Cloning and embryonic expression of zebrafish PLAG genes

Gene Expression Patterns 6 (2006) 267–276 www.elsevier.com/locate/modgep

Cloning and embryonic expression of zebrafish PLAG genes He´le`ne Pendevillea, Bernard Peersa, Koen Kasb, Marianne L. Voza,* a

Laboratoire de Biologie Mole´culaire et Ge´nie Ge´ne´tique, Center for Biomedical Integrated Genoproteomics, University of Lie`ge, B6 4000 Lie`ge (Sart-Tilman), Belgium b Peakadilly nv, Technologiepark 4, B-9052 Zwijnaarde, Ghent Belgium Received 13 January 2005; received in revised form 24 June 2005; accepted 1 August 2005 Available online 27 December 2005

Abstract PLAG transcription factors play important roles in oncogenesis. To date three members of this subfamily of zinc finger proteins have been identified in humans and mice: PLAG1, PLAGL1 and PLAGL2. In this study, we identified zebrafish orthologs of PLAG1 and PLAGL2 and a novel member of this family, PLAGX. We examined the temporal expression of these three genes by quantitative real time RT-PCR and found that all three genes are maternally provided, expressed at low level during early somitogenesis and, during late somitogenesis and beyond, PLAG expression increases to reach a plateau level around 5 dpf. Whole mount in situ experiments revealed that PLAG1, PLAGL2 and PLAGX display a similar pattern of expression characterized by a low ubiquitous expression overcame by high expression in some restricted compartments such as the ventricular zone of the brain, the pectoral fin buds, the developing pharyngeal arches and the axial vasculature. We show that this pattern resembles the one observed for the proliferative marker PCNA, suggesting that the PLAG genes are expressed more strongly in zones of active proliferation. This hypothesis was proven for the ventricular zone shown to be a highly proliferative zone using the anti-phosphohistone H3 antibody that detects cells in mitosis. q 2005 Elsevier B.V. All rights reserved. Keywords: PLAG; Zebrafish; Proliferation; Oncogene; Orthologue; Expression pattern

1. Results and discussion PLAG1 is a member of the highly conserved PLAG subfamily of zinc finger proteins, comprising two other members: PLAGL1 (also called LOT1 or ZAC1) and PLAGL2 (Abdollahi et al., 1997; Kas et al., 1998; Spengler et al., 1997). All three genes have been shown to be involved in tumorigenesis. PLAG1 is a proto-oncogene whose ectopic expression can trigger the development of lipoblastomas and pleomorphic adenomas of the salivary gland in humans (Astrom et al., 1999; Hibbard et al., 2000; Kas et al., 1997; Voz et al., 1998). PLAGL2 and PLAG1 cooperate with Cbfb-MYH11 for leukemogenesis in a knock-in mouse model (Castilla et al., 2004; Landrette et al., 2004). Conversely, PLAGL1 is strictly thought to be a tumor suppressor due to its anti-proliferative activity and its capability to induce apoptosis (Spengler et al., 1997; * Corresponding author. Tel.: C32 4366 3691; fax: C32 4366 2968. E-mail address: [email protected] (M.L. Voz).

1567-133X/$ - see front matter q 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.modgep.2005.08.001

Varrault et al., 1998). This difference in function is reflected in their DNA binding capacities as the three PLAG proteins, although highly homologous in their DNA-binding domain, bind different DNA sequences in a distinct fashion (Hensen et al., 2002; Varrault et al., 1998; Voz et al., 2000). Indeed, PLAG1 and PLAGL2 interact with a bipartite motif GRGGC(N)6–8GGG mainly via fingers 3, 6 and 7 while the binding of PLAGL1 to the monopartite motif GGGGGGCCCC does not require finger 3. Previous Northern Blot analyses performed in human have shown that PLAG1 and PLAGL2 are mainly expressed in foetal tissues suggesting that they play an important role in developmental processes (Kas et al., 1997; 1998). The importance of the PLAG genes in development is underscored by the significantly reduced foetal size and birth weights of the PLAG1 and PLAGL2 null mice (Hensen et al., 2004; Caroline Braem, personal communication). Finally, the spatiotemporal distribution of mouse PLAGL1 was studied by in situ hybridization and revealed that PLAGL1 transcripts were mainly detected in embryonic brain regions with high active cellular proliferation and in the limb buds at earlier stages (Valente and Auladell, 2001).

