Cloning and expression of a putative common cytokine receptor gamma chain (γC) gene in rainbow trout (Oncorhynchus mykiss)

Fish & Shellfish Immunology (2001) 11, 233–244 doi:10.1006/fsim.2000.0310 Available online at http://www.idealibrary.com on

Cloning and expression of a putative common cytokine receptor gamma chain (
C) gene in rainbow trout (Oncorhynchus mykiss) TIEHUI WANG AND CHRISTOPHER J. SECOMBES* Department of Zoology, University of Aberdeen, Tillydrone Avenue, Aberdeen AB24 2TZ, U.K. (Received 26 May 2000, accepted after revision 6 September 2000) A full length cDNA of a putative common cytokine receptor gamma chain (
C) gene of rainbow trout (Oncorhynchus mykiss) has been cloned and sequenced. The contiguous cDNA contained 2291 nucleotides, consisting of an ORF of 1029 bp, with a 72 bp 5 UTR and a 1190 bp 3 UTR. The coding region showed 44–46% identity to mammalian
C genes. The ORF translated into a 343 amino acid protein, with some 28–30% amino acid identity to the coding region of mammalian sequences. A predicted signal peptide and transmembrane domain were identified, giving a 206 amino acid extracellular domain and a 98 amino acid intracellular domain in the trout molecule. Five potential glycosylation sites were present in the extracellular domain, as were six conserved cysteine residues and the W-S-X-W-S motif typical of haemopoietin receptors. One of the most interesting di#erences between the trout and mammalian sequences was the lack of tyrosines in the trout intracellular domain. RT-PCR studies revealed a wide tissue distribution of
C expression, with detectable transcript in blood, spleen, gill, kidney, brain and liver. Low levels of
C transcript were detectable in unstimulated macrophage cultures and expression was increased by stimulation of the cells with recombinant trout interleukin-1 (IL-1) or LPS. Similarly, in the RTG cell line which exhibited even lower level constitutive expression, stimulation with IL-1 increased
C transcript levels but LPS had no e#ect.  2001 Academic Press Key words:

common cytokine receptor gamma chain, rainbow trout, cDNA, expression.

I. Introduction At least four families of cytokine receptors can be defined on the basis of sequence homology, secondary structure and function (Nicola, 1994). These include the haemopoietin and interferon receptors, the TNF/NGF receptors, receptor kinases and G-protein coupled receptors. The haemopoietin receptors have an extracellular haemopoietin-binding domain containing a conserved W-S-X-W-S motif and shared cysteine residues. The cytokines they bind possess a four alpha helical bundle crystal structure (Sprang & Bazan, 1993), and are subdivided into those with short-chain helices and long-chain helices. *Corresponding author. E-mail: [email protected] 1050–4648/01/030233+12 $35.00/0

