- Email: [email protected]
Cloning and expression of ATP N-glycosidase from the freshwater sponge Ephydatia muelleri
Biochimie 158 (2019) 126e129
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Short communication
Cloning and expression of ATP N-glycosidase from the freshwater sponge Ephydatia muelleri ~ nu Reintamm, Kerli Vallmann, Kaidi Kolk, Mailis Pa €ri, Annika Lopp, Nele Aas-Valleriani, To * Merike Kelve Department of Chemistry and Biotechnology, Division of Gene Technology, Tallinn University of Technology, Akadeemia tee 15, Tallinn, 12618, Estonia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 October 2018 Accepted 27 December 2018 Available online 29 December 2018
Previously we had discovered unusual enzymatic activity in the marine sponge Axinella polypoides, ATP N-glycosidase (Reintamm et al., 2003). We show here that the Ephydatia muelleri mRNA encoding protein with PNP_UDP_1 (phosphorylase superfamily) signature is the secreted ATP N-glycosidase. The functionality of the protein was established by recombinant expression in Pichia pastoris. In addition to the enzymatic domain, the full-length protein contains the N-terminal cysteine-rich domain belonging to the subfamily SCP_HrTT-1 (cd05559) of the SCP (sperm coating protein) superfamily (cl00133). © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: ATP N-Glycosidase PNP_UDP_1 domain Porifera Ephydatia muelleri Pichia pastoris expression system
1. Introduction While studying the nucleotide metabolism in sponges (Porifera), the phylogenetically lowest multicellular animals, we have found two novel enzymatic activities. These are the ATP N-glycosidase in Axinella polypoides [1] and the endo-2ʹ,5ʹ-ribonuclease in Tethya aurantium [2]. The 2ʹ,5ʹ-oligoadenylate degrading activity of the latter is also present in the oyster Crassostrea gigas, where we recently identified the genes which encode the proteins having this activity [3]. ATP N-glycosidase has a surprising enzymatic activity as it hydrolyses the high-energy nucleotide, ATP, into a nucleobase without touching the energy-charge carrying triphosphate moiety. ATP Nglycosidase from A. polypoides is capable of releasing adenine from a wide range of substrates containing the adenosine 50 -diphosphoryl fragment [1]. The protein having this enzymatic activity could be classified to the superfamily of nucleoside phosphorylases/hydrolases. When analyzing the draft genome of the marine sponge Amphimedon queenslandica [4] we found a frequent and/or divergent motif with a nucleoside phosphorylase/hydrolase signature. Its best matches in the NCBI protein database were bacterial proteins with predicted MTA/SAH enzymatic activity. MTA/SAH nucleosidase (methylthioadenosine/S-adenosylhomocysteine nucleosidase,
* Corresponding author. E-mail address: [email protected] (M. Kelve).
EC:3.2.2.9) recycles adenine and methionine through S-adenosylmethionine (SAM)-mediated methylation reactions. Our bioinformatical analysis revealed that a similar protein could be coded by the EST sequence AM760456 from the freshwater sponge Ephydatia muelleri, where we had previously demonstrated ATP Nglycosidase activity [5]. On the basis of this EST we elucidated the primary structure of the protein and the corresponding gene. ATP N-glycosidase activity was proven by the recombinant expression of the full-length transcript in Pichia pastoris. 2. Materials and methods 2.1. Sponge samples The sample of the freshwater sponge E. muelleri (Porifera, Demospongiae, Spongillida, Spongillidae, Ephydatia) was collected ~ handu River, Estonia. Juvenile sponges were grown from from Vo gemmules [6] and cells were isolated as previously described [7]. 2.2. Extraction of RNA and DNA The RNA was extracted from sponge cells using TRIzol® reagent (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. The integrity of the RNA was evaluated using the formaldehyde-agarose gel electrophoresis method. The sponge genomic DNA was extracted as described in our previous work [8].
https://doi.org/10.1016/j.biochi.2018.12.018 0300-9084/© 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
T. Reintamm et al. / Biochimie 158 (2019) 126e129
2.3. Bioinformatical search for candidate proteins The draft genome of A. queenslandica [4] was screened for the common motifs of nucleoside phosphorylase I and purine nucleoside hydrolase families using standalone blast searches. The matches from the screening were individually assembled and evaluated using BioEdit and MS Excel programs. Sequences with homologies to known proteins were disregarded. 34 sequences had the utmost similarity to 50 -methylthioadenosine/S-adenosyl-homocysteine nucleosidase (MTA/SAH nucleosidase) from E. coli. They were grouped into three subgroups and multiple sequence alignments for every subgroup were made using Clustal W program. All three consensus sequences were used to search EST sequences of Ephydatia muelleri in the NCBI database (1698 sequences), which resulted in a single sequence (Clone ID: IL0ACA4YD09RM1/EST name: AM760456).