268

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

1.1. Cloning of the zebrafish PLAG genes In the process of decrypting the role of PLAG genes in zebrafish embryogenesis, we cloned the zebrafish PLAG orthologs. By a combination of PCRs using degenerate primers, hybridization of cDNA and genomic libraries and 5 0 RACE (for additional informations, see Section 2), we could isolate 3 members of the family, the orthologs of human PLAG1 (AY864859) and PLAGL2 (AF186476) and a novel member, PLAGX (AY864858) (Fig. 1). Despite

extensive screening and in silico searches, we were unable to detect the ortholog of PLAGL1 in zebrafish. Sequence alignment of PLAG1, PLAGL2 and PLAGX proteins highlights a high conservation amongst all PLAG members in the DNA binding domain and a complete conservation of the amino acid residues supposed to make key DNA contacts defining sequence specificity (residues represented by red dots in Fig. 1) (Hensen et al., 2002). Surprisingly, PLAGL2 in zebrafish comprises seven zinc finger motifs while the first zinc finger in human is disrupted. However,

Fig. 1. Alignment of vertebrate PLAG peptidic sequences. Residues identical in all proteins are shaded in yellow and those conserved in just some of them are shaded in blue. The zinc finger motifs (zf1–zf7) are indicated by lines and the position of the conserved Cys and His residues of the C2H2 zinc finger motifs (Consensus: CX2–4CX12–15HX3–4H) by asterisks. Residues supposed to make key base contacts (Hensen et al., 2002) are represented by red dots and are all conserved amongst PLAG members. Danio Rerio PLAG1 (AY864859) Dr-PLAG1, Dr-PLAGL2 (AF186476) and Hs-PLAG1 (NM_002655), comprise seven zinc finger motifs while Hs-PLAGL2 (AF006005), and Dr-PLAGX (AY864858) only 6 and 4, respectively. The position of the different oligonucleotides used for the isolation of the different members is also noted. Dr: Danio Rerio, Hs: Homo sapiens.

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

this should have a minor influence on their binding capacities as finger 1 does not seem critical for DNA binding of the human PLAG proteins (Hensen et al., 2002). In contrast, the absence of the first three zinc fingers in zebrafish PLAGX suggests that that protein binds a monopartite motif only composed of the core sequence GRGGC, as we have shown that the third finger is critical for the interaction with the second part of the bipartite element. A second conserved domain is the last ten amino acids region, totally identical in the PLAG family except for PLAGL1. The predicted amino acid sequences indicate that zebrafish PLAG1 and PLAGL2 present, respectively, 56 and 55% identity over their entire sequence with their human orthologs while the percentage of identity obtained for Dr-PLAGX with the closest relative, hs-PLAGL2, drops to 39% (Fig. 2A). A phylogenetic analysis of full length PLAG proteins indicates that Dr-PLAG1 clusters with the mouse and human PLAG1 while Dr-PLAGL2 fits strongly in the PLAGL2 clade (Fig. 2B). To further test whether zebrafish PLAG1 and PLAGL2 are true orthologs of the human genes, we determined whether a synteny occurs between the zebrafish and the human PLAG genomic loci using existing genomic databases (http://www.ensembl.org/). Zebrafish PLAG1 and PLAGL2 have immediate neighbors that are clear orthologs of human genes mapping close to the human PLAG1 and PLAGL2 genes (Fig. 2C). In contrast, the genomic locus of dr-PlagX was not syntenic with any human PLAG members (data not shown). Together, the combination of sequence similarity, phylogenetic tree and synteny shows unequivocally that we have indeed identified PLAG1 and PLAGL2 orthologs in zebrafish. 1.2. Expression pattern 1.2.1. Time course analysis of zebrafish PLAG expression by quantitative real-time RT-PCR We first examined the temporal expression profile of the zebrafish PLAG genes using the sensitive and quantitative real-time RT-PCR assay (Fig. 3). These analyses clearly indicated that all three PLAG mRNAs are maternally provided since we could detect the presence of the PLAG transcripts before the onset of zygotic transcription (around 3.0 hpf; Kane and Kimmel, 1993). For PLAG1, the level of expression thereafter declines abruptly to reach the background level at 14 hpf (i.e. the level obtained without reverse transcriptase). That decrease is probably due to the progressive degradation of the maternal PLAG1 transcript that is not compensated by zygotic transcription. Zygotic expression begins to increase in the middle of somitogenesis to reach a plateau level at 5 dpf. A different situation has been obtained for PLAGL2 and PLAGX where zygotic expression could already be detected at 6 hpf. This was followed by a rapid decline during gastrulation and early somitogenesis. However, similarly to PLAG1,