233

 2001 Academic Press

234

T. WANG AND C. J. SECOMBES

On binding their ligand, signal transduction by these receptors typically requires formation of a homodimer or heterodimer of two receptor molecules with long cytoplasmic domains. In some cases a third receptor molecule is also required for signal transduction. A receptor molecule can be common to many di#erent receptor complexes, suggesting that a new complex is formed by altering only some of the components (Shields et al., 1995). The common cytokine receptor gamma chain (
C) was originally isolated as the gamma chain of the interleukin-2 receptor (IL-2R); with the low a$nity receptor being composed of the  subunit, the 
subunits giving an intermediate a$nity form and the 
complex giving the high a$nity receptor (Waldmann, 1993; Lin & Leonard, 1997). The
C is particularly important for IL-2 signalling since it regulates the dissociation of IL-2 from the receptor and is involved in receptor internalisation as well as signal transduction (Arima et al., 1992). In addition to its role in the IL-2R complex the
C is also a signal transducing component of various other cytokine receptors, including receptors for IL-4, IL-7, IL-9 and IL-15 (Vilcek, 1998), with its role in the IL-13R complex under debate (Murata et al., 1997). Signalling via these cytokines is crucial for many aspects of T and B cell development, and thus it is not surprising that the
C plays a key role in these events (Malek et al., 1999; Nakajima et al., 2000). Mutations in the
C result in an X-linked severe combined immunodeficiency (SCIDX1) (DiSanto et al., 1994; Ting et al., 1999) and in
C deficient mice
/ T cells are absent (Malissen et al., 1997). In adults, administration of monoclonal antibodies (mab) specific for the
C can completely ablate the induction of a cytotoxic T cell response when used in combination with anti-IL-2R and anti-IL-2R mab (Yasuda et al., 1998), without a#ecting CD4 + CD8
and CD4
CD8 + numbers. More recently it has been shown that the
C is essential for aspects of monocyte and macrophage activity, as with IL-4 regulated TNF (Bonder et al., 1998) and IL-10 (Bonder et al., 1999) production by these cells. Clearly the
C is an important immunoregulatory molecule, with potential as a pharmaceutical target and as a key gene to monitor in studies looking at dysfunction of the immune system, where cytokine and cytokine receptor mRNA levels are thought to be particularly sensitive to the immunomodulatory e#ects of drugs and chemicals (Vandebriel et al., 1998). Relatively few cytokine receptor genes are known outwith mammals (Secombes, 1998). In chickens, amphibians and bony fish a few chemokine receptors have been cloned (Moepps et al., 1998; Daniels et al., 1999; Fujiki et al., 1999) and four FGFR are known (Secombes, 1998). In chickens the IL-1R-I has also been cloned (Guida et al., 1992) and in bony fish a number of CSF receptors have been cloned (How et al., 1996; Nam et al., 2000) and recently the TNFR1 and TNFR2 genes have been sequenced in Japanese flounder EST studies (Nam et al., 2000). No haemopoietin receptor genes have been cloned to date in fish and the
C is unknown outwith mammals, although in chickens a monoclonal antibody has been described that binds to a 110 kDa receptor on T cell blasts that is thought to be the
C (Lee & Tempelis, 1992). This paper describes the cloning of the full length
C in rainbow trout Oncorhynchus mykiss, and shows that this gene has a wide tissue distribution and can be modulated by stimulation with trout cytokines.

CLONING AND EXPRESSION OF A GAMMA CHAIN (
C) GENE

235

Table 1. Primers used for sequencing and expression studies Name CR-F1 CR-R1 CR-R2 CR-R3 GPDH-F GPDH-R GR1 RM13

Gene

Sequence (5 to 3 )


C
C
C
C GAPDH GAPDH Interferon Vector

CAGCGACAAGTGGAAGACATC CACTCACTCTCCACACATGTAC TCCCACAGCATAACTCTCCTC TGGACAGGCAATCTGACTGGTC ATGTCAGACCTCTGTGTTGG TCCTCGATGCCGAAGTTGTCG GGGTCTGGGACCKNYTNCKYTT AGCGGATAACAATTTCACACAGG

K=G+T; Y=C+T; N=A+G+C+T.