127
(2% peptone, 1% yeast extract, 100 mM potassium phosphate pH 6.0, 1.34% Yeast Nitrogen Base (w/o AA), 0.4 mg/ml biotin, 1% glycerol) at 28 C for 24 h. The yeast cells (250 OD600) were re-suspended in 250 ml BGMY and the protein expression was induced by 1 ml methanol. The culture was grown for 96 h at 20 C with vigorous shaking at 250 rpm. 100% methanol was added daily to the concentration of 0.5%. 1 ml culture aliquots were taken daily, OD600 values were measured, cells were pelleted by centrifugation and adenine was quantified in the supernatant. At the end of the expression the cells were removed by centrifugation and the growth medium was concentrated 100 x on a Amicon Ultra100K filtration device. The concentrate containing most of secreted ATP N-glycosidase activity was washed twice with size exclusion buffer (see below). For short-term storage (up to 2 weeks), the concentrate was kept at 4 C. 2.7. Size exclusion chromatography
2.4. Primers The sequences of the PCR primers were (5‘/3’): L8: GCGCCAG ACAATGAGGAT; L305: TGCTGTGTCGCAGTGGTT; L461: GCTGCGT GGAACACTGCT; L569: TCAATGCCTGGATAGCCT; L702: GTGATGTTG GAGAAGCATCC; L1019: TAACGCTCAGGCCATTATCGGAGT; R322: AACCACTGCGACACAGCA; R479: AAGCAGTGTTCCACGCAG; R586: AGGCTATCCAGGCATTGA; R720: GATGCTTCTCCAACATCACTT; R1370: CATTTCACCACCTATAGCTTCGGG; R1721: GCAATGTCAAG AAACTAACACACT; R1816: ATTAATTCAGCAGCAGCAGC; L18NcoI: TTCCATGGGGATATACGCGGCT; R1637SalI: ATTGTCGACTTCAAATTC CCTGTTGAC; EcoRI_L: TAAGAATTCAAAATGTCTAGGATATACGCGG CT; 6xHisEcoRI_R: TAAGAATTCTCAATGGTGGTGGTGGTG GTGCTC. 2.5. Determination of mRNA and gene sequences The full-length mRNA sequence was determined by using the FirstChoice® RLM-RACE Kit (Ambion®, Thermo Fisher Scientific) according to the manufacturer's protocol. The E. muelleri RNA was used as a template; the PCR primer sequences were designed on the basis of the EST AM760456. The primer L1019 was used for 3‘-RACE amplification and the primer R1370 was used for 5‘-RACE amplification in combination with RACE adapter specific primers. Obtained PCR products were identified either by direct sequencing or after cloning. The full-length mRNA sequence was used to design additional primers for determination of the gene structure. Successfully amplified fragments were subjected to direct sequencing. The full-length gene sequences (allele a and b) were assembled using the obtained fragments. 2.6. Expression of the recombinant protein in Pichia pastoris cDNA was amplified using the primers L18NcoI and R1637SalI. The obtained amplicon was treated with NcoI/SalI restrictases and inserted into the bacterial expression vector pET-24d (Novagen®) treated with NcoI/XbaI restrictases. For the expression in the yeast system, the Pichia Expression Kit (Life Technologies®, Thermo Fisher Scientific) was used according to the manufacturer's protocol. The insert from pET-24d was adapted for the expression in PHIL-D2 EcoRI site by using the PCR primers EcoRI_L and 6xHisEcoRI_R. The CDS sequence of the expression construct was deposited in the GenBank (accession No. MK040442). PHILD2, carrying the insert in the proper orientation, was linearized by SalI restrictase and transformed into the Pichia strain GS115 by electroporation (5.0 ms, 1979 V). The transformants were selected on Minimal Dextrose (MD) plates. The presence of the insert in the yeast genome was verified by colony PCR with the primers L702 and 6xHisEcoRI_R. A single colony was grown in 30 ml BGMY medium
200 ml of the concentrated growth media was loaded onto a BioSep SEC-s3000 column (300 7.8 mm, 5 mm, Phenomenex) and eluted with 50 mM Na2HPO4, pH 6, 150 mM NaCl at the flow rate of 1 ml/min. 2.8. ATP N-glycosidase assays The ATP N-glycosidase assays were performed as described earlier [1], except for the reaction temperature (25 C) because of the thermal instability of E. muelleri enzyme. 3. Results and discussion 3.1. The primary and gene structures of the novel protein from E. muelleri The experimentally determined length of the mRNA corresponding to the EST AM760456 is 1827 bp and it encodes the protein of 540 amino acids. No alternative transcripts were detected (based on the results of the 5‘-RACE experiment and the combination of L8 and oligo(T) primers). Thus, the EST sequence AM760456 is only the C-terminal fragment of the full-length transcript and it starts from the mRNA position 798 bp. The results of the NCBI Protein BLAST/CD search revealed that the protein (GenBank accession number MK040442) contains two domains: cl00303 (PNP_UDP_1 superfamily) in positions 303e510 (the most conserved motif EME in positions 450e452) and cl00133 (SCP superfamily) in positions 25e159. No proteins having this domain combination were found in any protein database. The best hits to the PNP_UDP_1 domain included the proteins from A. queenslandica (XP_019858343.1 and XP_019861886.1) and from cyanobacteria (WP_075902040.1 and WP_027844486.1). The best hits to the SCP domain included the proteins from Crassostrea gigas (XP_011422870.1) and Homo sapiens (XP_005248974.1). These proteins together with the protein from E. muelleri belong to the subfamily SCP_HrTT-1 (cd05559) of the SCP superfamily (cl00133). The first amino acids in our sequence may present a secretion signal similarly to other proteins of this subfamily [9,10]. To elucidate whether the transcript belongs to the sponge or to any of its symbionts, the gene structure was determined. The fulllength annotated gene sequences were deposited in the GenBank under the accession numbers MK040440 and MK040441. As shown in Fig. 1A, the gene consists of six exons indicating the eukaryotic origin of the gene. The PNP_UDP domain localizes in the longest exon (E5). The SCP domain is split into four exons. Fig. 1B indicates the metazoan origin of the gene. This is demonstrated by the similarity of the genomic structure of the novel E. muelleri protein