269

Fig. 2. Phylogenetic analysis of predicted zebrafish PLAG proteins and the synteny to human proteins. (A) The percentage of identity between the different PLAG proteins indicates that Dr-PLAG1 is more closely related to human PLAG1, Dr-PLAGL2 to human PLAGL2 while Dr-PLAGX does not closely relate to any PLAG proteins. (B) Phylogenetic tree of the vertebrate PLAG proteins. The bootstrap neighbour-joining phylogenetic tree was constructed with ClustalX (Thompson et al., 1997) and Treeview (Page, 1996) programs performed on the full-length amino acids sequences. The degree of relatedness is indicated by the branch lengths as number of amino acid replacements per site, the scale bar representing 0.1 replacements per amino acid site. Numbers on branches are the number of times, in one thousand runs, that the two clades branched as sisters. The accession numbers for the sequences are as follow: Mm-Zac1, Mus musculus Zac1 (NM_009538), Hs-PLAGL1, Homo sapiens PLAGL1 (U72621), Dr-PLAG1 (AY864859), Hs-PLAG1 (NM_002655), MmPLAG1 (NM_019969), Dr-PLAGX (AY864858), Dr-PLAGL2 (AF186476), Hs-PLAGL2 (AF006005), Mn-PLAGL2 (AB051854). (C) Genomic sequence surrounding the zebrafish PLAG1 and PLAGL2 genes shows the syntenic relationship with the human genes. ENSDARG00000013622 is predicted to be homologous to the tyrosineprotein kinase HCK.

the zygotic expression of PLAGL2 and PLAGX increases again in the middle of somitogenesis to reach plateau level at 5 dpf. 1.2.2. Localization of zebrafish PLAG RNA expression by whole-mount in situ hybridization. The distribution of the different zebrafish PLAG messages was next analyzed by whole-mount in situ

270

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

was ever observed in the sense controls done in parallel (Figs. 4I, 5E, 6E). Secondly, a supplementary step of purification on spin columns has been added after the synthesis of the riboprobe to take away as much as possible of free ribonucleotides that can be responsible for nonspecific staining of the embryo. Finally, the revelation was kept as short as possible to avoid non specific staining and probe trapping, that especially occurs with long period of NBT/BCIP staining. At early stages of development, in situ experiments could only detect a faint ubiquitous expression of the PLAG transcripts (data not shown). It is only from late somitogenesis that high expression became visible in more restricted areas, as described below. 1.3. PLAGL2

Fig. 3. Time course analysis of zebrafish PLAG expression by quantitative real-time RT-PCR. Quantitative results are presented as normalized mean (GSD) copies of target genes per 250 ng RNA. Each sample was run in triplicate, together with known dilutions of respective plasmid cDNA ranging from 105 to 101 copies, the appropriate non-template controls and mock reverse-transcribed RNA (samples noted w/o RT). For PLAGX realtime PCR runs, melting curve analyses were performed and single specific melting peaks were observed indicating amplification specificity. The absence of cross-reactivity between the different PLAG members was also checked. The normalization factor was calculated using the copy number of 18S in the cDNA sample versus the average 18S copy number in all 12 cDNAs samples. The temporal expression profiles of the PLAG genes were also confirmed using a second set of reverse-transcribed RNAs isolated independently (data not shown).

hybridization from one-cell stage until 2 days of development. In order to be sure about the specificity of the expression pattern observed, in situ experiments have been carried with the utmost care. Firstly, at least two riboprobes spanning different regions of the different PLAG transcripts have been used together with their sense control (see description in Section 2). No staining and probe trapping