II. Materials and Methods SEQUENCING

Several degenerate primers were designed to screen cDNA libraries to isolate clones for immunologically important genes, such as cytokines. Using primer GR1 and RM13 (Table 1), a clone was obtained with apparent homology to
C from a rainbow trout Oncorhynchus mykiss macrophage-enriched headkidney leucocyte cDNA library (Hardie et al., 1998). This clone was subcloned and sequenced using vector primers and the gene specific primers
C Forward (F) 1 (CR-F1),
C Reverse (R) 1 (CR-R1) and CR-R3 (Table 1). The obtained sequence was apparently missing the 5 end of the cDNA, thus anchored PCR was performed using library cDNA as template with CR-R2 and RM13 to obtain the remaining sequence. The amplification was performed in 50 l reaction volumes containing 2 l forward and reverse primers (10 M), 2 l dNTP mix (2·5 mM each dATP, dCTP, dGTP, dTTP; Promega), 5 l 10Taq bu#er (Promega), 4 l MgCl2 (25 mM; Promega), 32·5 l sterile H2O, 0·5 l Taq DNA polymerase (Promega) and 2 l cDNA library template. The PCR cycling protocol was 4 min at 94 C, followed by 30 cycles of 94 C for 1 min, 62 C for 1 min and 72 C for 1 min, with a final extension at 72 C for 10 min. The generated PCR product was ligated into the pGEM TEasy vector (Promega) and following transfection into competent E. coli cells, recombinants were identified through blue-white colour selection. Plasmid DNA from six clones was recovered using a Qiaprep spin miniprep kit (Qiagen), and sequenced using an ABI 377 Automated Sequencer (Applied Biosystems). In addition, the transcription initiation point was investigated using a GeneRacer kit (Invitrogen), where 5 RACE PCR was performed with primer CR-R3 in a manner that only allowed amplification of full length capped mRNA, obtained from stimulated macrophages (see expression studies). The obtained product was cloned and sequenced as above. DATABASE AND SEQUENCE ANALYSIS

Sequences generated were run through the GenBank/EMBL databases using the FASTA (Pearson & Lipman, 1988) and BLAST (Altschul et al., 1990)

236

T. WANG AND C. J. SECOMBES

suite of programmes, to search for similarity. Direct comparison between sequences was performed using the GAP programme (Needleman & Wunsch, 1970), within the Wisconsin Genetics Computer Group (GCG) Sequence Analysis Software Package (version 10.0, 1999), and multiple sequence alignments generated using CLUSTALW (version 1.74, 1997) (Thompson et al., 1994). SignalP (version 2.0) (Nielsen et al., 1997) was used to predict whether a signal peptide was present, and TMpred (Hofmann & Sto#el, 1993) to predict membrane-spanning domains. EXPRESSION STUDIES

RT-PCR with primers CR-F1 and CR-R3 (expected product size of 515 bp) was performed with cDNA from a range of tissues (brain, pituitary, head kidney, liver, spleen, gill, blood) isolated from control trout. RNAzol B was used for preparation of total RNA from tissues and cell suspensions. Standard PCR reaction conditions and thermal cycling protocol were used as described above. Primers for GAPDH (GAPDH-F and GAPDH-R, Table 1) were used as a positive control for RT-PCR, since the gene is expressed constitutively in the tissues/cells examined. Expression in cultured trout macrophages (Secombes, 1990) and in the RTG cell line (Wolf & Quimby, 1962) was studied with or without stimulation of the cells for 4 h with recombinant trout IL-1 (rIL-1) produced in Escherichia coli (Secombes et al., 2000), at 20 ng ml
1 or with LPS at 20 g ml
1. III. Results SEQUENCING

The fully sequenced head-kidney leucocyte library clone contained 2270 bp of contiguous sequence, with a clear open reading frame (ORF), stop codon and 3 UTR. However, from analysis of multiple alignments it was not clear that the complete 5 end of the gene was present. Thus anchored PCR was performed to attempt to obtain further 5 sequence. Anchored PCR with primer CR-R2 gave a product of 300 bp that contained a further 39 bp of 5 sequence. However, analysis of this new sequence revealed an in-frame stop codon 3 bp upstream of the original sequence, confirming that the complete ORF had in fact already been obtained. Nevertheless, the start point for transcription was studied further using the GeneRacer method, and a further eight clones were sequenced. In all cases the in-frame stop codon was apparent, and in no case was a longer transcript detected. Indeed, the commonest transcription start was at base 15 of the sequence obtained by anchored PCR (Fig. 1) described above. Thus, the full length transcript obtained from the cDNA library contained 2291 nucleotides, consisting of an ORF of 1029 bp, with a 72 bp 5 UTR and a 1190 bp 3 UTR, followed by an 18 bp poly(A) tail (Fig. 1). A polyadenylation signal was present 15 bp upstream (nucleotide 2276) from the polyA tail, with three additional putative polyadenylation sites beginning at nucleotide 1281, 1353 and 2148. The coding region showed 44–46% identity to mammalian
C genes (Table 2).