128
T. Reintamm et al. / Biochimie 158 (2019) 126e129
Fig. 1. The genomic structure of the novel protein from E. muelleri. (A) The primer combinations and the amplified DNA fragments. (B) The genomic structure of the novel protein from E. muelleri is similar to that of another member of the SCP superfamily, the human protein PI16 (NP_699201.2). The numbers on the introns mark the intron phases. Conserved cystein residues are marked in red. The possible secretion signal is marked in green.
with that of another SCP_HrTT-1 family member, the human PI16 protein. The SCP domain is divided between four exons in both proteins, and the intron positions and phases are the same. However, the longest exon in the human protein has no similarity to the AM760456 sequence from E. muelleri or generally to the PNP_UDP signature. 3.2. The novel protein is the ATP N-glycosidase As the preliminary expression of the construct in the bacterial system had been unsuccessful, we expressed the recombinant protein in Pichia pastoris. This expression system is capable of producing extracellular proteins using their native signal sequences [11]. Another advantage is that Pichia pastoris secretes only a limited number of endogenous proteins [12]. We did not find any ATP modifying activities in the growth medium of untransformed P. pastoris, which could influence the assays of the ATP N-glycosidase activity; neither was adenine detected. The control experiments also showed no adenine in media of transformed P. pastoris GS115 cells, where either the empty vector was used (mock control) or the expression of the recombinant protein had not been induced. To perform the ATP N-glycosidase activity assays, the expressed recombinant protein from the growth medium was concentrated and low-molecular compounds, including accumulated adenine (the concentration 0.17 mM at the end of 96 h expression at 20 C), were eliminated by diafiltration using the 100 kDa cut-off filter device. The enzymatic activity retained almost completely in the
>100 kDa fraction. The ATP N-glycosidase activity was characterised by the rate of the hydrolysis of ATP into adenine, which was approximately 0.3 mM/h in the culture medium at 25 C (Fig. 2A). Notably, the extracellular activity of the ATP N-glycosidase was observed also in case of E. muelleri, which was grown in vitro (data not shown). In size-exclusion chromatography, the enzymatic activity was eluted immediately after the void volume (Fig. 2B). These results indicated the multimeric nature of the protein. According to the calculated MW (56.8 kDa), the protein should consist of at least three monomers. The enzymatic assays with the external ATP as a substrate unambiguously showed that the investigated protein had ATP Nglycosidase activity. Except for adenine, no (intermediate) products (ADP, AMP, Ado etc.) were detected in HPLC analysis (Fig. 2A). Accordingly, the protein under investigation is the enzymatic analogue of the ATP N-glycosidase from A. polypoides whose enzymatic activity has been analysed in detail [1]. As the result of the present study, the PNP_UDP_1 superfamily has gained a new member, ATP N-glycosidase. This hydrolase acts on the N-glycosidic bond in the ATP molecule preferring the adenylates of high-energy charge to those of the salvage pathway, AMP and adenosine. Differently from the ATP N-glycosidase of A. polypoides, the enzyme from E. muelleri seems to be quite unstable. The instability of the ATP N-glycosidase was observed already in natural E. muelleri extracts (data not shown). Residual ATP N-glycosidase activity was detected when the recombinant protein was expressed at the recommended temperature, 30 C (while the amount of adenine
Fig. 2. (A) The reverse-phase HPLC analysis of the ATP N-glycosidase assay of the recombinant P. pastoris culture media >100 KDa concentrate. 10 ml aliquots of the assay mixture (containing enzyme preparation in 1:100 dilution) were taken at definite time points. 1 eATP (the substrate), 2 e ADP, 3 - adenine. Note that ADP present in the substrate stock solution remains constant. (B) The size-exclusion HPLC profile of the recombinant P. pastoris culture media >100 KDa concentrate. 250 ml fractions were assayed for ATP Nglycosidase activity. Red line e P. pastoris culture medium with expressed recombinant protein, blue line e negative control (P. pastoris transformed with empty pHILD2 vector). The arrows correspond to the void volume of system (1), bovine serum albumin (BSA) dimer (2) and BSA monomer (3). The ATP N-glycosidase activity (black line) is normalized to the most active fraction.