At 14 somite stage, a faint and ubiquitous expression of PLAGL2 transcripts was detected together with a stronger staining occurring in the lateral plate mesoderm (Fig. 4, double black asterisks in A). That pattern of expression in the lateral mesoderm persisted until 18 somite stage. The developing brain appeared also strongly marked at that stage (C). At 20 somite stage, PLAGL2 expression became most pronounced in the ventricular region of the brain (white arrow in D,E). At 24 hpf, the transcript was strongly distributed in the anterior portion of the body with high levels observed in the brain, the otic vesicles and the eye (F,H). Control experiments performed in parallel on the same batches of embryos with the corresponding sens RNA riboprobe gave no signal (I, K). The preferential expression of PLAGL2 observed at the ventricular surface (G) was confirmed by cross-sections through the head of 24 hpf embryos stained for PLAGL2 (J). We next determined whether this region correlates with a proliferative zone as described in other species (Gage, 2000). Firstly, we performed a whole mount immunohistochemistry on 24 hpf-staged embryos with the anti-phosphohistone H3 antibody that detects cells in mitosis. Sectioning of these embryos at the midbrain level showed that most positive labeled cells were confined to the ventricular surface of the brain (see brown spots in L). As shown on the section presented in M, these proliferative cells lining the ventricle cavity contain a lot of cytoplasm. We can thus conclude that the PLAGL2 messages accumulate at the apical side of these cells (J) and that the signal observed really corresponds with cell bodies within the nervous system. Secondly, as comparison with PLAGL2 staining, whole mount in situ hybridization was also used to localize expression of the zebrafish PCNA gene (a marker for cells in proliferation) at 24 hpf. The dorsal view in Y shows a striking resemblance between PLAGL2 (G) and PCNA expression at 24 hpf with a similar ventricular localization pattern and transcripts also detected in the otic vesicles and in the retina. At later stages PLAGL2 continued to be strongly expressed in the brain from 24 to 48 hpf, with additional staining being seen in the

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

developing pectoral fin buds (S and cross-section in T), the axial vasculature (Q,R) and more slightly in the neural tube (Q,U). We found prominent expression of PLAGL2 along the ventricular surface (white arrow in N,P), in the innermost cell layer adjacent to the lens (white arrowhead in S), the otic vesicles and in the hindbrain at these stages. PLAGL2 was also expressed in a region consistent with the position of the developing pharyngeal arches (double white asterisks in O,R,V) and in the neurocranium. Expression of the skeletal primordia in pharyngeal arches is visualized by Dlx3 staining (W) (Yelick and Schilling, 2002). Cross-sections through the trunk of 43 hpf embryos revealed a restricted distribution of PLAGL2 mRNA dorsal within the spinal cord (U). Examination of PCNA signal at 48 hpf also showed that the domains expressing PCNA are very similar to the sites of PLAGL2 expression (compare R and X). 1.4. Zebrafish PLAG1 Whole mount in situ experiments showed that PLAG1 transcripts (Fig. 5) were distributed uniformely across the whole embryo at 20 somite stage (A,B). Similarly to what was observed for PLAGL2, that widespread expression became more restricted in the head region: in the brain, eyes, otic vesicles, head mesenchyme at 24 hpf and at the later stages analyzed (31, 36 and 48 hpf). The stronger signal of PLAG1 expression was consistently detected in the ventricular zone of the whole brain (see cross section in D and white arrow in C,F,H,I,K). From 24 hpf on, the PLAG1 domain of expression could also be detected in the axial vasculature (see detail at 31 hpf in G), the pectoral fin buds, the developing pharyngeal arches (double white asterisks in H,I,K) and the neurocranium. At 36 and 48 hpf, in situ hybridization showed that the lens is weakly labeled as well (dorsal views in J,L). 1.5. Zebrafish PLAGX At 20 somite stage, we could observe a high expression of PLAGX transcript in the anterior part of the embryo (Fig. 6A,B). This wide and ubiquitous expression of PLAGX was maintained in the head and trunk at 24 hpf (C) and was not restricted to the ventricular zone of the brain (as for PLAGL2 and PLAG1) as shown in the transverse section performed on a 24 hpf stained embryo (D). However, 37 hpf stained embryos showed that, similarly to PLAG1 and PLAGL2, PLAGX is mainly expressed along the brain ventricles, in the eyes (in the whole lens (H)), the otic vesicles, the axial vasculature, the developing pharyngeal arches, the neurocranium whereas other parts of the brain are less, although ubiquitously, marked (F,G). PLAGX expression remained high in these compartments at 48 hpf (I,J,K) with an additional signal observed in the intestine (white arrowhead in L,M).

271

From these datas, we can therefore conclude that the three PLAG genes display a similar temporal expression profile as well as a considerable overlap in their expression domains. Our in situ hybridization experiments showed a diffuse and wide staining at all developmental stages tested, reflecting a general expression of the PLAG genes in all tissues but being more abundantly expressed in a few compartments such as the ventricular zone of the brain, the developing eyes, the otic vesicles, the pectoral fin buds, the developing pharyngeal arches and the axial vasculature. Since this expression resembles the expression pattern observed on 24 and 48 hpf stained embryos with a PCNA probe, it suggests that the domains concerned are highly proliferative domains at these stages and this has been proven for the ventricular zone of the brain. Also, although the PLAG genes share expression in most tissues, they also display some minor differences in the intensity of the signal and/or have some specific sites of expression. This is particularly true for PLAGX whose expression is the most widespread and which also displays a specific expression in the intestine at 2 days of development.