Fig. 1. Compiled full length sequence of the rainbow trout
C cDNA sequence. The start and stop codons and the putative polyadenylation signals are in bold, and the predicted signal peptide, transmembrane region and potential glycosylation sites are in italics and bold. The W-S-X-W-S motif and cytokine receptor family signature are boxed.

238

T. WANG AND C. J. SECOMBES

Species

Nucleotide identity

Amino acid similarity

Amino acid identity

Human Mouse Dog Cow

45·7% 44·8% 43·9% 44·9%

34·7% 40·1% 35·0% 35·6%

28·2% 30·0% 27·8% 27·9%

3000 (a) 2000 1000 0 –1000 –2000 –3000 –4000 –5000 0 50 100 150 200 250 300 350 400 Residue

Score

Score

Table 2. Homology of rainbow trout
C molecule with other known
C sequences in the coding region

3000 (b) 2000 1000 0 –1000 –2000 –3000 –4000 –5000 0 50 100 150 200 250 300 350 Residue

Fig. 2. TMpred plots of (a) human and (b) rainbow trout
C sequences. Positive values denote predicted membrane-spanning domains. Note the predicted signal peptide at the amino-terminus and the predicted transmembrane domain towards the carboxyterminus.

The ORF translated into a 343 amino acid protein, with some 28–30% amino acid identity and 35–40% amino acid similarity to the coding region of mammalian sequences (Table 2). The predicted molecular weight was 39·5 kDa. The SignalP programme predicted a 19 amino acid signal peptide, and this hydrophobic region was also very apparent in plots to predict membrane-spanning regions of the molecule (Fig. 2). A second membranespanning region was also readily identified, representing the transmembrane domain of the receptor, from amino acids 226–245. This predicted a 206 amino acid extracellular domain and a 98 amino acid intracellular domain in the trout molecule, compared with extracellular and intracellular domains of 229–243 and 83–91 amino acids in mammals, respectively. Five potential glycosylation sites were also apparent in the extracellular domain compared with three–five sites in the known mammalian sequences (Fig. 1). The W-S-X-W-S motif, typical of haemopoietin receptors, was present just upstream of the transmembrane domain and the growth factor and cytokine receptor family signature was present at the 5 end of the extracellular domain (i.e. C-[LVFYR]-X7–8-[STIVDN]-C-X-W). Multiple alignment of the trout
C amino acid sequence with other known (mammalian) sequences revealed the absolute conservation of six cysteines, the first four of which are typical of class I cytokine receptors, and the W-S-X-W-S domain (Fig. 3). These four cysteines, which form two pairs of disulphide bridges, have a signature of C-X9–10-C-X-W-X26–32-C-X10–15-C (Ga#en et al., 1998), and the trout sequence of C-X9-C-X-W-X24-C-X12-C conformed very

Fig. 3. Multiple alignment of the predicted translation of rainbow trout
C with known mammalian sequences. Identical (*) and similar (. or :) residues identified by the CLUSTAL programme are indicated. Conserved extracellular cysteines, mammalian intracellular tyrosine residues and potential glycosylation sites are in bold, and the transmembrane domain and W-S-X-W-S motif are boxed.

240

T. WANG AND C. J. SECOMBES

M

C

Brain

Liver

Blood

Spleen

1

1

1

1

2

2

2

2

Gill 1

2

Kidney 1

2

γC

(a)

28 Cycles

(b)

GAPDH 30 Cycles

Fig. 4. Analysis of expression of the
C transcript in tissues from two rainbow trout (1,2). RT-PCR was performed with cDNA from di#erent tissues with (a) primers for
C and (b) primers for GAPDH, as a positive control. M=100 bp molecular weight marker (Pharmacia-Biotech) and C=no template control.

