Cloning and developmental expression of a zebrafish meis2 homeobox gene

Mechanisms of Development 102 (2000) 247±250

www.elsevier.com/locate/modo

Gene expression pattern

Cloning and developmental expression of a zebra®sh meis2 homeobox gene Ted Zerucha a,1, Victoria E. Prince b,* a

b

University of Chicago Committee for Cancer Biology, 1027 E. 57th Street, Chicago, IL 60637, USA University of Chicago Committees on Developmental Biology, Neurobiology and Evolutionary Biology, 1027 E. 57th Street, Chicago, IL 60637, USA Received 2 January 2001; received in revised form 19 January 2001; accepted 23 January 2001

Abstract We show here that a zebra®sh meis2 gene homolog has a dynamic expression pattern in the developing mesoderm and central nervous system. Meis family homeodomain proteins are known to act as cofactors with other homeodomain proteins. We ®nd expression of meis2.1 in the developing zebra®sh hindbrain and somites, correlating with reported sites of zebra®sh hox gene expression, as well as in presumptive cerebellum, midbrain, retina and ventral forebrain. The expression pattern shares some, but not all, features with that of murine Meis2. q 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Homeobox; TALE superclass; Hox; Meis; Hindbrain; Midbrain; Forebrain; Cerebellum; Danio rerio

1. Results and discussion Meis genes belong to the TALE (Three Amino Acid Loop Extension) superclass of homeobox genes (BuÈrglin, 1997). The vertebrate Meis family comprises at least three paralogs, as identi®ed in mouse and human (Nakamura et al., 1996; Steelman et al., 1997); there is a single Drosophila homolog (homothorax, Rieckhof et al., 1997). To date, only one zebra®sh meis gene has been described, meis3; a limited analysis shows meis3 to be expressed at gastrula stages in the hindbrain primordium (Vlachakis et al., 2000). Meis proteins can form heterodimers with Pbx proteins (Rieckhof et al., 1997; Berthelsen et al., 1999; Chang et al., 1997) and heterotrimers with Pbx and Hox proteins (Shanmugan et al., 1999; Shen et al., 1999; Jacobs et al., 1999; Vlachakis et al., 2000). Here we show that a zebra®sh Meis homolog is expressed in the hindbrain and somites, similar to zebra®sh hox genes, and is also expressed in presumptive cerebellum, midbrain and forebrain structures, anterior to the sites of hox gene expression. We isolated a zebra®sh meis gene cDNA by PCR (see Section 2). Our amino acid sequence is homologous to those

* Corresponding author. Tel.: 11-773-834-2100; fax: 11-773-702-0037. E-mail address: [email protected] (V.E. Prince). 1 Present address: Biochip Technology Center, Building 202, Room B333, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439, USA.

of the four mouse Meis2 protein isoforms (Fig. 1A), with highest percentage identity within the conserved MH and homeodomains. A neighbor-joining tree shows that the isolated gene is a homolog of mouse Meis 2 (Fig. 1B). A second closely related meis2 homolog has also been isolated (meis2.2; Cecilia Moens, pers. commun.). We have termed the gene described here zebra®sh meis2.1. We have investigated expression of zebra®sh meis2.1 between oogenesis and 48 h of development. No maternal expression was detectable. Expression commences at approximately 60% epiboly and is immediately localized to bilateral domains correlating with the hindbrain primordia (Woo and Fraser, 1995). At the 90±100% epiboly stage the meis2.1 expression domain covers a broader territory from animal to vegetal (Fig. 2A). In some embryos at 100% epiboly there is also low level expression at the animal pole that likely pre®gures the forebrain expression detected as somitogenesis begins. At the 12 h stage (6 somites, s) there are distinct expression domains in the forebrain, midbrain, in rhombomeres (r) 2 and 3 of the hindbrain, and the anterior spinal cord (Fig. 2B). There is also expression in the anterior half of each somite, but no expression is apparent in the presegmental mesoderm. By the 14 h stage (10s) expression at the r2 level has begun to diminish, but there is now increased expression in r4 (Fig. 2C), as con®rmed by co-labeling with the r3/r5 marker krox20 (Oxtoby and Jowett, 1983). High level expression domains in individual cells, or small cell clus-

0925-4773/00/$ - see front matter q 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(01)00299-4