2. Experimental Procedures 2.1. Cloning of PLAG orthologues from zebrafish Consensus-degenerate primers P2068 (AGGCAYATGGCLYACLYCAYTC) and P2069 (ARWACTGRCASAGGAAGTCCTT) designed to conserved motifs in the DNA binding domain of the three human PLAG genes (Fig. 1) allowed us to amplify a partial PLAGL2 cDNA from 24 hpf cDNA. This was subsequently used to isolate the zebrafish PLAGL2 gene from a genomic BAC library (BAC-8543, Genome Systems). Analysis of the sequence conservation amongst characterized members of the PLAG family and this new zebrafish clone revealed an additional conserved region in the C-terminal region (Fig. 1). This region is conserved between PLAG1 and PLAGL2 in different species but is not present in PLAGL1. PCRs performed on genomic zebrafish DNA (using P2068 and a new designed consensus-degenerate primer P3034 (GCYTGTTGTAATCGWGGCA) directed against this C-terminal region) allowed us to isolate partial PLAG1 sequence in addition to PLAGL2. The full length PLAG1 cDNA was obtained by screening of the zebrafish and Fugu geneFinder cDNA pools (RZPD, Germany, clone CHBOp576L13241Q). Finally, PLAGX was obtained by PCR amplification using the primers P3058 (CACACGACCCCAACAAGGAG) and P3034 followed by the screening of the zebrafish and Fugu geneFinder cDNA pools (RZPD clones ID ICRFp524C204Q8 and ICRFp524J02171Q8). The full length PLAGX cDNA was obtained by 5 0 RACE (Ambion, First choice RLM-RACE).

272

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

Fig. 4. Spatio-temporal distribution of the zebrafish PLAGL2 transcripts from 14 somite stage to 48 hpf and comparison with the proliferative marker PCNA. Whole mount in situ hybridization was performed using either PLAGL2, PCNA or Dlx3 antisense probes (except in L,M whole mount immunohistochemistry with anti-phosphohistone H3 antibody). The developmental stage is indicated in each panel. (A) Posterior view of a 14 somite stage embryo. Lateral (B,C,D,F, N,O,Q,R,V,W,X) or dorsal (E,G,H,I,P,S,Y) views of zebrafish embryos with anterior to the left. Transverse sections (5 mm) at the level of the midbrain in J,K, L,M, hindbrain in T or at the trunk level in U. (A,B) At 14 somite stage, PLAGL2 is expressed ubiquitously at low levels and more strongly in the lateral plate mesoderm and in the developing brain and eyes. (C) At 18 somite stage, staining is seen throughout the whole embryo and more intensely in the developing brain and the lateral mesoderm. (D,E) At 20 somite stage, PLAGL2 expression is evident in the anteriomost part of the embryos and more specifically in the ventricular zone. (F,G,H) Staining is evident in the brain, the otic vesicles and the eyes at 24 hpf. (J) A microtome section confirms the preferential expression of PLAGL2 in the apical region of the ventricular zone of the brain. (L) These PLAGL2-labelled cells correspond to a proliferative zone as shown by the high number of mitotically active cells (stained by anti-phospho H3 antibody) at the ventricular border (brown spots in L). (M) H&E-stained section showing the highly cytoplasmic content of the cells lining the brain ventricle. Expression of PLAGL2 at 36 and 48 hpf is evident in the brain ventricles (N,O,P,R), the

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

273

Fig. 5. Spatio-temporal distribution of the zebrafish PLAG1 transcripts from 20 somite stage to 48 hpf. Embryos (A,C,E,F,G,H,I,K) are shown in lateral view, with anterior to the left. Embryos (B,J,L) are shown in dorsal view with anterior to the left. (D) is a vibratome section at the midbrain level. (A,B) Wide expression of PLAG1 transcript throughout the whole embryo at 20 s stage. (C,F) At 24 and 31 hpf, PLAG1 expression is located in the brain ventricles (as shown on a vibratome section at 24 hpf in D), the otic vesicles, the eyes and the developing axial vasculature. (G) Magnified view of the trunk at 31 hpf showing a high staining in the vasculature. The brain, developing fin buds and primordia of the pharyngeal arches are also highly stained at 36 hpf (H,I) and 48 hpf (K,L). (I,J,L) Magnified views showing that PLAG1 signal is mostly located in the brain ventricles (more intensely in the hindbrain ventricle), the neurocranium and the pectoral fin buds. The lens appears also weakly stained at these stages. White arrows denote the ventricular zone of the brain. Black arrows show the pectoral fin buds. Double white asterisks indicate the developing pharyngeal arches. OV, otic vesicles; AV, axial vasculature.

