Cloning and expression of the cDNA for bovine granulocyte-macrophage colony-stimulating factor

Veterinary Immunology and Immunopathology, 21 (1989) 261-278 Elsevier Science Publishers B.V., Amsterdam - - Printed in The Netherlands

261

Cloning and Expression of the c D N A for Bovine Granulocyte-Macrophage Colony-Stimulating Factor STEVEN R. LEONG, GAIL M. FLAGGS, MICHAEL J.P. LAWMAN ~and PATRICK W. GRAY

Department of Developmental Biology, 460 Pt. San Bruno Boulevard, South San Francisco, CA 94080 (U.S.A.) Veterinary In[ectious Disease Organization, University of Saskatchewan, Saskatoon, Sask. S7N OWO (Canada) (Accepted 17 February 1989)

ABSTRACT Leong, S.R., Flaggs, G.M., Lawman, M.J.P. and Gray, P.W., 1989. Cloning and expression of the cDNA for bovine granulocyte-macrophage colony-stimulatingfactor. Vet. Immunol. Immunopathol., 21: 261-278. A sequence encoding bovine granulocyte-macrophage colony-stimulatingfactor (GM-CSF) has been identified from a concanavalin A-stimulated bovine lymphocyte cDNA library. This sequence was isolated by hybridization with synthetic oligonucleotideprobes based upon the human GM-CSF sequence. This bovine cDNA was engineered for expression and secretion of activity into the periplasmic space of E. coll. Periplasmic extracts contain a 14 500-dalton protein and stimulate colony formation of bovine bone marrow progenitor cells. The predicted protein is 70% homologous with human GM-CSF and 55% homologous with murine GM-CSF. Numerous structural features are conserved among these three proteins, such as location of cysteine residues, glycosylation sites, and overall charge. The biological activity of bovine GM-CSF is species specific, since recombinant preparations do not cause proliferation of human or murine bone marrow cells. Similarly, murine GM-CSF does not exhibit activity on cells of bovine or human origin. However, human GM-CSF does stimulate colony formation of bovine bone marrow cells, although the specific activity appears reduced when compared to assays on human cells.

INTRODUCTION

Colony-stimulating factors are required for the proliferation and differentiation of a variety of lineages of hematopoietic stem cells (Metcalf, 1984; Clark and Kamen, 1987). These lymphokines also enhance the function of mature peripheral blood mononuclear cells and consequently are important in host defense mechanisms. Four distinct colony-stimulating factors (CSFs) have been isolated and identified by their ability to promote the proliferation and 0165-2427/89/$03.50

© 1989 Elsevier Science Publishers B.V.

262

differentiation of bone marrow stem cells into mature myeloid cells in semisolid media. Granulocyte-macrophage CSF (GM-CSF) stimulates the formation of neutrophilic granulocyte and macrophage colonies from progenitor cells {Burgess et al., 1977; Gough et al., 1984; Cantrell et al., 1985; Lee et al., 1985; Wong et al., 1985). Granulocyte-CSF (G-CSF or CSF-fl) (Nicola et al., 1983; Nagata et al., 1986; Tsuchiya et al., 1986) and macrophage-CSF (M-CSF or CSF-1) (Das and Stanley, 1982; Kawasaki et al., 1985) are distinct factors which are more specific in generating only a single type of colony. Interleukin3 (IL-3 or Multi-CSF) (Ihle et al., 1983; Fung et al., 1984; Yang et al., 1986) stimulates the development of a variety of colony types: granulocytes, macrophages, mast cells, eosinophils, megakaryocytes, and erythroid cells. The nucleotide coding sequences for a number of these factors of both human (Cantrell et al., 1985; Kawasaki et al., 1985; Lee et al., 1985; Wong et al., 1985; Yang et al., 1986) and murine (Fung et al., 1984; Gough et al., 1984; Tsuchiya et al., 1986) origin have recently been isolated and expressed in heterologous systems. Both human (Cantrell et al., 1985; Lee et al., 1985; Wong et al., 1985) and murine (Gough et al., 1984) GM-CSF cDNAs have recently been cloned. Natural GM-CSF from both sources is an acidic glycoprotein of molecular weight 23 000 and is required for the continuous culture of granulocyte and macrophage progenitor cells in vitro. GM-CSF is active at low concentrations (10- lo_ 10-12M) (Metcalf, 1984; Walker and Burgess, 1985; Gasson et al., 1986) and its specific cell surface receptor has been partially characterized (Walker and Burgess, 1985; Gasson et al., 1986). Stimulation of T lymphocyte clones with antigen, concanavalin A, or interleukin-2 results in the rapid synthesis of GMCSF mRNA (Kelso et al., 1986; Mosmann et al., 1986). In addition to promoting growth of granulocytes and macrophages, GM-CSF also stimulates the proliferation of some T cell lines (Kupper et al., 1987; Woods et al., 1987) and modulates the activity of mature neutrophilic granulocytes (Gasson et al., 1984 ). The availability of recombinant CSFs will greatly aid in characterizing their biological properties and help to advance cell culture techniques. We report here the identification of a cDNA clone for bovine GM-CSF and its expression in E. coli. Comparison of this sequence with human and murine GM-CSF allows the identification of numerous conserved structural features. Bovine and murine GM-CSF exhibit strict species specificity; however, human GM-CSF is active on bovine cells. MATERIALS AND METHODS

Construction of a bovine lymphocyte cDNA library Bovine peripheral blood lymphocytes were stimulated in vitro with concanavalin A ( 10 ]lg/ml) for 72 h. Total RNA was isolated by homogenizing the cells in 5 M guanidinium thiocyanate and then precipitating the RNA with 4 M lithium chloride (Cathala et al., 1983). Polyadenylated RNA was prepared

