, 2004). During wasp oviposition, virions are injected into the parasitoid’s host larva along with eggs, ovarian proteins and venom. Compared to other viruses, PDV has a unique genome comprised of multi-segmented double-stranded DNA (Webb, 1998; Webb and Strand, 2005), which is integrated in the wasp genome as a provirus (Fleming and Summers, 1991; Belle et al., 2002). Proviral segments are excised and replicated exclusively in virogenic stroma within the calyx cell nuclei of female wasps (Volkoff et al., 1995; Wyler and Lanzrein, 2003). In the wasp hosts, PDVs do not replicate, Corresponding author. Tel.: +86 10 64807115; fax: +86 10 64807099.
E-mail address: [email protected] (C.-Z. Wang). 0022-1910/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jinsphys.2007.03.015
but host-specific viral genes are expressed. The expression of viral genes in the parasitized host triggers a set of changes in host physiology, which are essential to the survival of the endoparasitoid (Strand and Pech, 1995; Shelby and Webb, 1999; Kroemer and Webb, 2004; Webb and Strand, 2005). These physiological alterations include host developmental disruption and growth inhibition, immunosuppression, hormone changes in the host associated with metamorphosis, and mobilization of host protein stores for parasitoid utilization (Li and Webb, 1994; Cui et al., 1997; Beckage, 1998; Shelby et al., 1998; Shelby and Webb, 1999; Yin et al., 2003; Zhang et al., 2003; Fath-Goodin et al., 2006). Some PDV gene families, such as cys-motif, rep, vinnexin, PTP gene families, have previously been described (Theilmann and Summers, 1988; Cui and Webb, 1996; Turnbull et al., 2005; Gundersen-Rindal and Pedroni, 2006). These gene families have been characterized based on similarities in sequence, protein structure, expression patterns, and function. Recently, another gene family, the
ARTICLE IN PRESS 700
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
vankyrin gene family, was found in Campoletis sonorensis ichnovirus (CsIV) and Microplitis demolitor bracovirus (MdBV) (Kroemer and Webb, 2005; Thoetkiattikul et al., 2005). These genes encode proteins similar to the ankyrin repeat domains (ARD) of the Drosophila melanogaster dorsal/NF-kB transcription factor inhibitor cactus, a member of the IkB gene family. Recombinant MdBV vankyrin gene expression greatly reduced expression of drosomycin and attacin reporter constructs, which are under NF-kB regulation (Thoetkiattikul et al., 2005). NF-kB proteins comprise a family of structurally related eukaryotic transcription factors that are involved in the control of a large number of normal cellular and organismal processes, such as immune responses, developmental processes, cellular growth, and apoptosis (Gillespie et al., 1997; Ghosh et al., 1998; Lavine and Strand, 2002; Hoffmann, 2003; Loker et al., 2004). The promoters for many insect antimicrobial and antifungal peptide genes contain variations of the insect NF-kB transcription factor consensus DNA binding sequence (Dushay and Beckage, 1993; Engstrom et al., 1993; Kappler et al., 1993; Manfruelli et al., 1999; Meng et al., 1999; Kimbrell and Beutler, 2001; Naitza and Ligoxygakis, 2004). Several genes involved in cellular immunity and developmental cascades are also regulated by NF-kB (Belvin and Anderson, 1996; Ghosh et al., 1998; Ghosh and Karin, 2002). In Drosophila, three NF-kB-like factors (Dif, Dorsal, and Relish) regulate expression of antimicrobial peptide genes (Campbell and Wilson, 2002) and numerous other immune molecules (De Gregorio et al., 2001). Therefore, it is widely assumed that NF-kBs play a conserved role in immune regulation because of similarities in the inducible expression of effector molecules across many invertebrates (Hoffmann, 2003; Loker et al., 2004). PDV and PDV gene encoded proteins play important roles in host immune suppression. The presence of IkBrelated genes in PDVs indicates that the PDV infections may target NF-kB mediated activities for disruption, which benefit parasitization by preventing hemocytic immune reactions to the endoparasitic egg and larvae as well as altering host development to support endoparasite survival and development (Kroemer and Webb, 2005; Thoetkiattikul et al., 2005). Cellular encapsulation of foreign objects can be very rapid, sometimes as rapid as 30 min postparasitization (p.p.) (Webb and Luckhart, 1996). As a key immunosuppression factor in ichneumonids, PDV could play a role in protecting the wasp egg at the very beginning of parasitization. However, most studies so far have not shown PDV-encoded protein production in lepidopteran host before 2 h p.p. Although venoms (Asgari et al., 2003a, b), ovarian proteins (Webb and Luckhart, 1996; Asgari et al., 1998; Cui et al., 2000) and other factors may be involved in suppression of the host immune response during the first 2 h, we still have questions about PDV’s function. Our previous study showed that Campoletis chlorideae ichnovirus (CcIV) genes are expressed abundantly in its host, Helicoverpa armigera, during the first