T. Reintamm et al. / Biochimie 158 (2019) 126e129
accumulated in the medium was similar to that at 20 C). The expression at 20 C resulted in the preparation with high enzymatic activity, which was stable at 4 C for several weeks. However, a freezing/thawing cycle led to partial or complete activity loss. The enzymatic assays at 25 C showed that in the presence of substrate the enzymatic activity remained constant for at least 4 h. However, when the recombinant protein was exposed to 30 C prior to the addition of the substrate, a rapid and irreversible decrease of enzymatic activity occurred (the half-decay was approximately 6 h). Attempts to purify the recombinant protein through its C-terminal His-tag were unsuccessful: the anti-His antibody reactivity and the enzymatic activity did not correlate. The reasons of the protein instability (precipitation, thermal denaturation (auto?) proteolytic cleavage etc.), need further investigation.
[2]
[3]
[4]
[5]
[6] [7]
4. Conclusions [8]
The multi-domain protein from E. muelleri with PNP_UDP_1 and SCP signatures is the first ATP N-glycosidase whose primary structure was determined. The native N-terminus of the protein is suitable for secretion in Pichia pastoris expression system. Due to its low stability the enzyme has to be expressed at 20 C.
[10]
Acknowledgements
[11]
We are grateful to Nicholas Gathergood for linguistic help with the manuscript. This work was supported by the EC Marie Curie Actions ITN Project No. 607786 BluePharmTrain and the Estonian Science Foundation grant No. 9185. References [1] T. Reintamm, A. Lopp, A. Kuusksalu, T. Pehk, M. Kelve, ATP N-glycosidase - a
[9]
[12]
129
novel ATP-converting activity from a marine sponge Axinella polypoides, Eur. J. Biochem. 270 (2003) 4122e4132. A. Lopp, T. Reintamm, A. Kuusksalu, S. De Rosa, M. Kelve, A novel endoribonuclease from the marine sponge Tethya aurantium specific to 2',5'-phosphodiester bonds, Biochimie 94 (2012) 1635e1646. A. Lopp, T. Reintamm, A. Kuusksalu, A. Olspert, M. Kelve, Identification of a Novel Member of 2H Phosphoesterases, 2ʹ,5ʹ- Oligoadenylate Degrading Ribonuclease from the Oyster Crassostrea gigas, Biochimie 156 (2019) 181e195 . M. Srivastava, O. Simakov, J. Chapman, et al., The Amphimedon queenslandica genome and the evolution of animal complexity, Nature 466 (2010) 720e726, https://doi.org/10.1038/nature09201. M. Kelve, A. Lopp, T. Reintamm, A. Kuusksalu, G. Van de Vyver, E. RichelleMaurer, Freshwater sponge cell cultures as model systems for biochemical pathways present in marine sponges, in: Aquaculture Europe 2004 Conference “Biotechnologies for Quality”, European Aquaculture Society, Special Publication, Barcelona, Spain, 2004, pp. 459e460, https://doi.org/10.13140/ RG.2.2.18907.21288. Oct. 20-23, 2004. ponges d'eau douce en milieu conR. Rasmont, Une technique de culture d'e ^ le , Ann. Soc. R. Zool. Belg. 91 (1961) 147e156. tro D. De Sutter, G. Van de Vyver, Aggregative properties of different cell types of the fresh-water sponge Ephydatia fluviatilis isolated on ficoll gradients, Wilhelm Roux’s Arch. 183 (1977) 151e161. €ri, V. Mikli, E. Richelle-Maurer, A. Lopp, T. Reintamm, K. Vallmann, M. Pa M. Kelve, Molecular identification, characterization and distribution of freshwater sponges (Porifera: Spongillidae) in Estonia. Fundamental and Applied Limnology, Arch. Hydrobiol. 168 (2007) 93e103. K. Hotta, H. Takahashi, N. Satoh, Expression of an ascidian gene in the tip of the tail of tail-bud-stage embryos, Dev. Gene. Evol. 3 (1998) 164e167. R. Frost, S. Engelhardt, A secretion trap screen in yeast identifies protease inhibitor 16 as a novel antihypertrophic protein secreted from the heart, Circulation 116 (2007) 1768e1775. E. Ciplys, E. Zitkus, L.I. Gold, J. Daubriac, S.C. Pavlides, P. Højrup, G. Houen, W.A. Wang, M. Michalak, R. Slibinskas, High-level secretion of native recombinant human calreticulin in yeast, Microb. Cell Factories 14 (2015) 165, https://doi.org/10.1186/s12934-015-0356-8. C.J. Huang, L.M. Damasceno, K.A. Anderson, S. Zhang, L.J. Old, C.A. Batt, A proteomic analysis of the Pichia pastoris secretome in methanol-induced cultures, Appl. Microbiol. Biotechnol. 90 (2011) 235e247, https://doi.org/ 10.1007/s00253-011-3118-5.