248

T. Zerucha, V.E. Prince / Mechanisms of Development 102 (2000) 247±250

ters, are now apparent in the lateral parts of r1, r2 and r6 (Fig. 2C arrows). In the forebrain, bilateral expression domains are present, as seen at the 16.5 h stage. By the 16.5 h stage (15s) the r4 domain has become the region of most intense expression (Fig. 2D). At 24 h of development meis2.1 expression within the developing brain is complex (Fig. 2E,F). In addition to the more dorsal forebrain domain, there is a small additional

ventral domain now apparent (arrowheads, Fig. 2F). In the hindbrain, there are restricted bilateral `stripes' of expression along the dorsal and anterior-most part of rhombomere 1 (presumptive cerebellum), immediately adjacent to the isthmus between mid and hindbrain (Fig. 2E). This expression domain is absent in the acerebellar mutant (data not shown), which lacks a cerebellum (Brand et al., 1996). Expression has down-regulated in r2 and r3, with patchy clusters of cells continuing to express ventrally, at or close to the r1/2 and r2/3 boundaries (below focal plane in Fig. 2E). Expression remains elevated, albeit patchy, in r3, with no expression apparent medially; as con®rmed by sectioning through r3 (Fig. 2G). Expression levels are also high in r4, and unique to this rhombomere there is also medial expression, again as con®rmed by sectioning (Fig. 2H). At 30 h of development the cerebellar expression domain has become very tightly localized to narrow bilateral stripes just posterior to the isthmus, which now meet at the dorsal midline (Fig. 2I). In the hindbrain, there is a small ventral expression domain at the r1/r2 boundary, but negligible expression within r1 or r2 (Fig. 2I). Expression in r3 and r4 remains at elevated levels. There is a low level expression domain in a population of cells posterior to the otic vesicle, possibly in the 3rd or more posterior pharyngeal arches (Fig. 2I). Between 30 and 48 h this basic pattern of expression is retained, but by 36 h we additionally detect expression in the developing retina (Fig. 2H). In conclusion, zebra®sh meis2.1 has a very dynamic expression pattern, particularly within the developing hindbrain. The expression overlaps with that of zebra®sh hox genes in r2 and more posteriorly within the CNS, and in the somites (Prince et al., 1998a,b), but also extends more anteriorly. This expression pattern shares some characteristics with that of the murine Meis 2 ortholog, but also shows obvious differences. In particular we do not ®nd expression of zebra®sh meis2.1 in the ®rst two pharyngeal arches, or in the limb buds, as described for mouse (Cecconi et al., 1997; Capdevila et al., 1999). Furthermore, the tightly localized cerebellar expression that we ®nd for zebra®sh meis2.1 has not been described for mouse Meis genes.

Fig. 1. (A) The amino acid sequence coded for by the meis2.1 gene is compared to the four murine isoforms of Meis2 (Oulad-Abdelghani et al., 1997; accession #s A 000504-7). Red shading indicates the position of the MH-domain, yellow shading indicates the position of the homeodomain. Alignments performed using CLUSTALX (Thompson et al., 1997), complete sequence identity is indicated by `*'. (B) Neighbor-joining tree to show the phylogenetic relationships between Meis proteins. Based on ClustalX alignment of amino acid sequences of Meis gene family members from mouse, Xenopus, zebra®sh and Drosophila. Sequence accession numbers: Mouse Meis 1 Q60954; Mouse Meis 2 P97367; Mouse Meis 3 P97368; Xenopus Meis 1 P79937; Xenopus Meis3 AAD02948; Drosophila HTH AAC47759; displayed using NJ-Plot (Perriere and Gouy, 1996), scale refers to branch lengths, bootstrap values based on 1000 replicates are shown.