2 days p.p., and their expression peak coincides with protection of the parasitoid egg against encapsulation (Yin et al., 2003). To further explore the role of CcIV in early suppression of the host immune system, we report here two new CcIV vankyrin genes and their expression patterns in H. armigera larvae. We show that these two genes are fully expressed 30 min p.p., which suggests that PDVs can produce virusencoded proteins in hosts much faster than earlier anticipated. Considering the high transcription level, CcIV vankyrin proteins are likely to play a major role in the initial steps of host manipulation. 2. Materials and methods 2.1. Insect culture H. armigera, the lepidopteran host of C. chlorideae, were reared at 2671 1C and a 16-h light (L):8-h dark (D) photoperiod on artificial diets as described in Wang and Dong (2001). A colony of the parasitoid C. chlorideae was started with cocoons collected from Zhengzhou in the Henan province of China. The colony was maintained on H. armigera larvae fed with artificial diet. The host larvae at late second or early third instar were stung by mated female wasps one or two times, and the parasitized host larvae were further reared in an incubator under the same condition until cocoon formation. Fifteen cocoons were collected and kept in a glass tube (2 cm diameter, 10 cm length) plugged with cotton wool until adult emergence. Twenty adults were kept in a cage (10 cm diameter, 20 cm length) with a sex ratio of 1:1. Honey solution (20%) was provided every day as a food source. 2.2. RNA isolation Parasitized H. armigera larvae were frozen in liquid nitrogen and ground as powder for RNA extraction at various time intervals (30 min, 1, 2, 6, 12 h, 1, 2, 3, 4, 5, 6, 7 days) p.p. RNeasy Mini Kit (RNA extraction kit, QIAGEN) was used for total RNA isolation according to the manufacturer’s instructions. After determining the concentrations of RNA samples by measuring the absorbance at 260 nm, the samples were stored at 80 1C for further analysis. As controls, RNA samples were also collected from nonparasitized larvae. The quality of the RNA was analyzed by agarose gel electrophoresis in the presence of 1% formaldehyde. For analysis of CcIV vankyrin gene expression in different tissues, 2 days p.p. H. armigera larvae were anesthetized by immersion in ice-cold phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4 7H2O, 1.4 mM KH2PO4, pH 7.4) for 20 min prior to dissection. Hemolymph was drawn from the parasitized larvae with a capillary tube through an opening made by cutting off a hindleg and bled into 200 ml ice-cold PBS. Hemocytes were collected by centrifugation at
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
800 g and washed three times in PBS. After collecting hemocytes, the parasitized H. armigera larvae were dissected in PBS under a stereo light microscope. Fat body, nerve cord, epidermal layer (including muscle, trachea, and epidermis), and digestive tract (including gut and Malphigian tubules) tissues were collected and placed in ice-cold PBS separately. To prevent contamination with hemolymph, purified tissues were centrifuged at 800 g for 5 min and washed with PBS three times prior to RNA extraction. The procedures of RNA extraction were the same as described above. All RNA samples were treated with DNase I (QIAGEN) prior to real-time quantitative RT-PCR. The absence of contaminating genomic DNA in the RNA samples was verified by running PCR directly without reverse transcription. 2.3. Cloning of full length CcIV vankyrin cDNA 2.3.1. CcIV vankyrin cDNA fragments amplification by RT-PCR To clone the CcIV vankyrin cDNA fragment, 2 mg total RNA from 10 parasitized third instar H. armigera larvae at 2 days p.p. was reverse-transcribed using a cDNA synthesis kit (ThermoScripte RT-PCR system, Invitrogen) according to the manufacturer’s protocol. We used 1 ml of the reverse transcript (RT) products for PCR. According to the comparison between the published CsIV vankyrin cDNA sequences, four degenerate primers, VK-F, VK-R1, VK-R2 and VK-R3 were designed and synthesized by Invitrogen (details in Table 1). Following a 5-min denaturation at 94 1C, PCR was run for 35 cycles (each cycle: 30 s of denaturation at 94 1C, 30 s of annealing at 50 1C and 30 s of extension at 72 1C), followed by 10 min at 72 1C. To visualize gene fragments, 5 ml of PCR product was electrophoresed on a 2% agarose gel. 2.3.2. Cloning and sequencing of CcIV vankyrin cDNA fragments PCR products from a 1.2% agarose gel were purified with the QIAquicks Gel Extraction kit (QIAGEN) and ligated into the pGEM-T Easy cloning vector (Promega). The ligation mixture was transformed into DH5a competent cells for propagation of the recombinant plasmid. Positive clones were picked for PCR under abovementioned conditions, and appropriate colonies were sequenced to confirm that no mutation or error had occurred during PCR or other experimental processes. 2.3.3. Cloning of full length CcIV vankyrin cDNA by 30 - and 50 -RACE After determining the nucleotide sequence of the partial clone of vankyrin cDNA from the PCR products induced by degenerate primers, vankyrin gene-specific primers (GSP) were designed for 30 -RACE and 50 -RACE, respectively (details in Table 1).