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Short communication
Cloning and expression of ATP N-glycosidase from the freshwater sponge Ephydatia muelleri ~ nu Reintamm, Kerli Vallmann, Kaidi Kolk, Mailis Pa €ri, Annika Lopp, Nele Aas-Valleriani, To * Merike Kelve Department of Chemistry and Biotechnology, Division of Gene Technology, Tallinn University of Technology, Akadeemia tee 15, Tallinn, 12618, Estonia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 October 2018 Accepted 27 December 2018 Available online 29 December 2018
Previously we had discovered unusual enzymatic activity in the marine sponge Axinella polypoides, ATP N-glycosidase (Reintamm et al., 2003). We show here that the Ephydatia muelleri mRNA encoding protein with PNP_UDP_1 (phosphorylase superfamily) signature is the secreted ATP N-glycosidase. The functionality of the protein was established by recombinant expression in Pichia pastoris. In addition to the enzymatic domain, the full-length protein contains the N-terminal cysteine-rich domain belonging to the subfamily SCP_HrTT-1 (cd05559) of the SCP (sperm coating protein) superfamily (cl00133). © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: ATP N-Glycosidase PNP_UDP_1 domain Porifera Ephydatia muelleri Pichia pastoris expression system
1. Introduction While studying the nucleotide metabolism in sponges (Porifera), the phylogenetically lowest multicellular animals, we have found two novel enzymatic activities. These are the ATP N-glycosidase in Axinella polypoides [1] and the endo-2ʹ,5ʹ-ribonuclease in Tethya aurantium [2]. The 2ʹ,5ʹ-oligoadenylate degrading activity of the latter is also present in the oyster Crassostrea gigas, where we recently identified the genes which encode the proteins having this activity [3]. ATP N-glycosidase has a surprising enzymatic activity as it hydrolyses the high-energy nucleotide, ATP, into a nucleobase without touching the energy-charge carrying triphosphate moiety. ATP Nglycosidase from A. polypoides is capable of releasing adenine from a wide range of substrates containing the adenosine 50 -diphosphoryl fragment [1]. The protein having this enzymatic activity could be classified to the superfamily of nucleoside phosphorylases/hydrolases. When analyzing the draft genome of the marine sponge Amphimedon queenslandica [4] we found a frequent and/or divergent motif with a nucleoside phosphorylase/hydrolase signature. Its best matches in the NCBI protein database were bacterial proteins with predicted MTA/SAH enzymatic activity. MTA/SAH nucleosidase (methylthioadenosine/S-adenosylhomocysteine nucleosidase,
* Corresponding author. E-mail address: [email protected] (M. Kelve).
EC:3.2.2.9) recycles adenine and methionine through S-adenosylmethionine (SAM)-mediated methylation reactions. Our bioinformatical analysis revealed that a similar protein could be coded by the EST sequence AM760456 from the freshwater sponge Ephydatia muelleri, where we had previously demonstrated ATP Nglycosidase activity [5]. On the basis of this EST we elucidated the primary structure of the protein and the corresponding gene. ATP N-glycosidase activity was proven by the recombinant expression of the full-length transcript in Pichia pastoris. 2. Materials and methods 2.1. Sponge samples The sample of the freshwater sponge E. muelleri (Porifera, Demospongiae, Spongillida, Spongillidae, Ephydatia) was collected ~ handu River, Estonia. Juvenile sponges were grown from from Vo gemmules [6] and cells were isolated as previously described [7]. 2.2. Extraction of RNA and DNA The RNA was extracted from sponge cells using TRIzol® reagent (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. The integrity of the RNA was evaluated using the formaldehyde-agarose gel electrophoresis method. The sponge genomic DNA was extracted as described in our previous work [8].
https://doi.org/10.1016/j.biochi.2018.12.018 0300-9084/© 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
T. Reintamm et al. / Biochimie 158 (2019) 126e129
2.3. Bioinformatical search for candidate proteins The draft genome of A. queenslandica [4] was screened for the common motifs of nucleoside phosphorylase I and purine nucleoside hydrolase families using standalone blast searches. The matches from the screening were individually assembled and evaluated using BioEdit and MS Excel programs. Sequences with homologies to known proteins were disregarded. 34 sequences had the utmost similarity to 50 -methylthioadenosine/S-adenosyl-homocysteine nucleosidase (MTA/SAH nucleosidase) from E. coli. They were grouped into three subgroups and multiple sequence alignments for every subgroup were made using Clustal W program. All three consensus sequences were used to search EST sequences of Ephydatia muelleri in the NCBI database (1698 sequences), which resulted in a single sequence (Clone ID: IL0ACA4YD09RM1/EST name: AM760456).