263

by oligo-dT cellulose (Collaborative Research, Lexington, MA) chromatography. The mRNA was used to synthesize cDNA by the method of Gubler and Hoffman (1983) (cDNA synthesis kit, Amersham, Arlington Heights, IL). Synthetic DNA (a 16-mer and a complementary 12-mer) was ligated to the bovine cDNA to provide EcoRI endonuclease sites at both ends. The cDNA was then fractionated on an 8% polyacrylamide gel and subsequently ligated to EcoRI digested ~gtl0. The recombinant DNA was packaged into phage particles using an in vitro packaging system (Promega, Madison, WI). A library of approximately 5 × 106 phage was generated from 10 ng of cDNA. Several clones encoding authentic bovine interleukin-2 (Cerretti et al., 1986; Reeves et al., 1986) have been isolated from this library (S.R.L., M.J.P.L and W.I. Wood, unpublished observations). Isolation of bovine GM-CSF cDNA clones Two 70-base oligodeoxynucleotides were synthesized (Froeler et al., 1986) and used as probes for the identification of bovine GM-CSF. These probes were based upon the human GM-CSF sequence (Wong et al., 1985) (starting at base 225 and base 299) in regions which were highly homologous to the routine GMC SF sequence (82 % and 75 % homology, respectively ). We predicted that these regions would also be highly homologous to bovine GM-CSF and that the human sequence would be more homologous than the mouse. The bovine lymphocyte cDNA library was screened independently with the two probes; 1 100 000 plaques were plated on twenty 15-cm plates and duplicate nitrocellulose filters were blotted from each plate (Maniatis et al., 1978). One set of filters was screened with probe 1 (starting at base 225) and the other set of filters was screened with probe 2 (starting at base 299). The probes were kinased with 32P-ATP (Amersham) and then added to the filters which were previously bathed for 4 h in hybridization solution: 20% formamide, 0.75 M sodium chloride, 0.075 M sodium citrate, 1% polyvinyl pyrolidone (Sigma Chemical Co., St. Louis, MO), 1% Ficoll, 1% bovine serum albumin (Sigma; fraction V), 0.05 M sodium phosphate, pH 6.5, and 50 ng/ml sonicated salmon sperm DNA (Sigma). Following overnight hybridization at 42 ° C, the filters were washed extensively: filters hybridized with probe 1 were washed in 0.06 M sodium chloride, 0.006 M sodium citrate, 0.1% sodium dodecyl sulfate at room temperature and filters hybridized with probe 2 were washed in 0.03 M sodium chloride, 0.003 M sodium citrate, 0.1% sodium dodecyl sulfate at 37 ° C. Approximately 100 plaques appeared to hybridize with both probes (approximately one clone in 10 000). Twenty phage isolates were plaque purified (Maniatis et al., 1978) and subsequently phage D NA was hybridized with probe 3, which was based on the 5' end of the reported human GM-CSF sequence (50 bases long starting at the ATG, base 10). Four clones hybridized with all three probes and presumably contained full length cDNAs. The clone ~BovGMCSF contained an EcoRI insert of approximately 800 bp in length, as

264 determined by electrophoresis on a 5% polyacrylamide gel. This insert was subcloned in p U C l l 9 and both strands were sequenced by the dideoxy chain termination technique (Smith, 1980).

Expression of bovine GM-CSF The DNA insert sequence of clone pBovGMCSF-3.4 appeared to encode the entire precursor of bovine GM-CSF, based on homology with the human and murine proteins. This was conclusively demonstrated by engineering the cDNA insert for expression in E.coli. As presented in Fig. 2, the 353 bp DdeI-Sau3A fragment coding for the majority of bovine GM-CSF was ligated to 78 bp of synthetic DNA and the expression vector. The resulting plasmid utilized a promoter from the alkaline phosphatase gene (Kikuchi et al., 1981) to direct the expression of the bovine GM-CSF sequence fused to the bacterial secretory signal of heat stable enterotoxin II (Picken et al, 1983). Similar constructions have been utilized to correctly process some eucaryotic proteins (Ghrayeb et al., 1984; Gray et al., 1985) and direct their localization to the periplasmic space of E. coll. The region of the plasmid derived from synthetic DNA and the adjacent cloning restriction sites were sequenced by the dideoxy technique. E. coli cultures were grown to an OD55o of 1.0 and then extracts of whole cells or periplasmic fractions were prepared (Gray et al., 1985) for sodium dodecylsulfate polyacrylamide gel electrophoresis or biological assay.

Colony-[orming assay Bovine GM-CSF was assayed by its ability to stimulate the formation of colonies in agar from bone marrow progenitor cells. Bovine bone marrow cells were plated at a concentration of 2 × 105 cells per ml in 35-mm petri dishes with 20% fetal bovine serum, MEM-~ media (Gibco), 0.6% agar (Difco), and the colony-stimulating factor (E. coli extracts or activated bovine lymphocyteconditioned medium). The cultures were incubated at 37°C in 5% CO2 and then examined after 14 days for colony formation. Assays on murine and human marrow cells were performed similarly. Preparations of recombinant human and recombinant murine GM-CSF (Genzyme, Boston, MA) were supplied at a concentration of 5000 units per ml and specific activity of 107 units per mg protein.

Bovine GM-CSF antibody preparation A synthetic peptide based on the bovine GM-CSF sequence (the first 15 mature residues presented in Fig. 1, followed by a cysteine) was synthesized by a Beckman peptide synthesizer. This peptide was conjugated to Soybean Trypsin Inhibitor with a ratio of 2 mg peptide to 1 mg carrier. New Zealand white rabbits were immunized intradermally with a suspension of the peptidecarrier complex in complete Freund's adjuvant. The rabbits were boosted at 1month intervals and serum was obtained 14 days after each boost.