2.2. RNA extraction and cDNA synthesis Total RNA of whole embryos/fishes were isolated using Trizole Reagent (Life technologies) according to manufacturer protocols. In order to minimize the amount of genomic DNA contaminating the preparation, the RNA isolated was further purified through a second step of Trizol purification by directly dissolving the RNA pellet obtained during the first purification in 1 ml of Trizole Reagent and starting back the whole procedure. The RNA concentrations were determined by OD260 measurements and the quality of the preparation was checked on gel. Total RNA (5 mg) were then reverse transcribed with Superscripte reverse transcriptase (Superscripte first

strand synthesis system for RT-PCR, Invitrogen) and random hexamers as primers. 2.3. Quantitative real-time PCR For PLAG1 and PLAGL2, intron-spanning primers and probes for the TaqMan system were designed by using the Primer Express software (Perkin Elmer, Foster City, CA) (Table 1). The 5 0 - and 3 0 -end nucleotides of the TaqMan probe were labelled with a reporter (FAMZ 6-carboxy-fluorescein) and a quencher dye (TAMRAZ6carboxy-tetramethylrhodamine). For PLAGX, as the melting curve performed after amplification revealed single specific melting peaks indicating amplification

3 ganglion cell layer of the retina (S), the pharyngeal region (double white asterisks in O,R,V), the otic vesicles and the roof of the neural tube (black asterisk in Q,R,U). A signal is also observed in the developing fin buds (black arrows in R,S,T) and the developing vasculature at 36 and 48 hpf (Q,R). (W) Expression of Dlx3 in pharyngeal arch primordia, similar to that observed for PLAGL2 at 48 hpf (V). (Q, R) Views of 24 and 48 hpf embryos stained with PCNA antisense probe. Note the striking similarity of the signal observed between PCNA and PLAGL2 at the same stage (compare R and X, G and Y). Double black asterisks indicate the lateral plate mesoderm. White arrows denote the ventricular surface of the brain. Black arrows show the pectoral fin buds. Black asterisk indicates the top of the neural tube. White arrowhead points to the ganglion cell layer of the retina. Double white asterisks denote the developing pharyngeal arches. OV, otic vesicles; AV, axial vasculature.

274

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

Fig. 6. Spatio-temporal distribution of the zebrafish PLAGX transcripts from 20 somite stage to 48 hpf. (A,C,E,F,I,J,M) Lateral views, anterior to the left. (B,G, H,K) Dorsal views, anterior to the left. (D) Microtome section at the midbrain level. (L) Vibratome section at the trunk level. (A,B) PLAGX is ubiquitously expressed in the anteriormost part of the embryo at 20 somite stage. (C) The expression remains high and wide in the brain at 24 hpf, as shown by the intensity of the signal detected through a 5 mm section (D). At 37 hpf (F,G) and 48 hpf (I,J,K), PLAGX is detected in the brain, eyes, neurocranium, otic vesicles, developing arches, pectoral fin buds and axial vasculature. (H) The whole lens appears labelled at 37 and 48 hpf. A specific signal is also observed in the gut at 48 hpf as clearly detected on the vibratome section shown in L and in the lateral view of the tail represented in M. White arrows denote the ventricular surface of the brain. Black arrows show the pectoral fin buds. Double white asterisks indicate the developing pharyngeal arches. White arrowhead shows the gut at 48 hpf. OV, otic vesicles; AV, axial vasculature; PQ, palatoquadrate of the pharyngeal arches; TE, trabeculea of the neurocranium; SOC, superoptic cartilage.

specificity and the absence of dimers, the quantitative real-time PCR was performed using SybrGreen. The specificity of the PCR products was further confirmed by agarose gel electrophoresis, whereby the amplicons were of the estimated size. The absence of cross-reactivity between the different PLAG members was also checked. The 18S ribosomal RNA was measured using the PreDeveloped Taqman assay (Eukaryotic 18S rRNA Endogenous Control (FAM/MGB)) from Applied Biosystems (Foster City, CA).