closely to this. In addition, two of the potential glycosylation sites were conserved, with a third adjacent to a potential glycosylation site in the mammalian sequence. One of the most interesting di#erences between the trout and mammalian sequences was seen in the intracellular domain, where the four tyrosine residues typical of the intracellular domains of type I cytokine receptors (absolutely conserved in the mammalian sequences, Fig. 3) are entirely lacking. EXPRESSION STUDIES

RT-PCR performed with cDNA from a range of trout tissues revealed a wide tissue distribution of the
C transcript, with strong products detectable with blood, spleen, gill and kidney, and weaker products with brain and liver (Fig. 4). In unstimulated macrophage cultures low levels of
C transcript were detectable by RT-PCR (Fig. 5), as seen using 21 cycles but not 18 cycles for PCR. Stimulation of the cells with rIL-1 or LPS clearly increased expression of the gene under both protocols. With RTG cells, even lower levels of
C transcript were expressed (i.e. only detectable using 28 cycles and above) but again stimulation with rIL-1 resulted in a clear increase in transcript level. In contrast to macrophage cultures, stimulation of RTG cells with LPS had no e#ect on
C expression. IV. Discussion The conserved motifs and sequence homology in the gene cloned in this study strongly suggest that it is the rainbow trout
C. Typical of known mammalian class I cytokine receptor molecules, the trout
C contains the four conserved cysteines and the cytokine receptor family signature in the N-terminal half (approx. 100 amino acid domain) of the extracellular segment, and the W-S-X-W-S motif in the C-terminal half of the extracellular segment (Bazan, 1990). However, despite the conservation of these residues/motifs, the

CLONING AND EXPRESSION OF A GAMMA CHAIN (
C) GENE

(a) M NC T1 T2

241

(b) C

M NC T1 T2 γC 18 Cycles

C γC 28 Cycles

γC 21 Cycles

GAPDH 24 Cycles

GAPDH 24 Cycles

Fig. 5. RT-PCR detection of
C in (a) cultured trout macrophages and (b) RTG cells. Note the low level expression in unstimulated cells (lane C) and induction upon stimulation with trout recombinant IL-1 (lane T1) in both cell types, and with LPS (lane T2) in macrophage. M=100 bp molecular weight marker (Pharmacia-Biotech) and NC=negative control without DNA template.

extracellular domain of the trout gene is shorter than in mammalian
C molecules, whilst the intracellular domain is a little longer. Most interesting is the complete absence of the four conserved tyrosine residues typical of the intracellular domains. Whether this could have an impact on intracellular signalling is discussed below. Whilst the cytokines known to bind
C in mammals have not been isolated in fish to date, the existence of this key receptor implies that at least some of these molecules are present at this level of phylogeny. Constitutive expression of the putative
C was found in the various trout tissues examined, with a tendency to higher expression in lymphoid sites. This is consistent with the situation in mammals where the
C is constitutively expressed on lymphocytes, neutrophils and monocytes, albeit at a low level in the latter, and expression is relatively resistant to regulation (Nakarai et al., 1994; Girard & Beaulieu, 1997; Lin & Leonard, 1997). Indeed, the promoter lacks a classical TATA box at an appropriate distance from the start of transcription and lacks the B and CArG elements needed by the IL-2R chain for inducibility (Noguchi et al., 1993). Similarly, in the cultured cells examined trout macrophages had higher detectable
C transcript level, in that PCR products were detectable using 21 cycles v. 28 cycles for RTG cells (a fibroblast cell line). In both cell types expression could be rapidly induced following stimulation of the cells with rIL-1, and with the cultured macrophages LPS was also e#ective. The low constitutive
C levels in human monocytes can also be up-regulated, by stimulation of the cells with cytokines such as IL-2 or IFN
(Bosco et al., 1994). Signalling via the IL-2R requires both the IL-2R and
C, and a principle role of the ligand appears to be to induce dimerisation of these receptor chains (Lin & Leonard, 1997). Within the intracellular domain of the IL-2R a ‘serine-rich’ region is known to be required for Jak1 binding and a ‘prolinerich’ region containing two tyrosine residues is critical for STAT protein