265

Analysis o[ bovine GM-CSF gene and m R N A DNA from bovine liver was isolated (Blin and Stafford, 1976) and used for Southern blot analysis (Southern, 1975). The DNA was digested with restriction endonucleases (New England Biolabs, Boston, MA), fractionated on a 1% agarose gel, and then transferred to nitrocellulose. The size of bovine GMCSF mRNA was determined by Northern blot analysis. RNA was isolated (Cathala et al., 1983 ) from bovine lymphocytes stimulated in culture for 3 days with concanavalin A. Oligo-dT cellulose was used to prepare poly-A containing RNA which was electrophoresed on a formaldehyde-agarose gel (Dobner et al., 1981) and then transferred to nitrocellulose (Thomas, 1980). The Southern and Northern blots were hybridized with a bovine GM-CSF cDNA probe and washed under stringent conditions (Maniatis et al., 1978). RESULTS

Isolation o[ a bovine GM-CSF cDNA A cDNA library in 2gtl0 was prepared from concanavalin A-stimulated bovine lymphocyte mRNA. Approximately 50 000 plaques were screened in tandem with two 70-base synthetic oligonucleotide probes; the probes were based on the human GM-CSF cDNA sequence (Wong et al., 1985) in coding regions which were highly homologous to the routine sequence (Gough et al., 1984; Stanley et al., 1985). The human sequence was chosen over the mouse since bovine genes are generally more homologous to human genes; this is also reflected in other lymphokine sequences such as interferon-y (Gray and Goeddel, 1987) and interleukin-2 (Cerretti et al., 1986; Reeves et al., 1986). Approximately 100 plaques in the library hybridized independently with both probes. Twenty of these clones were plaque purified and four of the cloned DNAs bybridized with a third probe based on the 5' end of the human GM-CSF cDNA (50 bases in length). The longest cDNA insert appeared to be 800 bp in length and was subcloned in pUC119 (Vieira and Messing, 1987). The cDNA sequence of the resulting plasmid (pBovGM-CSF-3.4) was determined by the dideoxy chain termination method and is presented in Fig. 1. This sequence exhibits significant homology to both human and murine GM-CSF at the DNA and protein level (see discussion for percentage comparison). Expression o[ recombinant bovine GM-CSF To confirm that this sequence indeed codes for bovine GM-CSF, it was engineered for expression in E. coli and the biological activity of the recombinant protein was examined. As presented in Fig. 2, a restriction fragment encoding the majority of bovine GM-CSF (353 bp DdeI-Sau3A fragment, encoding the 104 carboxy terminal amino acids) and 78 bp of synthetic DNA (encoding the

266

1 GAAAGGCTAAAGTCCTCAAGAGG

-I0 m e t trp leu gln asn leu leu leu leu ATG TGG CTG CAG A A C CTG CTT CTC CTG

1 gly thr val v a l cys set phe ser Ala Pro Thr A r g Pro Pro A s h 51 GGC A C T GTG GTC TGC A G C TTC TCC G C A C C T A C T CGC CCA C C C AAC I0 20 Thr Ala Thr Arg Pro Trp Gln His V a l A s p Ala Ile Lys G l u Ala 96 ACT G C C ACC CGG CCC TGG CAG CAT GTG G A T GCC A T C AAG GAG GCC 3O Leu Ser Leu L e u Asn His Ser Set Asp Thr A s p A l a Val M e t Asn 141 CTG AGC CTT CTG AAC CAC AGC A G T GAC A C T G A T G C T GTG ATG A A T 40 50 A s p Thr G l u Val Val Ser Glu Lys Phe A s p Ser G l n G I u P r o Thr 186 GAC ACA G A A G T C GTC TCT G A A AAG TTT G A C TCC C A G GAA C C A ACG 6O Cys Leu Gln Thr Arg L e u Lys Leu Tyr L y s Asn G l y Leu G l n Gly 231 TGC CTG CAG A C T CGC CTG AAG CTG TAC A A G AAC G G C CTG CAG GGC 7O 80 Set Leu Thr Ser Leu M e t G l y Ser Leu Thr M e t M e t Ala Thr His 276 AGC CTC ACT A G T CTC ATG GGC TCC TTG A C C ATG A T G GCC A C C CAC 9O Tyr G l u Lys His Cys Pro Pro Thr Pro G l u Thr Set Cys G l y Thr 321 TAC GAG A A A C A C TGC C C A CCC A C C CCG G A A ACT TCC TGT G G A ACC i00 ii0 G l n Phe Ile Ser Phe Lys Ash Phe Lys G I u Asp L e u Lys G I u Phe 366 CAG TTT ATC AGC TTC A A A A A T TTC A A A G A G G A C CTG AAG G A G TTC 120 L e u Phe Ile Ile Pro Phe Asp Cys Trp G l u Pro A l a Gln L y s 411 CTT TTT ATC A T T CCC T T T GAC TGC TGG G A A C C A G C C CAG A A G TGA 456 A G C A G G C C A A A C C A G C C A G A A G T G G A A G C T T A C C T C A C A G A T C G C T G C C C T C C T A C C C A C 516 A A A G A G C C A A A C A A A A C T C A G G A T C T T C A C A C T G G A G G G A C C A C A G G G A G G G C C A G A G C T 576 G T A G G G G G C C G C T G G C T T G T T C A G G G C C A T G T T G A C C C T G A T A C A G G T G T G G C A G G G G A A 636 A C G G G A A A T G T T T T A C A C T G G C A G G G A T C A G C A A T A T T T A T T T A T A T A T T T A T G T A T T T T 696 A A T A T T T A T T T A T T T A T T T A T T T A A A C T C A T A C C C C A T A T T T A T T C A A G A T G T T T T T C T A 756 T A A T A A T A A A T T A C T T C A A A G TC T G T T C T G A A A A A A A A

AP/kA_A

Fig. 1. The cDNA sequence of bovine GM-CSF. The sequence is translated from the first ATG encountered. The first 17 amino acids (presented in lower case) presumably represent a signal sequence, predicted by homology with human GM-CSF. The two potential N-linked glycosylation sites (residues 27 and 37 ) are overlined. Restriction sites utilized in construction of the expression plasmid were DdeI at nucleotide 142 and Sau3A at nucleotide 495. The isolated cDNA contained EcoRI synthetic DNA linkers at both ends (not shown, 19 bases in length). 22 a m i n o t e r m i n a l r e s i d u e s ) w e r e ligated i n t o an E. coli e x p r e s s i o n plasmid. A p r o m o t e r for t h e E. coli a l k a l i n e p h o s p h a t a s e gene ( K i k u c h i et al., 1981) directs t h e e x p r e s s i o n o f t h e G M - C S F s e q u e n c e p r e c e d e d by a bacterial s e c r e t i o n s e q u e n c e for h e a t - s t a b l e e n t e r o t o x i n II ( P i c k e n et al., 1983). S u c h a c o n s t r u c -