701
Table 1 Oligodeoxynucleotide primers used for synthesis and amplification of partial, 30 -RACE, 50 -RACE and real-time PCR of CcIV vankyrin cDNA Fragments Primers
Sequences
CcIV vankyrin fragment
VK-F VK-R1 VK-R2 VK-R3
AMYATATTNCACGAGMTTG GVAAMATDHYYATCATCT TACTTTCAWTCACTTTCGG CCACWTYGYSAGSRYGTAAT
CcIV vank-1 30 Region
30 GSP1 30 GSP2 AP-dT AP
ATCGTTCCATTCTATCCTGC GAGCCGATCTGAATGGCACAA CTGATCTAGAGGTACCGGATCC(T)18 CTGATCTAGAGGTACCGGATCC
CcIV vank-1 50 Reigon
RT S1 S2 A1 A2
TATGCCGTTAGTCC GTCAGGCTGTACTGTGCTCCA AAGGGTGGTACGGACTAACG TGCCATTCAGATCGGCTCC GCAATCTCGTGGAATATGGT
CcIV vank-2 30 Reigon
30 GSP1 30 GSP2 AP-dT AP
GAATATGACTGTCCTCCACCTTG CAGCAGCCAATTCTTGATATCAATG CTGATCTAGAGGTACCGGATCC(T)18 CTGATCTAGAGGTACCGGATCC
CcIV vank-2 50 Region
RT S1 S2 A1 A2
TCGCCCGTTGAGT GAATATGACTGTCCTCCACCTTGCG ATGGGCTTTGATGGAACGACTG AAATCCAATGGCCCGCCGTAGTTAT CCAGTTCGGACAAGCTCGTGTAAT
Real-time PCR
vank-1-F vank-1-R vank-2-F vank-2-R 18S-F 18S-R
ACATATTCCACGAACTTGCGG TCAGATCGGCTCCCATTGAC CGAGGACGTCGTGCAATACTC CCATCAAAGCCCATTGCATT GTGTAAACGCAAGACGCGAC TTGATTGTTAACGAACGCGTG
In order to amplify the 30 end of CcIV vank-1 and vank2, nest-PCR was used. In the first round of PCR, 1 ml RT products were used as template and GSP1 and AP were used as primers; 30 cycles of amplification were performed using a cycle profile of 94 1C for 30 s, 56 1C for 30 s, and 72 1C for 2 min. Then, 1 ml of 100-fold diluted first-round PCR product was subjected to a nest-PCR, and the primers were GSP2 and AUAP; 30 cycles of amplification were performed using the same cycle profile as that using for the first round PCR. 50 -Full RACE Core Set kit (TaKaRa Biotechnology) was used to amplify the 50 end of CcIV vank-1 and vank-2 according to the instructions of the manufacturer. The obtained PCR products were cloned into the pGEM-T easy vector (Promega) for sequencing. Nucleotide sequences were analyzed using DNAMAN. Alignments of PDV vankyrin proteins were performed using Clustal X software (http:// www-igbmc.u-strasbg.fr/Bioinfo/). Alignments were bootstrapped from 10,000 independent trials using a random number generator of 200 for vankyrin proteins. Phylogenetic trees were constructed from alignments using MEGA software (Version 3.1) with nodal placement of bootstrap values and a ladderise left orientation of branches.
ARTICLE IN PRESS 702
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
2.4. Quantitative real-time PCR (qRT-PCR) Primers for CcIV vank-1, CcIV vank-2 and 18S rRNA were designed using Primer Express version 2.0 (PE Applied Biosystems). Primers for CcIV vank-1, CcIV vank-2 and 18S rRNA gene were designed to amplify less than 250 bp PCR products (the detailed sequence of primers is showed in Table 1). The obtained vank-1 PCR products were cloned into pGEM-T easy vector (Promega). The recombinant plasmid was prepared using a QIAprep Spin Miniprep Kit (QIAGEN), using 10-fold dilutions, ranging from 109 to 102 copies. cDNA pools created for the CcIV vankyrin gene clone (1 ml cDNA synthesized from 2 mg total RNA/reaction)
were subjected to 40 rounds of PCR in the presence of SYBRs Premix Ex TaqTM (TaKaRa) according to manufacturer’s instructions. The fluorescence intensity was monitored after each PCR cycle with mean threshold cycles determined for all unknowns and a serially diluted plasmid standard testing positive for amplification of each gene. Reactions were performed in triplicate for standards and cDNA from each unknown tissue and time point of postparasitization. Starting quantities for all unknown cDNA samples were calculated on the basis of the linear standard equation formulated from starting quantities and mean log threshold fluorescence values obtained from standards. Mean starting quantities of unknowns were calculated
Fig. 1. Protein sequence alignment of the CcIV vankyrin genes with other IV vankyrins and some typical IkBs. Locations of Drosophila cactus ankyrin repeats 1–6 have been denoted according to Dushay et al. (1996). Alignments were created with Clustal X software (http://www.igbmc.u-strasbg.fr/ Bioinfo/). NCBI accession numbers: Drosophila cactus (A44269), IkBe human (O00221), IkBa human (A39935), IkBa pig (CAA84619), CsIV I2-vank-1 (AAX56957), CsIV I2-vank-2(AAX56958), CsIV I2-vank-3 (AAX56959), CsIV P-vank-1 (AAX56953), CsIV P-vank-2 (AAX56954), CsIV P-vank-3 (AAX56955), CsIV P-vank-4 (AAX56956), HfIV vankyrin 1 (AAS90270), HfIV vankyrin 2 (AAX24120), TrIV vankyrin 1 and TrIV vankyrin 2 (AY940454).