Real-time quantitative PCR analyses were carried out using the ABI PRISM 7700 Sequence Detection System instrument and software (PE Applied Biosystems). A calibration curve was generated by 10-fold serial dilution of plasmids containing the amplified region of the targeted genes (from 105 copies down to 101 copies) and the accuracy of the curve was verified using different plasmid constructs. The copy numbers of the plasmid DNA templates were calculated according to the molecular weight of the plasmid (660/bp average value) and then

Table 1 Sequence of primers and TaqMan probes used for quantitative real-time PCR studies Gene

Primers

Probes

Size (bp)

Dr-PLAG1

F: TCTCTAAGTATAAACTCCTACGGCACAT R: GGGTCGTGTGTATGGAGATGGT F: AGCCCCATTGCCCTAAGG R: GGTGATCTTTGCGGTGAAACA F: GCGGCCGACGCTTCT R: ACTCTTGCGCGTGGCTCTT

AAGATGTTCCACCGCAAAGATCACCTAAAGA

126

ATGGCCACACACTCCCCACAGAAGAC

122

Dr-PLAGL2 Dr-PLAGX

150

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

converted into the copy numbers based upon Avogadro’s number (1 molZ6022!1023 molecules). The expression level of the target gene was normalized against 18S rRNA to compensate for variation due to differences in the RT efficiency and RNA quality between samples. The normalization factor was calculated using the copy number of 18S in the cDNA sample versus the average 18S copy number in all 12 cDNAs samples used in this study. For 18S, relatively constant expression level was obtained for all 12 samples, indicating the suitability of that gene as an internal control and a reference for normalization. PCR was carried out in triplicate with the Q-PCR master mix (Eurogentech) using 5 ml of diluted cDNA (equivalent to 250 ng total RNA), 200 nM of the probe, and 400 nM primers in a 25 ml final reaction mixture. For PLAGX, real-time PCR was carried out in triplicate with the Q-PCR master mix for SYBR green (Eurogentech) using 5 ml of diluted cDNA (equivalent to 250 ng total RNA), and 400 nM primers in a 25 ml final reaction mixture. After a 2 min incubation at 50 8C to allow uracil-N-glycosylase cleavage, AmpliTaq Gold was activated by an incubation for 10 min at 95 8C. Each of the 40 PCR cycles consisted of 15 s of denaturation at 95 8C and hybridation of probe and primers for 1 min at 60 8C. 2.4. In situ experiments All work involving zebrafish was conducted in compliance with what described in the zebrafish book (Westerfield, 1995). Whole mount in situ hybridizations of zebrafish embryos were performed using digoxigenin labeled antisense RNA probes prepared using dig-RNA labeling kit (Roche) according to the manufacturer’s instructions. After synthesis, all riboprobes were passed on Nuc Away spin columns (Ambion) and subsequently ethanol-precipitated to take away as much as possible of the free ribonucleotides that can be responsible for non-specific staining of the embryos. All PLAG riboprobes were designed in the 3 0 UTR and/or in the transactivation domain, which is not conserved between the different PLAG genes. The absence of repetitive elements was also checked using the Zebrafish RepeatMasker Server (http://www.sanger.ac.uk/Projects/D_rerio/fishmask.shtml). For all three PLAG genes, we have used at least two different riboprobes to be sure of the reproducibility of the expression pattern. For zPLAGL2, three riboprobes were used, spanning the regions 739–1048, 1176–2922 or 1371–2922 in AF186476, for zPLAG1, spanning the regions 1003–1416, 1011–1873 or 1059–2741 in AY864859 and for zPLAGX, spanning the regions 1008–1480 or 2396–4494 in AY864858. Since all these probes gave identical expression profiles, we mainly presented hybridization data obtained with the longest probes. In situ experiments were carried at 60 8C as described previously (Thisse et al., 1993) with minor modifications. For sectioning, stained embryos were dehydrated, embedded into JB-4 plastic resin (Polysciences, Inc.), and sectioned at 5 mm on a Leica microtome. For 30 mm sections, embryos were embedded in a gelatin/albumin mix and sectioned on a

275

Campden Instruments vibratome. Whole mount immunohistochemistry was performed using an antibody specific to phosphohistone H3 at Ser10 (1:200 dilution, Upstate Biotechnology). After permeabilisation and washes of 24 hpf embryos, the binding of the primary antibody was followed by incubation with a biotinylated anti-rabbit antibody at 4 8C overnight (1:500 dilution, Vector laboratories). The color reaction was vizualized with the Vectastain Elite ABC kit and 3,3 0 -Diaminobenzidine tetrahydrochloride as chromogen (Vector Laboratories). Pictures were made using an Olympus microscope linked to the Analysis software and processed with Adobe Photoshop.