267 Oligo-2

Oligo-I CGCGTATC.-CAGCACCAACTCGCCCACCTAACACTGCAACTCGCC ATAGGTGGTGGI"rc~GCGGGTGGATr G T ~ T A G

CATGGCAGCACGTTGACGC'rAT~AC CGI"CGTGCAACTGCGATAGTTCCTCOGTGACT

Oligo-3 M~lu I IFN-oamml AP

OUgo*4 1. Kinase with ATP 2. Anneal oligome~ I~ather

~JI II

1. Digest pSovGMCSF-3.4 wil.h Dde ! snd Sau 3A 2. Isolate 353 bp fragment

Ddel

I. Digest with MIu I and Sgl II 2. Isolate vector fragment on 1% agaro6e gel

Sau 3A

t

J 3s3

l I. Ligale fragmenls Iogelher 2. Transform E. co/i

MluI AP p r o ~

Bovine cSF Bgl II

Fig. 2. Plasmic construction for expression of bovine GM-CSF in E. coll. The four synthetic oligonucleotideswereprepared by the phosphite method (Froeleret al., 1986), kinased,and annealed together. This DNA is designedto encodethe last two codons of the bacterial signalsequenceand the first 22 codons of bovine GM-CSF. The 353 bp restriction fragment (DdeI-Sau3A) encodes the 104 carboxyterminal residues of GM-CSF.An expressionvector containingthe human interferon-7 sequence (P.W. Gray, unpublished) provided the E. coli alkaline phosphatase promoter (APro, Kikuchi et al., 1981 ) and signal sequence for heat-stable enterotoxin II (STII, Picken et al., 1983). The three DNA fragments were ligated together (the Sau3A site ligates into the BgIII site since both endonucleasesrecognize the same internal four bp) and then transformed into E. coli. Recombinants were selected by resistance to ampicillin (plasmid contains the AMP gene from pBR322). tion should promote the synthesis of a fusion protein: the bacterial signal sequence should allow for the processing of the entire mature bovine GM-CSF which would then be sequestered in the periplasmic space. This approach has the advantage of ease of purification and yields a recombinant protein with the appropriate amino terminal end (as opposed to directly expressed proteins which may have an unprocessed methionyl residue). In addition, periplasmic transport aids the correct formation of disulfide bridges (Gray et al., 1985), two of which are potentially present in bovine GM-CSF. Cultures containing the expression plasmid and control cultures were grown and assayed for colony-forming activity. As presented in Table 1, culture lysates and periplasmic fractions of pAPSTII-BoGMCSF-1 elaborated a significant number of granulocyte-macrophage colonies from bovine bone marrow precursor cells, while

268 TABLE 1 Colony formation of bovine bone marrow cells in agar Extract

Final dilution

Average number of coloniesa

T cell-conditioned media Bone marrow control media (unstimulated)

1/20

51

-

5

E. coli-pAPSTII-BoGMCSF-1 Periplasmic Whole cell

1/400 1/400

34 43

E. coli-pUC119 Periplasmic Whole cell Buffer control (20% sucrose- 10raM Tris)

1/400 1/400

1.5 1.5

1/400

2

aFresh bovine bone marrow cells (2 × 102) were plated in 0.6% agar with 20% fetal bovine serum, MEM-~ media, and the potential colony-stimulating factor. The cultures were examined for colony formation after 14 days incubation.

control cultures produced few colonies. Morphologic analysis of the resulting stimulated colonies is presented in Fig. 3A; the majority of the colonies are a mixture of macrophage an neutrophilic granulocyte cell types. Bovine lymphocyte conditioned media also elaborated GM-CSF activity and produced colonies of similar appearance. However, comparison of the specific activities of natural and recombinant bovine GM-CSF is not currently possible since neither protein has yet been purified. Identification of activity within the periplasmic fraction suggests that the mature recombinant bovine GM-CSF is processed from the bacterial signal sequence and sequestered within the periplasmic space. This result is supported by polyacrylamide gel electrophoresis of periplasmic proteins: a protein band with the predicted size of mature non-glycosylated bovine GM-CSF (14 500 daltons) is observed in periplasmic extracts of pAPSTII-BoGMCSFi but not in control (pUC119) preparations (Fig. 3B ). This band reacts with a polyclonal antiserum directed against a synthetic peptide designed on the first 15 amino acids of bovine GM-CSF (results not shown). In addition, the E. coli-derived GM-CSF was electrophoresed on a preparative polyacrylamide gel and the predicted GM-CSF band was isolated and subjected to amino terminal sequence analysis. Twelve amino terminal residues were determined (Lin and Kohr, 1987) and corresponded exactly with the sequence predicted from mature bovine GM-CSF; this result confirms that the protein has been properly processed from the bacterial signal sequence. Similar results have recently been obtained by Libby et al. (1987) with the secretion of recombinant human

269 A.

B.

i:

1

2

3

4

5

)2 000 ~6 000 ~,5 000

31 000

21 500

14 400 Fig. 3. Demonstration of recombinant bovine GM-CSF expression. A. Microscopic appearance of bovine bone marrow cells treated with recombinant GM-CSF and grown in agar for 7 days. Magnification is 150 X. This typical colony is a mixture ofneutrophilic granulocytes and macrophages. B. SDS-polyacrylamide gel electrophoresis of E. coli proteins. Extracts from pAPSTII-BoGMCSF-1 are shown in lane 1 (periplasmic fraction) and lane 2 (whole cells). Extracts from pUC 119 are shown in lane 3 (periplasmic fraction) and lane 4 (whole cells). Molecular size markers are presented in lane 5. An arrow marks the position of the putative bovine GM-CSF band.