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
from the three independent runs, normalized to 18S rRNA, and plotted for each cDNA sample to determine the mean relative starting quantities present in each unknown. Reactions were performed on a Stratagene MX 3000p Real-time PCR Thermalcycler. 3. Results 3.1. Cloning and sequence analyses of CcIV vankyrin genes The 30 - and 50 -RACE revealed two cDNA sequences, named CcIV vank-1 and vank-2, respectively (GenBank accession no. DQ845287 and DQ845288). The full length CcIV vank-1 cDNA consisted of 886 bp with a 108 bp 50 -untranslated region and 278 bp 30 -untranslated region, including a polyadenylation signal (AATAAA) and a poly(A) tail. The full length CcIV vank-2 cDNA consisted of 645 bp with a 102 bp 50 -untranslated region and 36 bp 30 -untranslated region, including a TATA box (37 bp)
703
and a poly(A) tail. Aligned by DNAMAN, the overall identities of CcIV vank-1 and vank-2 to CsIV I2-vank-1 and I2-vank-2 (GenBank accession no. AF362517) were 95.5% and 91.5%, respectively, but the identity between CcIV vank-1 and vank-2 was only 54.9%. The open reading frames (ORF) of CcIV vank-1 (468 bp) and vank-2 (507 bp) encoded 155 and 168 amino acids, respectively, which lacked predicted secretory signal peptides and exhibited variable degrees of similarity to the ARD of Drosophila cactus and mammalian IkBs. All known IkBs have a central ARD that usually consists of six ankyrin repeats (Ghosh et al., 1998; Michel et al., 2001). While predicted CcIV vankyrin proteins had centrally located ARDs comprising four ankyrin repeats that aligned with ankyrin repeats 3–6 of Drosophila cactus and mammalian IkBs, they were much smaller than cactus or mammalian IkB because of a reduced ARD and the absence of regulatory regions in their N and C termini (Fig. 1). Most significant alignment occurs over ankyrin
Fig. 2. Phylogenetic alignments of PDV vankyrin proteins. Phylogenetic tree (bootstrapped from 10,000 replicates; seed ¼ 3000) constructed from alignment of PDV vankyrin proteins, including Campoletis chloridae ichnovirus (CcIV), C. sonorensis IV (CsIV), Micriplitis demolitor BV (MdBV), Cotesia congregata BV (CcBV), Toxoneuron nigriceps BV (TnBV), Tranosema rostrale IV (TrIV), Hyposoter fugitivus IV (HfIV), Glyptapanteles indiensis BV (GiBV) and Hyposoter didymator IV (HdIV), selected mammalian IkB proteins, and the IkB proteins Relish and Cactus from Drosophila. Each vankyrin and IkB along its accession number is listed to the right of the dendrograms.
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
704
repeats 4 and 5 of Drosophila cactus, with less overlap exhibited over repeats 3 and 6 (Fig. 1). Predicted vankyrin genes from C. chlorideae IV were similar to those from the C. sonorensis IV, Hyposoter fugitivus IV, Tranosema rostrale IV and aligned in the same regions. All of them lack two N-terminal ankyrin repeats and N- and C-terminal protease sensitive domains involved with regulation of typical IkB protein activities (Fig. 1). Phylogenetic analysis of the PDV vankyrin and mammalian and Drosophila IkBs was performed at the amino acid level. The phylogenetic tree of the PDV vankyrin and IkB revealed that the vankyrin family was divided into two groups: BVs and IVs (Fig. 2). IV vankyrins are more related to one another than they are to the corresponding genes in BVs. Alignment of all PDV vankyrin proteins using mammalian and Drosophila IkBs as outgroups produced incompletely resolved trees that provide no clear evidence of shared ancestry. 3.2. Temporal transcription of vankyrin genes Using qRT-PCR, we found that CcIV vank-1 and vank-2 had the same expression patterns in the host. The highest
expression levels of both CcIV vankyrin genes occurred at 30 min p.p., then decreased sharply at 2 h p.p., and was maintained at relatively lower levels during the following days of parasitization. Furthermore, a second expression peak gradually emerged at 2 days p.p., which is about 1/5 and 1/8 of the corresponding expression level of vank-1 and vank-2 at 30 min p.p. (Fig. 3A and B).
3.3. Tissue specificity of vankyrin gene transcription To delineate the tissue specificity of CcIV vank-1 and vank-2 transcription in parasitized hosts, total RNA was isolated from various tissues of 2-days-p.p. H. armigera fourth-instar larvae (corresponding to the second expression peak because the first peak was difficult to target) and subjected to qRT-PCR analyses as performed for temporal profiling of gene transcription in parasitized larvae. The two genes were predominantly expressed in hemocytes but could also be detected in fat body, nerve cord, digestive tract, and the epidermal layer. In host head capsules, the two gene transcript levels were very low (Fig. 3C and D).