242

T. WANG AND C. J. SECOMBES

docking. Another four tyrosine residues are also present, giving many potential phosphotyrosine docking sites for signalling molecules. Tyrosine residues (4) are also present in the intracellular domain of mammalian
C chains, in common with other class I cytokine receptors, and are targets for non-receptor protein tyrosine kinases following IL-2R stimulation which induces rapid tyrosine phosphorylation of many protein substrates (Ga#en et al., 1998). Stimulation via
C is known to be Jak3-dependent (Suzuki et al., 2000), and indeed
C and Jak3-deficient mice share similar phenotypes with the main exception that in Jak3
mice T and B cells express high levels of
C. However, mutation of the tyrosine residues has no impact on signalling (Goldsmith et al., 1995) in contrast to the dramatic e#ects seen with IL-2R. Thus
C is considered to be a ‘trigger’ chain that conveys Jak3 into the signalling complex, with the  chain driving the signalling cascade. Thus, whilst tyrosine residues can be a critical component of some class I cytokine receptor chains such as IL-2R, they may not be crucial for
C and perhaps this explains how the trout intracellular domain can lack the tyrosine residues and potentially be a functional component of cytokine receptor complexes in this species. Theories on the duplication of cytokine receptor genes and how new receptors can be achieved by altering only some of the components of a receptor complex (Shields et al., 1995) are currently based entirely on relationships between mammalian molecules. As more cytokine receptors are cloned and sequenced in lower vertebrates, as with this putative
C in trout, they will impact directly on such theories in addition to enabling studies on the biological e#ects of cytokine signalling within the immune systems of fish. This work was supported by a grant from BBSRC (1/S09641). Thanks go to Dr Jun Zou (Department of Zoology, University of Aberdeen) for providing the recombinant trout IL-1, to Dr Sam Martin (Department of Zoology, University of Aberdeen) for the GAPDH primers, and to Dr Kerry Laing (Department of Zoology, University of Aberdeen) for help with Fig. 2.

References Altschul, S. F., Gish, W., Miller, W., Myers, E. & Lipman, D. J. (1990). Best local alignment search tool. Journal of Molecular Biology 215, 403–410. Arima, N., Kamio, M., Imada, K., Hori, T., Hattori, T., Tsudo, M., Okuma, M. & Uchiyama, T. (1992). Pseudo-high a$nity interleukin 2 (IL-2) receptor lacks the third component that is essential for functional IL-2 binding and signaling. Journal of Experimental Medicine 176, 1265–1272. Bazan, J. F. (1990). Structural design and molecular evolution of a cytokine receptor superfamily. Proceedings of the National Academy of Sciences USA 87, 6934–6938. Bonder, C. S., Dickensheets, H. L., Finlay-Jones, J. J., Donelly, R. P. & Hart, P. H. (1998). Involvement of the IL-2 receptor
-chain (
c) in the control by IL-4 of human monocyte and macrophage proinflammatory mediator production. Journal of Immunology 160, 4048–4056. Bonder, C. S., Finlay-Jones, J. J. & Hart, P. H. (1999). Interleukin-4 regulation of human monocyte and macrophage interleukin-10 and interleukin-12 production. Role of a functional interleukin-2 receptor
-chain. Immunology 96, 529–536. Bosco, M. C., Espinoza-Delgado, I., Schwabe, M., Russell, S. M., Leonard, W. J., Longo, D. L. & Varesio, L. (1994). The
subunit of the interleukin-2 receptor is expressed in human monocytes and modulated by interleukin-2, interferon
and transforming growth factor 1. Blood 83, 3462–3467.