270

GM-CSF utilizing the signal sequence of the outer membrane protein in E. coli. A titration curve of recombinant bovine GM-CSF activity is presented in Fig. 4. The E. coli extracts contain material which is toxic to cells in the clonagenic assay; consequently, the more concentrated samples exhibit less activity than the thousand-fold dilution. To further confirm the authenticity of the sequence of Fig. 1, antisera prepared against the carboxy-terminal synthetic peptide (last 15 residues) have been shown to inhibit both recombinant and natural GM-CSF preparations (Fig. 4). The activity of GM-CSF on human, murine and bovine bone marrow cells 8O

A.

_= 60 o

°

40

L9

E

= 20 z

!

10

-5

-4 10

10

-3

-2 10

-1 10

10

0

Dilution of Bovine GM-CSF

40--

~.

a0-

0

~

"6 20

Z

.

165

1 Dilution

1

16 2

101 2x101

of Antisera

Fig. 4. A. Titration of bovine G M - C S F activity. The clonagenic assay was performed as described in Materials and Methods with whole-cell extracts from E. coli containing either pBR322 (negative control) or p A P S T I I - B o G M C S F - 1 (recombinant bovine G M - C S F ) . The undiluted E. coli extracts are toxic to cells in the assay. B. Titration of antisera prepared against a synthetic peptide designed on the GM-CSF carboxy terminal 15 residues. The prebleed ( - - ) and antisera ( - - ) were serially diluted and tested with a constant amount of bovine GM-CSF (1 to 400 dilution of recombinant GM-CSF (C) ) and a 1 to 40 dilution of T cell-conditioned media ( • ) ). Each sample was assayed in triplicate.

271 B.

A.

e160 _e

C.

70

70-

60

60-

50

50-

40

40-

30

30

20

20

10

lO

"~120o

80-

40--

0.005

0.05

0.5

GM-CSF

5 (ng/ml)

50

0.005

I 0.05

0.5 GM-CSF

'

5

(ngYml)

~o

"0

I 0.005

I 0.05

I 0.5 GM-CSF

/ 5

5O

(ng/ml)

Fig. 5. Titration of GM-CSF activity on different species' bone marrow cells. A. Murine clonagenic assay. B. Bovine assay. C. Human assay. The human (m) and murine ( • ) GM-CSF are recombinant commercial preparations. The quantity of E. coli-derived bovine GM-CSF ( • ) was estimated by comparison with protein standards on polyacrylamide gels (as in Fig. 3B). The undiluted E. coli extracts are toxic to cells in the assay. The clonagenic assays were performed as described in Materials and Methods, and each sample was assayed in triplicate.

is compared in Fig. 5. Bovine GM-CSF exhibits species specificity and is not active on human or murine cells. Similarly, murine GM-CSF is inactive on bovine cells or human cells. We have confirmed other reports (Cantrell et al., 1985; Lee et al., 1985) which demonstrate that human GM-CSF is inactive on murine cells; however, the human GM-CSF is clearly active on bovine cells. H u m a n GM-CSF appears to exhibit greater activity on human cells than on bovine cells; such specific activity comparisons are difficult to make because of the background differences in the assays. Southern and Northern analysis A cDNA probe specific for the coding region of bovine GM-CSF was radiolabeled and hybridized to a Southern blot of bovine genomic DNA digested with various restriction endonucleases. As shown in Fig. 6, the cDNA hybridizes to a single band in five or six restriction digests. The NcoI digestion {lane 5 ) produced multiple hybridization bands, but the cDNA contains an NcoI site. The results presented in Fig. 6 are consistent with a single gene encoding GMCSF in cows. Other investigators have shown that human GM-CSF is encoded by a single gene (Cantrell et al., 1985; Kaushansky et al., 1986). Murine GMCSF is also encoded by a single gene (Stanley et al., 1985 ). The bovine GM-CSF cDNA was also hybridized to a Northern blot of mRNA from stimulated bovine lymphocytes. A single hybridizing band was observed

272

1

2

3

4

5

6

7

22--"=

9.5~ 6.7 '--4.7

~28S

"='='

"-- 18S 2 o 3 ,,.,,.=

2.0m

Fig. 6. Southern hybridization of the bovine GM-CSF cDNA probe to bovine genomic DNA (left). The restriction endonuclease digests are: (1) BarnHI, (2) BgIII, (3) EcoRI, (4) HindIII, (5) NcoI, and (6) XhoI. Northern hybridization (right) of the bovine GM-CSF cDNA probe to bovine lymphocyte mRNA. Lane 7 contains 2 fig of mRNA from concanavalin A-stimulated bovine lymphocytes.

(Fig. 6) with an approximate size of 800 bases, which is in close agreement with the length of the isolated cDNA. DISCUSSION

We have identified a cDNA clone from peripheral blood lymphocytes which encodes bovine GM-CSF, similar to that recently isolated from a BT2 bovine T cell line (Maliszewski et al., 1988). Several lines of evidence confirm that this sequence is indeed bovine GM-CSF: the sequence is highly homologous to murine and human GM-CSF and the sequence directs the expression in E. coli of a recombinant protein with GM-CSF activity. The bovine GM-CSF sequence is highly homologous to the human sequence at both the DNA (78%) and amino acid levels (70%). The bovine sequence exhibits somewhat less similarity to murine GM-CSF (68% for DNA, 55% for protein). Alignment of these three protein sequences is presented in Fig. 7. Murine GM-C SF contains a deletion (at position 28) of three amino acids with respect to the other two sequences, while bovine GM-CSF is missing a single residue (at position 40) when compared to human and murine. The positions