4.50E+06
7.00E+04
4.00E+06 3.50E+06 Mean Copies (18S rRNA normalized)
Mean Copies (18S rRNA normalized)
6.00E+04 5.00E+04 4.00E+04 3.00E+04 2.00E+04
3.00E+06 2.50E+06 2.00E+06 1.50E+06 1.00E+06
1.00E+04
5.00E+05
0.00E+00 Ct1 30min 60min 2h
6h 12h 24h 2d
3d
4d
5d
6d
0.00E+00
7d
1.60E+05
NC
FB
DT
EL
Head
HC
NC
FB
DT
EL
Head
4.00E+05
1.40E+05
3.50E+05
1.20E+05 Mean Copies (18S rRNA normalized)
Mean Copies (18S rRNA normalized)
HC
1.00E+05 8.00E+04 6.00E+04 4.00E+04 2.00E+04
3.00E+05 2.50E+05 2.00E+05 1.50E+05 1.00E+05 5.00E+04
0.00E+00 Ct1 30min60min2h 6h 12h 24h 2d
3d
4d
5d
6d
7d
0.00E+00
Fig. 3. The temporal and spatial variations of CcIV vankyrin genes transcription. Quantitative real-time PCR for (A) CcIV vank-1 from 30-min to 7-day time course of parasitization; (B) CcIV vank-2 from 30-min to 7-day time course of parasitization; (C) CcIV vank-1 in selected tissues of 3-day-p.p. H. armigera larvae; (D) CcIV vank-2 in selected tissues of 3-day-p.p. H. armigera larvae. All values for viral genes were normalized to 18S rRNA controls to account for variations in cDNA pools. Error bars represent +1 S.D. from the mean. Ctl, control H. armigera; min, minutes p.p.; h, hours p.p.; d, days p.p.; HC, 2-day-p.p. hemocytes; NC, 2-day-p.p. nerve cord; FB, 2-day-p.p. fat body; DT, 2-day-p.p. digestive tract (including gut and malpighian tubules); EL, 2-day-p.p. epidermal layer (including trachea, muscles, and epidermis).
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
4. Discussion In the present study, two vankyrin genes in CcIV were characterized, named CcIV vank-1 and vank-2. Their predicted proteins exhibit variable degrees of similarity to the ankyrin repeat domains of Drosophila cactus and mammalian IkBs, the inhibitor of NF-kB. In most cells, NF-kB functions as latent gene regulatory proteins and are retained due to complex formation with IkB proteins in the cytoplasm of cells (Huxford et al., 1998; Jacobs and Harrison, 1998; Michel et al., 2001; Ghosh and Karin, 2002). Previous studies suggest that ARD is essential for IkB-NF-kB binding (Ghosh et al., 1998; Huxford et al., 1998; Jacobs and Harrison, 1998; Michel et al., 2001). Within the ARD, ankyrin repeats 3–6 form the largest number of interactions with NF-kBs, which suggests that four ankyrin repeats may be sufficient to form stable complexes with NF-kBs (Huxford et al., 1998). Predicted CcIV vankyrin proteins consisted of four ankyrin repeats that aligned with ankyrin repeats 3–6 of Drosophila cactus and mammalian IkBs. The African swine fever virus (ASFV) encodes an IkB-like gene, comprised of four ankyrin repeats too, which can disrupt the function of mammalian NF-kB p50/p65 (Revilla et al., 1998). This suggests that PDV vankyrin proteins may also possess the function of suppressing NF-kB activity during immune responses and developmental regulatory cascades in parasitized lepidopteran host. It has been shown that recombinant MdBV H4 and N5 with PDV vankyrin genes greatly reduces expression of drosomycin and attacin reporter constructs, which are under NF-kB regulation through the Toll and Imd pathways (Thoetkiattikul et al., 2005). IkBs have a central ARD that usually consists of six ankyrin repeats (Ghosh et al., 1998; Michel et al., 2001). Drosophila cactus, one of the family members, has signalreceiving domains (SRDs), N-terminal to the ARD, that accept phosphorylation and ubiquitination signals, whereas the C-terminal domains contain proline, glutamic acid, serine, and threonine (PEST) residues implicated in protein turnover (Ghosh et al., 1998; Ghosh and Karin, 2002). Vankyrin proteins in CcIV and other PDV genomes are much smaller than Drosophila cactus and mammalian IkBs because of a reduced ARD and absence of the N-terminal and C-terminal regulatory domains. This may be due to the fact that parasitoid-derived proteins abolish host function by blocking immune proteins without having to respond to other regulatory functions. In previous studies, Yin et al. (2003) detected CcIV transcripts 1 day p.p. and continued for 5 days in host hemocytes as indicated by cDNA hybridization. We found that CcIV vank-1 and vank-2 could be detected in the host 30 min p.p. and continued all thorough parasitization. There were two expression peaks, 30 min p.p. and 2 days p.p., respectively. The first expression peak at 30 min p.p. was more than 100-fold higher than that at 7 days p.p., and then the expression level declined sharply at 2 h p.p. These results suggest that the two CcIV vankyrin genes could be
705
early viral genes expressed rapidly and involved in early protection of parasitoid eggs from host immune response. Kroemer and Webb (2005) detected CsIV vankyrin gene expression within 2–4 h p.p. in H. virescens hosts and reached peak levels by 3 days p.p., but they did not test earlier time points of post-parasitization. Considering the difference in the study systems and rearing condition, the second expression peak (2 days p.p.) in CcIV may coincide with the CsIV vankyrin genes’ expression peak. Later, other immune-related genes may possibly have been activated, and then vankyrin gene expression level declined steeply. Suppression of the host immune response after parasitization is essential for the survival of the parasitoid wasp. Cellular encapsulation of foreign objects can be very rapid, possibly as rapid as 30 min p.p. (Webb and Luckhart, 1996). This forces the parasitoid to mobilize its immunesuppression system functions immediately after laying eggs into the host. In H. virescens larvae parasitized by C. sonorensis, ovarian proteins are introduced with the parasite egg and rapidly but transiently alter hemocyte morphology and disable the immune response (Webb and Luckhart, 1996). Asgari et al. (1998) reported that an ovary protein (Crp32) inhibited host immune response by coating the wasp egg surface. Wasp egg surface could interact with host hemolymph proteins that provide surface protection (Kinuthia et al., 1999). Venom and viral envelop proteins in the female ovary may also be involved in wasp egg protection (Webb and Luckhart, 1994). The previous study in our lab showed that washed C. chlorideae eggs alone were protected from host hemocytes encapsulation to a certain degree, and injecting female wasp calyx fluid further protected the washed wasp eggs from encapsulation (Yin et al., 2003). Treated with proteinase K, all the washed wasp eggs were encapsulated at 1 day post-injection (data not published). Together with the results here we hypothesize that ovarian proteins, venoms or other surface molecules of the C. chlorideae egg may cooperate with CcIV encoded proteins to initiate the rapid immunosuppression toward host. Temporal expression studies revealed another expression peak of CcIV vankyrin genes at 2 days p.p. The development of the parasitoid may explain this phenomenon. Based on our dissection results, the C. chlorideae egg hatched at about 2 days p.p. Emerging from the egg shell, the wasp larvae would face the challenge of host encapsulation again. The higher expression level of vankyrin genes at this time point is presumably beneficial to protect the development of wasp larvae. The persistence of PDV transcripts in parasitized insects varied significantly. Expression of some PDV viral genes appeared to be highly transient while other viral genes remained at constant levels throughout endoparasite development. Expression of BV genes has been reported to be transient or decreasing in later stages of parasitization (Asgari et al., 1996; Strand et al., 1997). In both PDV genera, viruses were able to persist without viral replication in parasitized insects to late stages of parasitoid development. The
ARTICLE IN PRESS 706
S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707
presence of CcIV vankyrin transcripts through the parasitization process suggests that CcIV vankyrin genes may have a continuous function in the protection of the developing endoparasitoid. CcIV vank-1 and vank-2 could be detected at hemocytes, fat body, nerve cord, epidermal layer, and digestive tract 2 days p.p., and both are mainly expressed in hemocytes. Kroemer and Webb (2005) detected that CsIV vankyrin genes were differently expressed in parasitized host tissues and can be divided into two subclasses: those that target the host fat body and those that target host hemocytes. The P-vank-1, I2-vank-2, and I2-vank-3 genes exhibit the highest levels of transcription in the parasitized fat body relative to other tissues, while transcription of P-vank-2, P-vank-3, P-vank-4, and I2-vank-1 predominantly was expressed in hemocytes (Kroemer and Webb, 2005). Some MdBV vankyrin gene family members are preferentially expressed in host hemocytes and fat body, whereas others are expressed elsewhere (Thoetkiattikul et al., 2005). Although PDV virions enter a variety of tissues, hemocytes are almost always the most heavily infected tissue in terms of the amount of detectable viral DNA (Strand et al., 1992; Li and Webb, 1994; Yin et al., 2003). Preferential infection of hemocytes could be due to the fact that wasps oviposit directly into the hemocoel, and hemocytes are the first cells virions encounter and play a key role in immunity. Lacking a basement membrane, hemocytes may further facilitate infection. The fact that the vankyrin genes have diversified to form multiple gene variants may be due to the possibility that vankyrin proteins have functional activities that differ among insect tissues. The variation in temporal and spatial gene expression p.p. in different host tissues suggested that the two CcIV vankyrin genes may be involved in suppressing host immune response, or the host regulatory system affecting viral expression during parasitism. Further studies of the CcIV vankyrin gene encoded proteins and their interactions with host proteins may have physiological relevance to understanding host regulatory processes. Acknowledgments We thank Professor B.A. Webb (University of Kentucky, USA) and Dr. Li-Wang Cui (University of Pennsylvania, USA) for suggestions during this study; thank Dr. HongSheng Wang and Cheng-Song Zhou for providing excellent technical assistance. This work was supported by the innovation program of Chinese Academy of Sciences (Grant no. KSCX2-YW-N-006), National Natural Science Foundation of China (Grant no. 30621003), and Beijing Natural Science Foundation (Grant no. 5052020). Appendix A. Supplementary materials Supplementary data associated with this article can be found in the online version at doi:10.1016/j.jinsphys.2007.03.015
References Asgari, S., Hellers, M., Schmidt, O., 1996. Host haemocyte inactivation by an insect parasitoid: transient expression of a polydnavirus gene. Journal of General Virology 77, 2653–2662. Asgari, S., Theopold, U., Wellby, C., Schmidt, O., 1998. A protein with protective properties against the cellular defense reactions in insects. Proceedings of the National Academy of Sciences of the United States of America 95, 3690–3695. Asgari, S., Zareie, R., Zhang, G.M., Schmidt, O., 2003a. Isolation and characterization of a novel venom protein from an endoparasitoid, Cotesia rubecula (Hym: Braconidae). Archives of Insect Biochemistry and Physiology 53, 92–100. Asgari, S., Zhang, G.M., Zareie, R., Schmidt, O., 2003b. A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph. Insect Biochemistry and Molecular Biology 33, 1017–1024. Beckage, N.E., 1998. Modulation of immune responses to parasitoids by polydnaviruses. Parasitology 116, S57–S64. Belle, E., Beckage, N.E., Rousselet, J., Poirie, M., Lemeunier, F., Drezen, J.M., 