CLONING AND EXPRESSION OF A GAMMA CHAIN (
C) GENE

243

Daniels, G. D., Zou, J., Charlemagne, J., Partula, S., Cunningham, C. & Secombes, C. J. (1999). Cloning of two chemokine receptor homologs (CXC-R4 and CC-R7) in rainbow trout Oncorhynchus mykiss. Journal of Leukocyte Biology 65, 684– 690. DiSanto, J. P., Rieux-Laucat, F., Dautry-Varsat, A., Fischer, A., De Saint Basile, G. (1994). Defective human interleukin 2 receptor gamma chain in an atypical X chromosome-linked severe combined immunodeficiency with peripheral T cells. Proceedings of the National Academy of Sciences USA 91, 9466–9470. Fujiki, K., Shin, D.-H., Nakao, M. & Yano, T. (1999). Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemokine receptors, allograft inflammatory factor-1 and natural killer cell enhancing factor by use of suppression subtractive hybridization. Immunogenetics 49, 909–914. Ga#an, S. L., Goldsmith, M. A. & Greene, W. C. (1998). Interleukin-2 and the interleukin-2 receptor. In The Cytokine Handbook, 3rd Edition (A. Thomson, eds) pp. 73–103. London: Academic Press. Girard, D. & Beaulieu, A. D. (1997). Absence of the IL-7 receptor component Cdw127 indicates that
C expression alone is insu$cient for IL-7 to modulate human neutrophil responses. Clinical Immunology and Immunopathology 83, 264–271. Goldsmith, M. A., Lai, S. Y., Xu, W., Amaral, M. C., Kuczek, E. S., Parent, L. J., Mills, G. B., Tarr, K. L., Longmore, G. D. & Greene, W. C. (1995). Growth signal transduction by the human interleukin-2 receptor requires cytoplasmic tyrosines of the  chain and non-tyrosine residues of the
c chain. Journal of Biological Chemistry 270, 21729–21737. Guida, S., Heguy, A. & Melli, M. (1992). The chicken IL-1 receptor: di#erential evolution of the cytoplasmic and extracellular domains. Gene 111, 239–243. Hardie, L. J., Laing, K. J., Daniels, G. D., Grabowski, P. S., Cunningham, C. & Secombes, C. J. (1998). Isolation of the first piscine transforming growth factor  gene: analysis reveals tissue specific expression and a potential regulatory sequence in rainbow trout (Oncorhynchus mykiss). Cytokine 10, 555–563. Hofmann, K. & Sto#el, W. (1993). TMbase—A database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler 347, 166. How, G.-F., Venkatesh, B. & Brenner, S. (1996). Conserved linkage between the pu#er fish (Fugu rubripes) and human genes for platelet-derived growth factor receptor and macrophage colony-stimulating factor receptor. Genome Research 6, 1185–1191. Lee, T.-H. & Tempelis, C. H. (1992). Possible 110 kDa receptor for interleukin 2 in the chicken. Developmental and Comparative Immunology 16, 463–472. Lin, J.-X. & Leonard, W. J. (1997). Signaling from the IL-2 receptor to the nucleus. Cytokine & Growth Factor Reviews 8, 313–332. Malek, T. R., Porter, B. O. & He, Y.-W. (1999). Multiple
c-dependent cytokines regulate T-cell development. Immunology Today 20, 71–76. Malissen, M., Pereira, P., Gerber, D. J., Malissen, B. & DiSanto, P. (1997). The common cytokine receptor
chain controls survival of
/ T cells. Journal of Experimental Medicine 186, 1277–1285. Moepps, B., Knopfle, K., Braun, M., Knochel, W. & Gierschik, P. (1998). Molecular cloning mRNA expression pattern and function expression of the Xenopus laevis CXC chemokine receptor 4. Naunyn-Schmiedebergs Archives of Pharmacology 357, 207. Murata, T., Obiri, N. I., Debinski, W. & Puri, R. K. (1997). Structure of IL-13 receptor: Analysis of subunit composition in cancer and immune cells. Biochemica Biophysica Research Communication 238, 90–94. Nakajima, H. H., Noguchi, M. M. & Leonard, W. J. (2000). Role of the common cytokine receptor
chain (
c) in thymocyte selection. Immunology Today 21, 88–94. Nakarai, T., Robertson, M. J., Streuli, M., Wu, Z. N., Ciardelli, T. l., Smith, K. A. & Ritz, J. (1994). Interleukin 2 receptor gamma chain expression on resting and activated lymphoid cells. Journal of Experimental Medicine 180, 241–251.