273 bovine human murine

MWL Q N L L L L G T V V C SIF~A~--~P['~N[~A[~RP--~Q~H--'~. ~ ID~-~ [MWL Q ~ L L L L G T V~C,.S[I IS A P[~R'SPiS P SIT[~P V~E[H VIN LMWL ~ Y ~ L I S A P~-8 S P]I ~ V ] T R - P '~K H[~E

bovine

~ S ~ H R S ~ I D ~ V ~ K ~ S

PQE ~T~L

i

hudnan ~E ALRR[L L~ILI!ISID~A~IEI~N--I-~= v '~S~]MIF~JL ELg__L~T 0 c~ murine

bovine human murine

bovine human murine

K E A LIN LLLq]D- - - L~MP V m L N EIE~V E V V SIN E ~ S F K K L T ~ V

L
T R L]EIL Y K'-QG L'RG S L T'KL"KGIPIL T MMA~-SH YIK Q -,- ,:, L ~ , F - - ~

G, = o~71r

K• KG

E=IF~.IL

I

~

~

o

T YIO ':' P Tr

KIOIE LI~V, PF DOW~ PlVrOE

V TLT]Y A DLFJl D S ~ T

FLF__L]T

P FC ~ K ~ $ 1 Q ~

Fig. 7. Homology comparison of the bovine GM-C SF protein sequence with the reported sequences for human (Cantrell et al., 1985; Lee et al., 1985; Wong et al., 1985) and murine (Gough et al., 1984; Sparrow et al., 1985; Stanley et al., 1985 ) GM-CSF. The entire sequences (including signal) are presented.

of the four cysteine residues are identical in each protein; consequently, the molecules probably share identical disulfide structures. The three sequences also each have two potential glycosylation sites, but those of the murine (at positions 46 and 55 of the mature molecule) are in different positions with respect to the human and bovine GM-CSFs (at positions 27 and 37). The positions and number of charged residues are roughly similar in the three sequences (natural murine and human GM-CSFs are acidic glycoproteins) (Gough et al., 1984; Wong et al., 1985). In addition, the three proteins have similar hydrophilicity profiles; as shown in Fig. 8, the profile for bovine GMCSF is more similar to the plot for human than the murine sequence. These results collectively suggest that these different species of GM-CSF share similar structures. However, the assay results presented in Fig. 5 suggest that the biological activities are generally species-specific; only human GMCSF exhibits significant activity on bovine cells. This result is consistent with the greater similarity of the human molecule with bovine GM-CSF than with murine, where no cross-species activity is observed. Because of the high degree of homology with human GM-CSF, we have predicted that mature bovine GM-CSF begins at residue 18 of Fig. 1. This would be consistent with the processing which occurs with human GM-CSF (Cantrell et al., 1985; Lee et al., 1985 ). Determination of the actual amino-terminal sequence of bovine GM-CSF awaits purification of the natural material; regardless, the recombinant GM-CSF described here exhibits biological activity and therefore contains a functional amino terminus. Mature murine GM-CSF, however, has been reported to begin at residue 24 (Sparrow et al., 1985) (numbering according to Fig. 7); this may result from alternative secretory process-

274 2

Bovine GM-CSF

1 0 -1 -2--

2

Human GM-CSF

1 0

-2-

2-

Murine GM-CSF

1 0 -1 -2

Fig. 8. Comparison of the hydrophilicity profiles of bovine, human, and murine GM-CSF sequences. The plots were generated by the method of Kyte and Doolittle (1982) using a jump of four residues and a width of ten residues. The numbers on the vertical axis are the hydropathy index. The primary sequences are represented on the horizontal axis, starting with the amino terminal of the left (the marks represent a length of 20 residues). The arrowscorrespondto the position of the signal-maturejunction. ing or further proteolytic processing following secretion and purification. Furthermore, glycosylation does not appear to be necessary for biological activity, since the E. coli-derived GM-CSF is presumably not glycosylated. It would be of interest to compare the specific activities of our E. coli-derived GM-CSF with mammalian cell-derived (either natural or recombinant) GM-CSF; perhaps the glycosylation may affect in vitro assay activity or alter turnover rates in vivo. Miyajima et al. (1986) removed the glycosylation sites in recombinant routine and human GM-CSF; while the typical size heterogeneity (a result of variable glycosylation) was reduced, the biological activity of the mutagenized GM-CSF was not altered.

275 The hybridization results of Fig. 6 suggest that bovine GM-CSF is encoded by a single gene which produces an 800-base transcript. Similar results have been observed for h u m a n GM-CSF (Cantrell et al., 1985; Kaushansky et al., 1985). The 5' untranslated region of human GM-CSF mRNA is 35 bases long (Kaushansky et al., 1986); the bovine cDNA clone is only 12 bp short of this length. A highly conserved A-T rich sequence has been implicated in selective mRNA degradation of human and murine GM-CSF and several other lymphokines (Shaw and Kamen, 1986). This sequence is also observed in bovine GM-CSF and exhibits a high degree of similarity (87%) to the human sequence. The regulation of the GM-CSF gene is dependent on the activation of T lymphocytes (Kaushansky et al., 1986; Kelso et al., 1986; Mosmann et al., 1986 ). Factors controlling this stimulation merit further investigation and will provide a clearer understanding of how other lymphokines regulate the levels of bovine GM-CSF. These studies will be aided by the availability of other recombinant bovine lymphokines which have recently been cloned and expressed, such as interleukin-2 (Cerretti et al., 1986; Reeves et al., 1986), interferon-7 (Gray and Goeddel, 1987), tumor necrosis factor (Goeddel et al., 1986), and lymphotoxin (Goeddel et al., 1986). As a model system, the cow has the advantage of providing large amounts of bone marrow progenitor cells for study of the physiological role of GM-CSF in hematopoiesis. The ability to produce active GM-CSF in E. coli should enable the production of large amounts of recombinant material. Site-specific mutagenesis should then facilitate the production of altered forms of bovine GM-CSF which will be useful for correlating the protein structure with functional regions of the molecule. ACKNOWLEDGEMENTS The authors wish to thank Mark Vasser and Peter Ng for preparation of synthetic DNA, David Leung for providing the E. coli alkaline phosphatase promoter sequence, Debra Glaister for providing the bacterial signal sequence, William Kohr for protein sequence analysis, and John Burnier for synthetic peptide preparation.