127
(2% peptone, 1% yeast extract, 100 mM potassium phosphate pH 6.0, 1.34% Yeast Nitrogen Base (w/o AA), 0.4 mg/ml biotin, 1% glycerol) at 28 C for 24 h. The yeast cells (250 OD600) were re-suspended in 250 ml BGMY and the protein expression was induced by 1 ml methanol. The culture was grown for 96 h at 20 C with vigorous shaking at 250 rpm. 100% methanol was added daily to the concentration of 0.5%. 1 ml culture aliquots were taken daily, OD600 values were measured, cells were pelleted by centrifugation and adenine was quantified in the supernatant. At the end of the expression the cells were removed by centrifugation and the growth medium was concentrated 100 x on a Amicon Ultra100K filtration device. The concentrate containing most of secreted ATP N-glycosidase activity was washed twice with size exclusion buffer (see below). For short-term storage (up to 2 weeks), the concentrate was kept at 4 C. 2.7. Size exclusion chromatography
2.4. Primers The sequences of the PCR primers were (5‘/3’): L8: GCGCCAG ACAATGAGGAT; L305: TGCTGTGTCGCAGTGGTT; L461: GCTGCGT GGAACACTGCT; L569: TCAATGCCTGGATAGCCT; L702: GTGATGTTG GAGAAGCATCC; L1019: TAACGCTCAGGCCATTATCGGAGT; R322: AACCACTGCGACACAGCA; R479: AAGCAGTGTTCCACGCAG; R586: AGGCTATCCAGGCATTGA; R720: GATGCTTCTCCAACATCACTT; R1370: CATTTCACCACCTATAGCTTCGGG; R1721: GCAATGTCAAG AAACTAACACACT; R1816: ATTAATTCAGCAGCAGCAGC; L18NcoI: TTCCATGGGGATATACGCGGCT; R1637SalI: ATTGTCGACTTCAAATTC CCTGTTGAC; EcoRI_L: TAAGAATTCAAAATGTCTAGGATATACGCGG CT; 6xHisEcoRI_R: TAAGAATTCTCAATGGTGGTGGTGGTG GTGCTC. 2.5. Determination of mRNA and gene sequences The full-length mRNA sequence was determined by using the FirstChoice® RLM-RACE Kit (Ambion®, Thermo Fisher Scientific) according to the manufacturer's protocol. The E. muelleri RNA was used as a template; the PCR primer sequences were designed on the basis of the EST AM760456. The primer L1019 was used for 3‘-RACE amplification and the primer R1370 was used for 5‘-RACE amplification in combination with RACE adapter specific primers. Obtained PCR products were identified either by direct sequencing or after cloning. The full-length mRNA sequence was used to design additional primers for determination of the gene structure. Successfully amplified fragments were subjected to direct sequencing. The full-length gene sequences (allele a and b) were assembled using the obtained fragments. 2.6. Expression of the recombinant protein in Pichia pastoris cDNA was amplified using the primers L18NcoI and R1637SalI. The obtained amplicon was treated with NcoI/SalI restrictases and inserted into the bacterial expression vector pET-24d (Novagen®) treated with NcoI/XbaI restrictases. For the expression in the yeast system, the Pichia Expression Kit (Life Technologies®, Thermo Fisher Scientific) was used according to the manufacturer's protocol. The insert from pET-24d was adapted for the expression in PHIL-D2 EcoRI site by using the PCR primers EcoRI_L and 6xHisEcoRI_R. The CDS sequence of the expression construct was deposited in the GenBank (accession No. MK040442). PHILD2, carrying the insert in the proper orientation, was linearized by SalI restrictase and transformed into the Pichia strain GS115 by electroporation (5.0 ms, 1979 V). The transformants were selected on Minimal Dextrose (MD) plates. The presence of the insert in the yeast genome was verified by colony PCR with the primers L702 and 6xHisEcoRI_R. A single colony was grown in 30 ml BGMY medium
200 ml of the concentrated growth media was loaded onto a BioSep SEC-s3000 column (300 7.8 mm, 5 mm, Phenomenex) and eluted with 50 mM Na2HPO4, pH 6, 150 mM NaCl at the flow rate of 1 ml/min. 2.8. ATP N-glycosidase assays The ATP N-glycosidase assays were performed as described earlier [1], except for the reaction temperature (25 C) because of the thermal instability of E. muelleri enzyme. 3. Results and discussion 3.1. The primary and gene structures of the novel protein from E. muelleri The experimentally determined length of the mRNA corresponding to the EST AM760456 is 1827 bp and it encodes the protein of 540 amino acids. No alternative transcripts were detected (based on the results of the 5‘-RACE experiment and the combination of L8 and oligo(T) primers). Thus, the EST sequence AM760456 is only the C-terminal fragment of the full-length transcript and it starts from the mRNA position 798 bp. The results of the NCBI Protein BLAST/CD search revealed that the protein (GenBank accession number MK040442) contains two domains: cl00303 (PNP_UDP_1 superfamily) in positions 303e510 (the most conserved motif EME in positions 450e452) and cl00133 (SCP superfamily) in positions 25e159. No proteins having this domain combination were found in any protein database. The best hits to the PNP_UDP_1 domain included the proteins from A. queenslandica (XP_019858343.1 and XP_019861886.1) and from cyanobacteria (WP_075902040.1 and WP_027844486.1). The best hits to the SCP domain included the proteins from Crassostrea gigas (XP_011422870.1) and Homo sapiens (XP_005248974.1). These proteins together with the protein from E. muelleri belong to the subfamily SCP_HrTT-1 (cd05559) of the SCP superfamily (cl00133). The first amino acids in our sequence may present a secretion signal similarly to other proteins of this subfamily [9,10]. To elucidate whether the transcript belongs to the sponge or to any of its symbionts, the gene structure was determined. The fulllength annotated gene sequences were deposited in the GenBank under the accession numbers MK040440 and MK040441. As shown in Fig. 1A, the gene consists of six exons indicating the eukaryotic origin of the gene. The PNP_UDP domain localizes in the longest exon (E5). The SCP domain is split into four exons. Fig. 1B indicates the metazoan origin of the gene. This is demonstrated by the similarity of the genomic structure of the novel E. muelleri protein
128
T. Reintamm et al. / Biochimie 158 (2019) 126e129
Fig. 1. The genomic structure of the novel protein from E. muelleri. (A) The primer combinations and the amplified DNA fragments. (B) The genomic structure of the novel protein from E. muelleri is similar to that of another member of the SCP superfamily, the human protein PI16 (NP_699201.2). The numbers on the introns mark the intron phases. Conserved cystein residues are marked in red. The possible secretion signal is marked in green.