T. Zerucha, V.E. Prince / Mechanisms of Development 102 (2000) 247±250

249

Fig. 2. Whole-mount in situ hybridization analysis of zebra®sh meis2.1 expression. Embryos have been removed from the yolk and ¯at-mounted between coverslips with anterior to the left, except on (A) and (F) where whole-mounts are shown. (A) 9.5±10 h (95% epiboly ± tailbud), note expansion of bilateral domain, red arrows indicate vegetal extent of margin in younger specimens, arrowhead indicates low level animal pole expression seen in some older specimens. (D) indicates dorsal, (AP) indicates animal pole. (B) 11.5 h (6 somite, s stage). Flat-mounted specimen showing elevated expression in the forebrain (fb), midbrain (mb), rhombomeres 2 and 3 of the hindbrain (r3 and r5 are indicated), the spinal cord (sc), and anterior part of the somites (arrowheads indicate somite boundaries). (C) 14 h (10s stage). Flat-mounted specimen at high magni®cation, focused on mid and hindbrain, double in situ with krox20 (red). Note overall similar pattern to the 6s stage, but expression levels have increased in r4 and decreased in r2, and punctate areas of expression are now present at the lateral margins of rhombomeres 1±6 (black arrows). (D) 16.5 h (15s stage). Expression is now at highest levels in r4, as con®rmed by double labeling with krox20. (E) High magni®cation view of brain at 24 h (dorsal plane), `i' indicates the isthmus between mid and hindbrain, note expression immediately posterior to the isthmus. Rhombomeres are indicated. (F) Left side lateral view of unmounted 24 h stage embryo shows two expression domains in the forebrain (dorsal and ventral, arrowheads), high level expression in r3 and r4 (indicated), and lower level expression in the midbrain and anterior part of each somite. (G) Transverse section through r3 at 24 h stage shows expression is restricted to the ventral part of the neural tube and is absent from the most ventral and medial cells (DV extent indicated by bracket). (H) Transverse section through the r4 level (identi®ed by presence of anterior aspect of the otic vesicle, o) shows more extensive DV expression (bracket). (I) Lateral view of mid and hindbrain (slightly tilted to show dorsal) at 30 h stage. Black arrowhead indicates dorsal aspect of expression in anterior r1 (immediately posterior to the isthmus), where bilateral domains now meet in the midline. i, isthmus. Blue arrow indicates ventrolateral expression at the r1/r2 boundary. Rhombomeres as indicated; o, otic vesicle, green arrowhead indicates expression posterior to the otic vesicle, possibly in posterior pharyngeal arches. (J) 48 h stage. Black arrowhead indicates continuing bilateral expression just posterior to the isthmus, `r' indicates expression in the developing retina. There continues to be high level expression in r3 (red arrowhead), reducing toward the posterior at this stage.

250

T. Zerucha, V.E. Prince / Mechanisms of Development 102 (2000) 247±250

2. Methods Degenerate primers were designed to isolate Meisrelated sequences: Meis 5 0 (degenerate): 5 0 TT(C/T)GA(G/A)AA(G/A)TG(C/T)GA(G/A)TIGCIAC Meis 3 0 (degenerate): 5 0 (C/T)TG(A/G)TCIATCATIGG(C/T)TGIAC PCR was performed for 35 cycles: 948C for 60 s, 488C for 60 s, and 728C for 90 s; plus a pre-dwell at 948C for 4 min and a 10 min post-dwell at 728C. The template used was a zebra®sh 18 h stage cDNA library (kindly provided by Bruce Appel) and a 735 bp Meis 2 related cDNA fragment was isolated and sequenced. Sequence speci®c primers were then generated (meis-3 0 : TGGCTCTTTCAACATCTC; meis-5 0 CGATGTCCTCGTTAAATG) to allow 3' and 5' RACE-PCR (as previously described; Frohman, 1993). The 3' (755 bp) and 5' (530 bp) clones were sequenced and used to generate PCR primers either side of the conceptual START (meis2-5 0 : CGGAATTCATATGCTGATGGCTCA) and STOP (meis2-3 0 : GCTCTAGAGGCGTTTACATGTAGT) of translation. Proof-reading polymerase (Pwo; Roche Inc.) was then used to amplify the complete coding sequence, which was cloned into pBluescript (Stratagene). The full-length cDNA (1182 bp) was completely sequenced in both directions (EMBL database accession # AJ300652) and shows three differences within the coding region to a sequence placed on Genbank (accession # AF170065). The cDNA was used to generate an anti-sense DIG labeled riboprobe for whole-mount in situ hybridization and sectioning in araldite (Polysciences) as previously described (Prince et al., 1998c). Acknowledgements We thank Abigail Kroch and Clifton Poma for their help at the onset of the project, Devon Mann and Mazen Kheirbek for expert technical assistance, and Cristin Howley for help with in situs on oocytes. We thank James McClintock and Cecilia Moens for comments on the manuscript. We thank the University of Chicago Cancer Research Center for sequencing, and Martin Feder for kindly sharing equipment. This study was funded by ACS Institutional Funds to the University of Chicago, and a University of Chicago Committee for Cancer Biology fellowship to T.Z. References Berthelsen, J., Kilstrup-Nielsen, C., Blasi, F., Mavilio, F., Zappavigna, V., 1999. The subcellular localization of PBX1 and EXD proteins depends on nuclear import and export signals and is modulated by association with PREP1 and HTH. Genes Dev. 13, 946±953. Brand, M., Heisenberg, C.P., Jiang, Y.J., Beuchle, D., Lun, K., FurutaniSeiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal, J., van Eeden, F.J., NussleinVolhard, C., 1996. Mutations in zebra®sh genes affecting the formation