2002. Visualization of polydnavirus sequences in a parasitoid wasp chromosome. Journal of Virology 76, 5793–5796. Belvin, M.P., Anderson, K.V., 1996. A conserved signaling pathway: the Drosophila Toll-Dorsal pathway. Annual Review of Cell and Developmental Biology 12, 393–416. Campbell, C.L., Wilson, W.C., 2002. Differentially expressed midgut transcripts in Culicoides sonorensis (Diptera: Ceratopogonidae) following Orbivirus (Reoviridae) oral feeding. Insect Molecular Biology 11, 595–604. Cui, L.W., Webb, B.A., 1996. Isolation and characterization of a member of the cysteine-rich gene family from Campoletis sonorensis polydnavirus. Journal of General Virology 77, 797–809. Cui, L.W., Soldevila, A., Webb, B.A., 1997. Expression and hemocytetargeting of a Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens larvae. Archives of Insect Biochemistry and Physiology 36, 251–271. Cui, L.W., Soldevila, A.I., Webb, B.A., 2000. Relationships between polydnavirus gene expression and host range of the parasitoid wasp Campoletis sonorensis. Journal of Insect Physiology 46, 1397–1407. De Gregorio, E., Spellman, P.T., Rubin, G.M., Lemaitre, B., 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proceedings of the National Academy of Sciences of the United States of America 98, 12590–12595. Dushay, M.S., Beckage, N.E., 1993. Dose-dependent separation of Cotesia congregata associated polydnavirus effects on Manduca sexta larval development and immunity. Journal of Insect Physiology 39, 1029–1040. Dushay, M.S., Asling, B., Hultmark, D., 1996. Origins of immunity: relish, a compound Rel-like gene in the antibacterial defense of Drosophila. Proceedings of the National Academy of Sciences of the United States of America 93, 10343–10347. Engstrom, Y., Kadalayil, L., Sun, S.C., Samakovlis, C., Hultmark, D., Faye, I., 1993. Kappa-B-like motifs regulate the induction of immune genes in Drosophila. Journal of Molecular Biology 232, 327–333. Fath-Goodin, A., Gill, T.A., Martin, S.B., Webb, B.A., 2006. Effect of Campoletis sonorensis ichnovirus cys-motif proteins on Heliothis virescens larval development. Journal of Insect Physiology 52, 576–585. Fleming, J.A.G.W., Summers, M.D., 1991. Polydnavirus DNA is integrated in the DNA of its parasitoid wasp host. Proceedings of the National Academy of Sciences of the United States of America 88, 9770–9774. Ghosh, S., Karin, M., 2002. Missing pieces in the NF-kappa B puzzle. Cell 109, S81–S96. Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-kappa B and rel proteins: evolutionarily conserved mediators of immune responses. Annual Review of Immunology 16, 225–260.
ARTICLE IN PRESS S.-P. Tian et al. / Journal of Insect Physiology 53 (2007) 699–707 Gillespie, J.P., Kanost, M.R., Trenczek, T., 1997. Biological mediators of insect immunity. Annual Review of Entomology 42, 611–643. Gundersen-Rindal, D.E., Pedroni, M.J., 2006. Characterization and transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the parasitized host. Journal of General Virology 87, 311–322. Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38. Huxford, T., Huang, D.B., Malek, S., Ghosh, G., 1998. The crystal structure of the I kappa B alpha/NF-kappa B complex reveals mechanisms of NF-kappa B inactivation. Cell 95, 759–770. Jacobs, M.D., Harrison, S.C., 1998. Structure of an I kappa B alpha/NFkappa B complex. Cell 95, 749–758. Kappler, C., Meister, M., Lagueux, M., Gateff, E., Hoffmann, J.A., Reichhart, J.M., 1993. Insect immunity. Two 17 bp repeats nesting a Kappa-B-related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteria-challenged Drosophila. Embo Journal 12, 1561–1568. Kimbrell, D.A., Beutler, B., 2001. The evolution and genetics of innate immunity. Nature Reviews Genetics 2, 256–267. Kinuthia, W., Li, D., Schmidt, O., Theopold, U., 1999. Journal of Insect Physiology 45, 501–506. Kroemer, J.A., Webb, B.A., 2004. Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annual Review of Entomology 49, 431–456. Kroemer, J.A., Webb, B.A., 2005. I kappa beta-related vankytin genes in the Campoletis sonorensis Ichnovirus: temporal and tissue-specific patterns of expression in parasitized Heliothis virescens lepidopteran hosts. Journal of Virology 79, 7617–7628. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochemistry and Molecular Biology 32, 1295–1309. Li, X.S., Webb, B.A., 1994. Apparent functional-role for a cysteine-rich polydnavirus protein in suppression of thei insect cellular immuneresponse. Journal of Virology 68, 7482–7489. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune system—not homogeneous, not simple, not well understood. Immunological Reviews 198, 10–24. Manfruelli, P., Reichhart, J.M., Steward, R., Hoffmann, J.A., Lemaitre, B., 1999. A mosaic analysis in Drosophila fat body cells of the control of antimicrobial peptide genes by the Rel proteins Dorsal and Dif. Embo Journal 18, 3380–3391. Meng, X.J., Khanuja, B.S., Ip, Y.T., 1999. Toll receptor-mediated Drosophila immune response requires Dif, an NF-kappa B factor. Genes and Development 13, 792–797. Michel, F., Soler-Lopez, M., Petosa, C., Cramer, P., Siebenlist, U., Muller, C.W., 2001. Crystal structure of the ankyrin repeat domain of Bcl-3: a unique member of the I kappa B protein family. EMBO Journal 20, 6180–6190. Naitza, S., Ligoxygakis, P., 2004. Antimicrobial defences in Drosophila: the story so far. Molecular Immunology 40, 887–896. Revilla, Y., Callejo, M., Rodriguez, J.M., Culebras, E., Nogal, M.L., Salas, M.L., Vinuela, E., Fresno, M., 1998. Inhibition of nuclear factor kappa B activation by a virus-encoded I kappa B-like protein. Journal of Biological Chemistry 273, 5405–5411. Shelby, K.S., Webb, B.A., 1999. Polydnavirus-mediated suppression of insect immunity. Journal of Insect Physiology 45, 507–514.