with that of another SCP_HrTT-1 family member, the human PI16 protein. The SCP domain is divided between four exons in both proteins, and the intron positions and phases are the same. However, the longest exon in the human protein has no similarity to the AM760456 sequence from E. muelleri or generally to the PNP_UDP signature. 3.2. The novel protein is the ATP N-glycosidase As the preliminary expression of the construct in the bacterial system had been unsuccessful, we expressed the recombinant protein in Pichia pastoris. This expression system is capable of producing extracellular proteins using their native signal sequences [11]. Another advantage is that Pichia pastoris secretes only a limited number of endogenous proteins [12]. We did not find any ATP modifying activities in the growth medium of untransformed P. pastoris, which could influence the assays of the ATP N-glycosidase activity; neither was adenine detected. The control experiments also showed no adenine in media of transformed P. pastoris GS115 cells, where either the empty vector was used (mock control) or the expression of the recombinant protein had not been induced. To perform the ATP N-glycosidase activity assays, the expressed recombinant protein from the growth medium was concentrated and low-molecular compounds, including accumulated adenine (the concentration 0.17 mM at the end of 96 h expression at 20 C), were eliminated by diafiltration using the 100 kDa cut-off filter device. The enzymatic activity retained almost completely in the
>100 kDa fraction. The ATP N-glycosidase activity was characterised by the rate of the hydrolysis of ATP into adenine, which was approximately 0.3 mM/h in the culture medium at 25 C (Fig. 2A). Notably, the extracellular activity of the ATP N-glycosidase was observed also in case of E. muelleri, which was grown in vitro (data not shown). In size-exclusion chromatography, the enzymatic activity was eluted immediately after the void volume (Fig. 2B). These results indicated the multimeric nature of the protein. According to the calculated MW (56.8 kDa), the protein should consist of at least three monomers. The enzymatic assays with the external ATP as a substrate unambiguously showed that the investigated protein had ATP Nglycosidase activity. Except for adenine, no (intermediate) products (ADP, AMP, Ado etc.) were detected in HPLC analysis (Fig. 2A). Accordingly, the protein under investigation is the enzymatic analogue of the ATP N-glycosidase from A. polypoides whose enzymatic activity has been analysed in detail [1]. As the result of the present study, the PNP_UDP_1 superfamily has gained a new member, ATP N-glycosidase. This hydrolase acts on the N-glycosidic bond in the ATP molecule preferring the adenylates of high-energy charge to those of the salvage pathway, AMP and adenosine. Differently from the ATP N-glycosidase of A. polypoides, the enzyme from E. muelleri seems to be quite unstable. The instability of the ATP N-glycosidase was observed already in natural E. muelleri extracts (data not shown). Residual ATP N-glycosidase activity was detected when the recombinant protein was expressed at the recommended temperature, 30 C (while the amount of adenine
Fig. 2. (A) The reverse-phase HPLC analysis of the ATP N-glycosidase assay of the recombinant P. pastoris culture media >100 KDa concentrate. 10 ml aliquots of the assay mixture (containing enzyme preparation in 1:100 dilution) were taken at definite time points. 1 eATP (the substrate), 2 e ADP, 3 - adenine. Note that ADP present in the substrate stock solution remains constant. (B) The size-exclusion HPLC profile of the recombinant P. pastoris culture media >100 KDa concentrate. 250 ml fractions were assayed for ATP Nglycosidase activity. Red line e P. pastoris culture medium with expressed recombinant protein, blue line e negative control (P. pastoris transformed with empty pHILD2 vector). The arrows correspond to the void volume of system (1), bovine serum albumin (BSA) dimer (2) and BSA monomer (3). The ATP N-glycosidase activity (black line) is normalized to the most active fraction.