244

T. WANG AND C. J. SECOMBES

Nam, B.-H., Yamamoto, E., Hirono, I. & Aoki, T. (2000). A survey of expressed genes in the leukocytes of Japanese flounder, Paralichthys olivaceus, infected with Hirame rhabdovirus. Developmental and Comparative Immunology 24, 13–24. Needleman, S. B. & Wunsch, C. D. (1970). A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 48, 443–453. Nicola, N. A. (1994). Guidebook to cytokines and their receptors. Oxford: Sambrooke & Tooze. Nielsen, E., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 1–6. Noguchi, M., Adelstein, S., Cao, X. & Leonard, W. J. (1993). Characterization of the human interleukin-2 receptor
chain gene. Journal of Biological Chemistry 268, 13601–13608. Pearson, W. R. & Lipman, D. I. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences USA 85, 2444–2448. Secombes, C. J. (1990). Isolation of salmonid macrophages and analysis of their killing activity. In Techniques in Fish Immunology (J. S. Stolen, T. C. Fletcher, D. P. Anderson, B. S. Roberson & W. B. van Muiswinkel, eds) pp. 137–154. New Jersey: SOS Publications. Secombes, C. J. (1998). Phylogeny of cytokines. In The Cytokine Handbook, 3rd edition (A. Thomson, eds) pp. 953–993. London: Academic Press. Secombes, C. J., Bird, S., Hong, S., Laing, K. J. & Zou, J. (2000). Phylogeny of vertebrate cytokines. In FASEB summer research conference on Phylogenetic perspectives on the vertebrate immune system. Copper Mountain, July 1999. pp. 89–94. Shields, D. C., Harmon, D. L., Nunez, F. & Whitehead, A. S. (1995). The evolution of haematopoietic cytokine/receptor complexes. Cytokine 7, 679–688. Sprang, S. R. & Bazan, J. F. (1993). Cytokine structural taxonomy and mechanisms of receptor engagement. Current Biology 3, 815–827. Suzuki, K., Nakajima, H., Saito, Y., Saito, T., Leonard, W. J. & Iwamoto, I. (2000). Janus kinase 3 (Jak3) is essential for common cytokine receptor
chain (
c)-dependent signaling: comparative analysis of
c, Jak3, and
c and Jak3 double-deficient mice. International Immunology 12, 123–132. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Ting, S. S., Leigh, D., Lindeman, T. & Ziegler, J. B. (1999). Identification of X-linked severe combined immunodeficiency by mutation analysis of blood and hair roots. British Journal of Haematology 106, 190–194. Vandebriel, R. J., Meredith, C., Scott, M. P., Roholl, P. J. M. & Van Loveren, H. (1998). E#ects of in vivo exposure to bis(tri-n-butyltin)oxide, hexachlorobenzene, and benzo(a)pyrene on cytokine (receptor) mRNA levels in cultured rat splenocytes and on IL-2 receptor protein levels. Toxicology and Applied Pharmacology 148, 126–136. Vilcek, J. (1998). The cytokines: An overview. In The Cytokine Handbook, 3rd edition (A. Thomson, eds) pp. 1–20. London: Academic Press. Waldmann, T. A. (1993). The IL-2/IL-2 receptor system: A target for rational immune intervention. Immunology Today 14, 264–270. Wolf, K. & Quimby, M. C. (1962). Established eurythermic lines of fish cells in vitro. Science 135, 1065–1066. Yasuda, K., Nemoto, T., Ohashi, Y., Satomi, S., Murata, K., Ishii, N., Takeshita, T. & Sugamura, K. (1998). Prolongation of allograft survival by administration of mAb specific for the three subunits of IL-2 receptor. International Immunology 10, 561–567.