707
Shelby, K.S., Cui, L., Webb, B.A., 1998. Polydnavirus-mediated inhibition of lysozyme gene expression and the antibacterial response. Insect Molecular Biology 7, 265–272. Strand, M.R., Pech, L.L., 1995. Immunological basis for compatibility in parasitoid host relationships. Annual Review of Entomology 40, 31–56. Strand, M.R., Mckenzie, D.I., Grassl, V., Dover, B.A., Aiken, J.M., 1992. Persistence and expression of Microplitis demolitor polydnavirus in Pseudoplusia includens. Virology 73, 1627–1635. Strand, M.R., Witherell, R.A., Trudeau, D., 1997. Two Microplitis demolitor polydnavirus mRNAs expressed in hemocytes of Pseudoplusia includens contain a common cysteine-rich domain. Journal of Virology 71, 2146–2156. Theilmann, D.A., Summers, M.D., 1988. Identification and comparison of Campoletis sonorensis virus transcripts expressed from four genomic segments in the insect hosts Campoletis sonorensis and Heliothis virescens. Virology 167, 329–341. Thoetkiattikul, H., Beck, M.H., Strand, M.R., 2005. Inhibitor kappa Blike proteins from a polydnavirus inhibit NF-kappa B activation and suppress the insect immune response. Proceedings of the National Academy of Sciences of the United States of America 102, 11426–11431. Turnbull, M., Webb, B., 2002. Perspectives on polydnavirus origins and evolution. Advances in Virus Research 58, 203–254. Turnbull, M.W., Volkoff, A.N., Webb, B.A., Phelan, P., 2005. Functional gap junction genes are encoded by insect viruses. Current Biology 15, R491–R492. Volkoff, A.N., Ravallec, M., Bossy, J.P., Cerutti, P., Rocher, J., Cerutti, M., Devauchelle, G., 1995. The replication of Hyposoter didymator polydnavirus—cytopathology of the calyx cells in the parasitoid. Biology of the Cell 83, 1–13. Wang, C.Z., Dong, J.F., 2001. Interspecific hybridization of Helicoverpa armigera and H. assulta (Lepidoptera: Noctuidae). Chinese Science Bulletin 46, 489–491. Webb, B.A., 1998. Polydnavirus biology, genome structure, and evolution. In: Miller, L.K., Balls, L.A. (Eds.), The Insect Viruses. Plenum, New York, pp. 105–139. Webb, B.A., Luckhart, S., 1994. Evidence for an early immunosuppressive role for related Campoletis sonorensis venom and ovarian proteins in Heliothis virescens. Archives of Insect Biochemistry and Physiology 26, 147–163. Webb, B.A., Luckhart, S., 1996. Factors mediating short- and long-term immune suppression in a parasitized insect. Journal of Insect Physiology 42, 33–40. Webb, B.A., Strand, M.R., 2005. The biology and genomics of polydnaviruses. In: Lawrence, I.G., Kostas, I., Sarjeet, S.G. (Eds.), Comprehensive Molecular Insect Science. Elsevier, Oxford, pp. 323–360. Wyler, T., Lanzrein, B., 2003. Ovary development and polydnavirus morphogenesis in the parasitic wasp Chelonus inanitus. II. Ultrastructural analysis of calyx cell development, virion formation and release. Journal of General Virology 84, 1151–1163. Yin, L.H., Zhang, C., Qin, J.D., Wang, C.Z., 2003. Polydnavirus of Campoletis chlorideae: characterization and temporal effect on host Helicoverpa armigera cellular immune response. Archives of Insect Biochemistry and Physiology 52, 104–113. Zhang, C., Yan, Y.H., Wang, C.Z., 2003. Degeneration of host prothoracic glands caused by Campoletis chlorideae polydnavirus. Progress in Natural Science 13, 690–695.