T. Reintamm et al. / Biochimie 158 (2019) 126e129
accumulated in the medium was similar to that at 20 C). The expression at 20 C resulted in the preparation with high enzymatic activity, which was stable at 4 C for several weeks. However, a freezing/thawing cycle led to partial or complete activity loss. The enzymatic assays at 25 C showed that in the presence of substrate the enzymatic activity remained constant for at least 4 h. However, when the recombinant protein was exposed to 30 C prior to the addition of the substrate, a rapid and irreversible decrease of enzymatic activity occurred (the half-decay was approximately 6 h). Attempts to purify the recombinant protein through its C-terminal His-tag were unsuccessful: the anti-His antibody reactivity and the enzymatic activity did not correlate. The reasons of the protein instability (precipitation, thermal denaturation (auto?) proteolytic cleavage etc.), need further investigation.
[2]
[3]
[4]
[5]
[6] [7]
4. Conclusions [8]
The multi-domain protein from E. muelleri with PNP_UDP_1 and SCP signatures is the first ATP N-glycosidase whose primary structure was determined. The native N-terminus of the protein is suitable for secretion in Pichia pastoris expression system. Due to its low stability the enzyme has to be expressed at 20 C.
[10]
Acknowledgements
[11]
We are grateful to Nicholas Gathergood for linguistic help with the manuscript. This work was supported by the EC Marie Curie Actions ITN Project No. 607786 BluePharmTrain and the Estonian Science Foundation grant No. 9185. References [1] T. Reintamm, A. Lopp, A. Kuusksalu, T. Pehk, M. Kelve, ATP N-glycosidase - a
[9]
[12]
129
novel ATP-converting activity from a marine sponge Axinella polypoides, Eur. J. Biochem. 270 (2003) 4122e4132. A. Lopp, T. Reintamm, A. Kuusksalu, S. De Rosa, M. Kelve, A novel endoribonuclease from the marine sponge Tethya aurantium specific to 2',5'-phosphodiester bonds, Biochimie 94 (2012) 1635e1646. A. Lopp, T. Reintamm, A. Kuusksalu, A. Olspert, M. Kelve, Identification of a Novel Member of 2H Phosphoesterases, 2ʹ,5ʹ- Oligoadenylate Degrading Ribonuclease from the Oyster Crassostrea gigas, Biochimie 156 (2019) 181e195 . M. Srivastava, O. Simakov, J. Chapman, et al., The Amphimedon queenslandica genome and the evolution of animal complexity, Nature 466 (2010) 720e726, https://doi.org/10.1038/nature09201. M. Kelve, A. Lopp, T. Reintamm, A. Kuusksalu, G. Van de Vyver, E. RichelleMaurer, Freshwater sponge cell cultures as model systems for biochemical pathways present in marine sponges, in: Aquaculture Europe 2004 Conference “Biotechnologies for Quality”, European Aquaculture Society, Special Publication, Barcelona, Spain, 2004, pp. 459e460, https://doi.org/10.13140/ RG.2.2.18907.21288. Oct. 20-23, 2004. ponges d'eau douce en milieu conR. Rasmont, Une technique de culture d'e ^ le , Ann. Soc. R. Zool. Belg. 91 (1961) 147e156. tro D. De Sutter, G. Van de Vyver, Aggregative properties of different cell types of the fresh-water sponge Ephydatia fluviatilis isolated on ficoll gradients, Wilhelm Roux’s Arch. 183 (1977) 151e161. €ri, V. Mikli, E. Richelle-Maurer, A. Lopp, T. Reintamm, K. Vallmann, M. Pa M. Kelve, Molecular identification, characterization and distribution of freshwater sponges (Porifera: Spongillidae) in Estonia. Fundamental and Applied Limnology, Arch. Hydrobiol. 168 (2007) 93e103. K. Hotta, H. Takahashi, N. Satoh, Expression of an ascidian gene in the tip of the tail of tail-bud-stage embryos, Dev. Gene. Evol. 3 (1998) 164e167. R. Frost, S. Engelhardt, A secretion trap screen in yeast identifies protease inhibitor 16 as a novel antihypertrophic protein secreted from the heart, Circulation 116 (2007) 1768e1775. E. Ciplys, E. Zitkus, L.I. Gold, J. Daubriac, S.C. Pavlides, P. Højrup, G. Houen, W.A. Wang, M. Michalak, R. Slibinskas, High-level secretion of native recombinant human calreticulin in yeast, Microb. Cell Factories 14 (2015) 165, https://doi.org/10.1186/s12934-015-0356-8. C.J. Huang, L.M. Damasceno, K.A. Anderson, S. Zhang, L.J. Old, C.A. Batt, A proteomic analysis of the Pichia pastoris secretome in methanol-induced cultures, Appl. Microbiol. Biotechnol. 90 (2011) 235e247, https://doi.org/ 10.1007/s00253-011-3118-5.