REFERENCES Blin, N. and Stafford,D.W., 1976.A general method for isolation of high molecularweightDNA from eukaryotes.NucleicAcids Res., 3: 2303-2308. Burgess, A.W., Camakaris,J. and Metcalf, D., 1977. Purification and properties of colonystimulating factor from mouselung-conditionedmedium.J. Biol. Chem.,252: 1998-2003. Cantrell, M.A., Anderson,D., Cerretti, D.P., Price, V., McKereghan,K., Tushinski, R.J., Moshizuki, D.Y., Larsen, A., Grabstein, K., Gillis, S. and Cosman,D., 1985. Cloning,sequence,and expressionof a human granulocyte/macrophagecolony-stimulatingfactor. Proc. Natl. Acad. Sci. U.S.A.,83: 6250-6254.

276 Cathala, G., Savouret, J.-F., Mendez, B., West, B.L., Karin, M., Martial, J.A. and Baxter, J., 1983. A method for isolation of intact, transcriptionally active ribonucleic acid. DNA, 2: 329-335. Cerretti, D.P., McKeneghan, K., Larsen, A., Cantrell, M.A., Anderson, D., Gillis, S., Cosman, D. and Baker, P.E., 1986. Cloning, sequence, and expression of bovine interleukin 2. Proc. Natl. Acad. Sci. U.S.A., 83: 3223-3227. Clark, S.C. and Kamen, R., 1987. The human hematopoietic colony stimulating factors. Science, 236: 1229-1236. Das, S.K. and Stanley, E.R., 1982. Structure-function studies of a colony stimulating factor (CSF1). J. Biol. Chem., 257: 13679-13684. Dobner, P.R., Kawasaki, E.S., Yu, L.Y. and Bancroft, F.C., 1981. Thyroid or glucocorticoid hormone induces pregrowth hormone mRNA and its probable nuclear precursor in rat pituitary cells. Proc. Natl. Acad. Sci. U.S.A., 78: 2230-2234. Froeler, B.C., Ng, P.G. and Matteucci, M.D., 1986. Synthesis of DNA via deoxynucleoside Hphosphonate intermediates. Nucleic Acids Res., 14: 5399-5407. Fung, M.C., Hapel, A.J., Ymer, S., Cohen, D.R., Johnson, R.M., Campbell, H.D. and Young, I.G., 1984. Molecular cloning of cDNA for murine interleukin-3. Nature, 307: 233-237. Gasson, J.C., Weisbart, R.H., Kaufman, S.E., Clark, S.C., Hewick, R.M., Wong, G.G. and Golde, D.W., 1984. Purified human granulocyte-macrophage colony-stimulating factor: direct action on neutrophils. Science, 226: 1339-1342. Gasson, J.C., Kaufman, S.E., Weisbart, R.H., Tomonaga, M. and Golde, D.W., 1986. High-affinity binding of granulocyte-macrophage colony-stimulating factor to normal and leukemic human myeloid cells. Proc. Natl. Acad. Sci. U.S.A., 83: 669-673. Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Y. and Inouye, M., 1984. Secretion cloning vectors in Escherichia coll. EMBO J., 3: 2437-2442. Goeddel, D.V., Aggarwal, B.B., Gray, P.W., Leung, D.W., Nedwin, G.E., Palladino, M.A., Patton, J.S., Pennica, D., Shepard, H.M., Sugarman, B.J. and Wong, G.H.W., 1986. Tumor necrosis factors: gene structure and biological activities. Cold Spring Harbor Symp. on Quant. Biol., LI: 597-609. Gough, N.M., Gough, J., Metcalf, D., Kelso, A., Grail, D., Nicola, N.A., Burgess, A.W. and Dunn. A.R., 1984. Molecular cloning of cDNA encoding a murine haematopoietic growth regulator, granulocyte-macrophage colony-stimulating factor. Nature, 309: 763-767. Gray, G.L., Baldridge, J.S., McKeown, K.S., Heyneker, H.L. and Chang, C.N., 1985. Periplasmic production of correctly processed human growth hormone in Escherichia coli: natural and bacterial signal sequences are interchangeable. Gene, 39: 247-254. Gray, P.W. and Goeddel, D.V., 1987. Molecular biology of interferon-gamma. Lymphokines, 13: 151-162. Gubler, U. and Hoffman, B.J., 1983. A simple and very efficient method for generating cDNA libraries, Gene, 25: 263-269. Ihle, J.N., Keller, J., Oroszlan, S., Henderson, L.E., Copeland, T.D., Fitch, F., Prystowsky, M.B., Goldwasser, E., Schrader, J.W., Palaszynski, E., Dy, M. and Lebel, B., 1983. Biology properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, P-cell-stimulating factor activity, colony-stimulating factor activity, and histamine-producing cell-stimulating factor activity. J. Immunol., 131: 282-287. Kaushansky, K., O'Hara, P.J., Berkner, K., Segal, G.M., Hagen, F.S. and Adamson, J.A., 1986. Genomic cloning, characterization, and multilineage growth-promoting activity of human granulocyte-macrophage colony-stimulating factor. Proc. Natl. Acad. Sci. U.S.A., 83: 31013105. Kawasaki, E.S., Ladner, M.B., Wang, A.M., VanArsdell, J., Warren, M.K., Coyne, M.Y., Schweickart, V.L., Lee, Mei-Ting, Wilson, K.J., Boosman, A., Stanley, E.R., Ralph, P. and Mark, D.F., 1985. Molecular cloning of a complementary DNA encoding macrophage specific colony-stimulating factor. Science, 230: 291-296.