of the boundary between midbrain and hindbrain. Development 123, 179±190. BuÈrglin, T.R., 1997. Analysis of TALE superclass homeobox genes (MEIS PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucl. Acids Res. 25, 4173±4180. Capdevila, J., Tsukui, T., Rodriquez-Esteban, C., Zappavigna, V., IzpisuaBelmonte, J.C., 1999. Control of vertebrate limb outgrowth by the proximal factor Meis2 and distal antagonism of BMPs by Gremlin. Mol. Cell. 4, 839±849. Cecconi, F., Proetzel, G., Alvarez-Bolado, G., Jay, D., Gruss, P., 1997. Expression of Meis2, a Knotted-related murine homeobox gene, indicates a role in the differentiation of the forebrain and the mesoderm. Dev. Dyn. 210, 184±190. Chang, C.P., Jacobs, Y., Nakamura, T., Jenkins, N.A., Copeland, N.G., Cleary, M.L., 1997. Meis proteins are major in vivo DNA binding partners for wild-type but not chimeric Pbx proteins. Mol. Cell. Biol. 17, 5679±5687. Frohman, M.A., 1993. Rapid ampli®cation of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Methods Enzymol. 218, 340±356. Jacobs, Y., Schnabel, C.A., Cleary, M.L., 1999. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity. Mol. Cell. Biol. 19, 5134±5142. Nakamura, T., Jenkins, N.A., Copeland, N.G., 1996. Identi®cation of a new family of Pbx-related homeobox genes. Oncogene 13, 2235±2242. Oulad-Abdelghani, M., Chazaud, C., Bouillet, P., Sapin, V., Chambon, P., Dolle, P., 1997. Meis2, a novel mouse Pbx-related homeobox gene induced by retinoic acid during differentiation of P19 embryonal carcinoma cells. Dev. Dyn. 210, 173±183. Oxtoby, E., Jowett, T., 1983. Cloning of the zebra®sh krox-20 gene (krx20) and its expression during hindbrain development. Nucl. Acids Res. 21, 1087±1095. Perriere, G., Gouy, M., 1996. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364±369. Prince, V.E., Joly, L., Ekker, M., Ho, R.K., 1998a. Zebra®sh hox genes: genomic organization and modi®ed colinear expression patterns in the trunk. Development 125, 407±420. Prince, V.E., Moens, C.B., Kimmel, C.B., Ho, R.K., 1998b. Zebra®sh Hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene valentino. Development 125, 393±406. Prince, V., Price, A., Ho, R.K., 1998c. Hox gene expression reveals regionalization along the anteroposterior axis of the zebra®sh notochord. Dev. Genes Evol. 208, 517±522. Rieckhof, G.E., Casares, F., Ryoo, H.D., Abu-Shaar, M., Mann, R.S., 1997. Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein. Cell 9, 171± 183. Shanmugan, K., Green, N.C., Rambaldi, I., Saragovi, H.U., Featherstone, M.S., 1999. PBX and MEIS as non-DNA-binding partners in trimeric complexes with HOX proteins. Mol. Cell. Biol. 19, 7577±7588. Shen, W.F., Rozenfeld, S., Kwong, A., ves Kom, L.G., Lawrence, H.J., Largman, C., 1999. HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells. Mol. Cell. Biol. 19, 3051±3061. Steelman, S., Moskow, J.J., Muzynski, K., North, C., Druck, T., Montgomery, J.C., Huebner, K., Daar, I.O., Buchberg, A.M., 1997. Identi®cation of a conserved family of Meis1-related homeobox genes. Genome Res. 7, 142±156. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: ¯exible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25, 4876±4882. Vlachakis, N., Ellstrom, D.R., SagerstroÈm, C.G., 2000. A novel Pbx family member expressed during early zebra®sh embryogenesis forms trimeric complexes with meis3 and hoxb1b. Dev. Dyn. 217, 109±119. Woo, K., Fraser, S.E., 1995. Order and coherence in the fate map of the zebra®sh nervous system. Development 121, 2595±2609.