Acknowledgements We are grateful to Dr Yi-Lin Yan and Dr C. Kimmel for some helpul advice on the manuscript. We thank Nathalie Devos and the fish facility staff for fish care. We also thank Dr Fre´de´ric Bie´mar, Pascal Servais, Jessica Tabart, AnneCatherine Binot for their help during the experimental stages of this work. MLV is a Chercheur qualifie´ and HP is a Charge´e de recherches at the Belgian National Fund for Research (FNRS). This work was funded by the Belgian State Program on ‘Interuniversity Poles of Attraction’ (SSTC, PAI p5/35) and by the Belgian National Fund for Research FNRS (‘Credit chercheur: 2001-02: 1.5.108.2, 2003-04: 1.5.130.03, 2004-05: 1.5.214.05’ and ‘FRFC 2003-06: 2.4531.03’).

References Abdollahi, A., Roberts, D., Godwin, A.K., Schultz, D.C., Sonoda, G., Testa, J.R., Hamilton, T.C., 1997. Identification of a zinc-finger gene at 6q25: a chromosomal region implicated in development of many solid tumors. Oncogene 14, 1973–1979. Astrom, A.K., Voz, M.L., Kas, K., Roijer, E., Wedell, B., Mandahl, N., et al., 1999. Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: Identification of SII as a new fusion partner geneidentification of SII as a new fusion partner gene. Cancer Res. 59, 918–923. Gage, F.H., 2000. Mammalian neural stem cells. Science 287, 1433–1438. Hensen, K., Van Valckenborgh, I.C., Kas, K., Van de Ven, W.J., Voz, M.L., 2002. The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities. Cancer Res. 62, 1510–1517. Hensen, H., Braem, C., Declercq, J., Van Dyck, F., Dewerchin, M., Fiette, L., Denef, C., Van de Ven, W.J.M., 2004. Targeted disruption of the murine plag1 proto-oncogene causes growth retardation and reduced fertility. Dev. Growth Differ. 46, 459–470. Hibbard, M.K., Kozakewich, H.P., Dal Cin, P., Sciot, R., Tan, X., Xiao, S., Fletcher, J.A., 2000. PLAG1 fusion oncogenes in lipoblastoma. Cancer Res. 60, 4869–4872. Kane, D.A., Kimmel, C.B., 1993. The zebrafish midblastula transition. Development 119, 447–456. Kas, K., Voz, M.L., Roije, E., Astrom, A.K, Meyen, E., Stenman, G., Van de Ven, W.J, 1997. Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3; 8)(p21;q12) translocations. Nat. Genet. 15, 170–174.

276

H. Pendeville et al. / Gene Expression Patterns 6 (2006) 267–276

Kas, K., Voz, M.L., Hensen, K., Meyen, E., Van de Ven, W.J., 1998. Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J. Biol. Chem. 273, 23026–23032. Landrette, S.F., Kuo, Y.H., Hensen, K., Khosrovani, B., Perrat, P.N., Van de Ven, W.J., et al., 2004. Plag1 and Plagl2 are oncogenes that induce acute myeloid leukemia in cooperation with Cbfb-MYH11, Blood. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Spengler, D., Villalba, M., Hoffmann, A., Pantaloni, C., Houssami, S., Bockaert, J., Journot, L., 1997. Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. Eur. Mol. Biol. Org. J. 16, 2814–2825. Thisse, C., Thisse, B., Schilling, T.F., Postlethwait, J.H., 1993. Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 1203–1215. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Valente, T., Auladell, C., 2001. Expression pattern of Zac1 mouse gene, a new zinc-finger protein that regulates apoptosis and cellular cycle arrest, in both adult brain and along development. Mech. Dev. 108, 207–211. Varrault, A., Ciani, E., Apiou, F., Bilanges, B., Hoffmann, A., Pantaloni, C., et al., 1998. HZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc. Natl Acad. Sci. USA 95, 8835–8840. Voz, M.L., Astrom, A.K., Kas, K., Mark, J., Stenman, G., Van de Ven, W.J., 1998. The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter. Oncogene 16, 1409–1416. Voz, M.L., Agten, N.S., Van de Ven, W.J., Kas, K., 2000. PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II. Cancer Res. 60, 106–113. Westerfield, M., 1995. General methods for zebrafish care, Zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon, Eugene, OR. Yelick, P.C., Schilling, T.F., 2002. Molecular dissection of craniofacial development using zebrafish. Crit. Rev. Oral Biol. Med. 13, 308–322.