277 Kelso, A., Metcalf, D. and Gough, N.M., 1986. Independent regulation ofgranulocyte-macrophage colony-stimulating factor and multi-lineage colony-stimulating factor production in T lymphocyte clones. J. Immunol., 136: 1718-1724. Kikuchi, Y., Yoda, K., Yamasaki, M. and Tamura, G., 1981. The nucleotide sequence of the promoter and the amino-terminal region of alkaline phosphatase structural gene (phoA) of Escherichia coll. Nucleic Acids Res., 9: 5671-5678. Kupper, T., Flood, P., Coleman, D. and Horowitz, M., 1987. Growth of an interleukin 2/interleukin 4-dependent T-cell line induced by granulocyte-macrophage colony-stimulating factor. J. Immunol., 138: 4288-4292. Kyte, J. and Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol., 157: 105-132. Lee, F., Yokota, T., Otsuka, T., Gemmell, L., Larson, N., Luh, J., Arai, K. and Rennick, D., 1985. Isolation of a cDNA for a human granulocyte-macrophage colony-stimulating factor by functional expression in mammalian cells. Proc. Natl. Acad. Sci. U.S.A., 82: 4360-4364. Libby, R.T., Braedt, G., Kronheim, S.R., March, C.J., Urdal, D.L., Chiaverotti, T.A., Tushinski, R.J., Mochizuki, D.Y., Hopp, T.P. and Cosman, D., 1987. Expression and purification of native human granulocyte-macrophage colony-stimulating factor from an Escherichia coli secretion vector. DNA, 6: 221-229. Lin, N. and Kohr, W., 1987. Protein sequences of the first twelve amino terminal residues of bovine GMCSF. Genentech. Inc. South San Francisco, CA (unpublished data). Maliszewski, C.R., Schonenborn, M.A., Cerretti, D.P., Wignall, J.M., Picha, K.S., Tushinski, R.J., Gillis, S. and Baker, P.E., 1988. Bovine GM-CSF: molecular cloning and biological activity of the recombinant protein. Mol. Immunol., 25: 843-850. Maniatis, T., Hardison, R.C., Lacy, E., Lauer, J., O'Connell, C., Quon, D., Sim, G.K. and Efstratiadis, A., 1978. The isolation of structural genes from libraries of eucaryotic DNA. Cell, 15: 687-701. Metcalf, D., 1984. The Hemopoietic Colony Stimulating Factors. Elsevier Science Publishers, Amsterdam, xvi + 494 pp. Miyajima, A., Otsu, K., Schreurs, J., Bond, M.W., Abrams, J.S. and Arai, K., 1986. Expression of murine and human granulocyte-macrophage colony stimulating factors in S. cerevisiae; mutagenesis of the potential glycosylation sites. EMBO J., 5: 1193-1197. Mosmann, T.R., Cherwinski, H., Bond, M.W., Giedlin, M.A. and Coffman, R.L., 1986. Two types of murine helper T cell clone; I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol., 136: 2348-2356. Nagata, S., Tsuchiya, M., Asano, S., Kaziro, Y., Yamazaki, T., Yamamoto, O., Hirata, Y., Kubota, N., Oheda, M., Nomura, H. and Ono, M., 1986. Molecular cloning and expression of cDNA for human granulocyte colony stimulating factor. Nature, 319: 415-418. Nicola, N.A., Metcalf, D., Matsumoto, M. and Johnson, G.R., 1983. Purification of a factor inducing differentiation in murine myelomonocytic leukemia cells: identification as granulocyte colony-stimulating factor. J. Biol. Chem., 258: 9017-9021. Picken, R.N., Mazaitis, A.J., Maas, W.K., Rey, M. and Heyneker, H., 1983. Nucleotide sequence of the gene for heat-stable enterotoxin II of Escherichia coll. Infect. Immun., 42: 269-279. Reeves, R., Spies, A.G., Nissen, M.S., Buck, C.D., Weinberg, A.D., Barr, P.J., Magnuson, N.S. and Magnuson, J.A., 1986. Molecular cloning of a functional bovine interleukin 2 cDNA. Proc. Natl. Acad. Sci. U.S.A., 83: 3228-3232. Shaw, G. and Kamen, R., 1986. A conserved AU sequence from the 3' untranslated region of GMCSF mRNA mediates selective mRNA degradation. Cell, 46: 659-667. Smith, A.J.H., 1980. DNA sequence analysis by primed synthesis. Methods Enzymol., 65: 560580. Southern, E.M., 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol., 98: 503-517.

278 Sparrow, L.G., Metcalf, D., Hunkapillar, M.W., Hood, L.E. and Burgess, A.W., 1985. Purification and partial amino acid sequence of asialo murine granulocyte-macrophage colony stimulating factor. Proc. Natl. Acad. Sci. U.S.A., 82: 292-296. Stanley, E., Metcalf, D., Sobieszczuk, P., Gough, N.M. and Dunn, A.R., 1985. The structure and expression of the routine gene encoding granulocyte-macrophage colony stimulating factor: evidence for utilization of alternative promoters. EMBO J., 4: 2569-2573. Thomas, P,S., 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. U.S.A., 77: 5201-5205. Tsuchiya, M., Asano, S., Kaziro, Y. and Nagata, S., 1986. Isolation and characterization of the cDNA for routine granulocyte colony-stimulating factor. Proc. Natl. Acad. Sci. U.S.A., 83: 7633-7637. Vieira, J. and Messing, J., 1987. Production of single stranded DNA. Methods Enzymol., 153: 311. Walker, F. and Burgess, A.W., 1985. Specific binding of radioiodinated granulocyte-macrophage colony-stimulating factor to hemopoietic cells. EMBO J., 4: 933-937. Wong, G.G., Witek, J., Temple, P.A., Wilkens, K.M., Leafy, A.C., Luxemberg, D.P., Jones, S.S., Brown, E.L., Kay, R.M., Orr, E.C., Shoemaker, C., Golde, D.W., Kaufman, R.J., Hewick, R.M., Wang, E.A. and Clark, S.C., 1985. Human GM-CSF: molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science, 228: 810-814. Woods, A., West, J., Rasmussen, R. and Bottomly, K., 1987. Granulocyte-macrophage colony stimulating factor produced by cloned L3T4 +, class II-restricted T cells induces HT-2 cells to proliferate. J. Immunol., 138: 4293-4297. Yang, Y.-C., Ciarletta, A.B., Temple, P.A., Chung, M.P., Kovacic, S., Witek-Gianotti, J.S., Leary, A.C., Kriz, R., Donahue, R.E., Wong, G.G. and Clark, S.C., 1986. Human IL-3 (multi-CSF): identification by expression cloning of a novel hematopoietic growth factor related to murine IL-3. Cell, 47: 3-10.