- Email: [email protected]
Cloning and expression of Tsaiya duck liver fatty acid binding protein1
Cloning and Expression of Tsaiya Duck Liver Fatty Acid Binding Protein1 Y. H. Ko, C. H. Cheng, T. F. Shen, and S. T. Ding2 Department of Animal Science, National Taiwan University, Taipei, Taiwan sequence was confirmed. The greater expression of the hepatic Lb-FABP in the egg-laying Tsaiya ducks than the prelaying ducks paralleled the higher FA use by the laying ducks. These results suggest that hepatic Lb-FABP may be needed for egg production when FA metabolism is high for the ducks. Feeding laying Tsaiya ducks with diets enriched with 2% docosahexaenoic acid (DHA) oil for 2 wk significantly increased hepatic DHA content compared with in ducks fed a 2% butter basal diet. There was no effect of dietary DHA enrichment on the expression of Lb-FABP in the liver of Tsaiya ducks. The results suggest that even though the Lb-FABP may be involved in hepatic FA metabolism, the effect of individual FA on liver Lb-FABP in laying Tsaiya ducks needs to be further studied.
(Key words: Tsaiya duck, laying, liver, gene expression, liver basic fatty acid-binding protein) 2004 Poultry Science 83:1832–1838
INTRODUCTION The primary site of de novo fatty acid (FA) synthesis in avian species is the liver (Leveille et al., 1968). In addition to the enzymes involved in the synthesis procedures, cytosolic proteins with low molecular weight (12 to 15 kD) that bind FA [i.e., FA-binding protein (FABP)] with high affinity have been proposed to transport FA to different metabolic sites (Ockner et al., 1972; Glatz et al., 1985, 1993; Glatz and Veerkamp, 1985; Huang et al., 2002). Huang et al. (2002) showed that liver FABP (L-FABP) enhanced uptake and intracellular targeting of long and medium chain fatty acids to the nucleus to enhance the interaction of FA with transcription factors that might regulate gene expression. Two forms of hepatic FABP have been purified from chicken livers. One is a basic form (liver basic FABP; LbFABP) with a molecular weight of 16 kD and an isoelectric point (pI) of 9.0 (Scapin et al., 1988) and the other form (LFABP) with a molecular weight of 14 kD and a pI of 7.0 (Collins and Hargis, 1989; Sewell et al., 1989). It has been documented that the ontogeny of FABP in turkey liver
2004 Poultry Science Association, Inc. Received for publication April 4, 2004 Accepted for publication July 26, 2004 1 This work was supported by Council of Agriculture in Taiwan. 2 To whom correspondence should be addressed: [email protected]. 3 CP Feed Company, Taipei, Taiwan.
and intestine is associated with FA metabolism in turkey embryos and poults (Ding et al., 2002; Ding and Lilburn, 2002). Because the gene sequence for Lb-FABP in Tsaiya ducks is not known, one objective of the current study was to clone Lb-FABP from the Tsaiya duck. Other objectives were to determine the effects of the onset of egg laying and dietary docosahexaenoic acid (DHA) on the mRNA concentrations of Lb-FABP mRNA in the livers of Tsaiya ducks.
MATERIALS AND METHODS Ducks and Treatments Tsaiya ducks (Anas platyrhynchos var. domestica), purchased from a commercial farm at 7 wk of age, were raised at the farm facility at the National Taiwan University. The animal protocols were approved by the Animal Care and Use Committee at National Taiwan University. The ducks were raised in individual cages and offered growing diets3 containing 16% CP and 2,800 kcal/kg ME on an as-fed basis, ad libitum. The ducks were then fed layer diets from 20 wk of age under a lighting program of 15L:9D.
Abbreviation Key: DHA = docosahexanoic acid; FA = fatty acid; LFABP = liver fatty acid binding protein; Lb-FABP = liver basic type fatty acid binding protein; pI = isoelectric point.
1832
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
ABSTRACT Liver basic fatty acid (FA)-binding protein (Lb-FABP) cDNA was cloned from the livers of laying Tsaiya ducks and used to generate probes for quantification of the Lb-FABP mRNA in Tsaiya ducks. The fulllength Lb-FABP cDNA of the Tsaiya duck was highly homologous with that of the mallard (99%), chicken (88%), and iguana (73%). The amino acid sequence was also highly homologous to Lb-FABP found in birds and reptiles, indicating a similar function of the Tsaiya duck Lb-FABP to those species. The calculated molecular weight for the cloned duck Lb-FABP was 14,043g/mol. The Lb-FABP was highly expressed in the liver of laying Tsaiya ducks and not detectable in heart, ovary, intestine, or adipose tissues. The expression of Tsaiya duck LbFABP in the skeletal muscle was also detected, and the
1833
DUCK FATTY ACID BINDING PROTEIN TABLE 1. Dietary composition
TABLE 2. Fatty acid compositions of experimental diets
Diet1 Ingredient, % Yellow corn, % Soybean meal, % Butter, % DHA oil,1 % Dicalcium phosphate, % Limestone, pulverized, % Salt, iodized, % Vitamin-premix,2 % Mineral-premix,3 % DL-Methionine, % Calculated value CP, % ME, kcal/kg Ca, %
Control 61.27 26.65 2.00 0.00 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
0.5% DHA oil 61.27 26.65 1.50 0.50 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
Fatty acid profile
Experiment 1 used 4 ducks with very high egg production rates (>80%) to clone Lb-FABP cDNA. From these ducks, tissues (liver, leg muscle, heart, ovary, small intestine, and abdominal adipose tissue) were taken to study the tissue distribution of the Lb-FABP mRNA. Experiment 2 was conducted to compare the differences of gene expression between ducks before laying and ducks that had reached the plateau of egg production. Tissue samples were taken from 5 ducks before the first egg was laid and from 5 ducks of the same population at an egg production rate of 80% (30 wk old) to determine the LbFABP mRNA concentrations. The average BW for 5 ducks before laying and 5 ducks after laying were 1.11 and 1.35 kg, respectively. In experiment 3, 30 laying Tsaiya ducks (approximately 42 wk of age) were raised in individual cages. Ducks were allocated into 3 groups of 10 ducks each and were fed experimental diets based on a cornsoybean meal diet (2,803 kcal/kg ME, 17.1% CP, and 3.4% Ca on an as-fed basis) supplemented with 0, 0.5, or 2%, algal DHA oil (Table 1). The differences in dietary fat content were balanced by adding butter. After laying ducks were fed the control diet (0% DHA + 2% butter) for 1 wk to adapt to the experimental diet, birds were fed ad libitum with the experimental diets for 14 d. Ducks were then killed at the 14th day without feed withdrawal, and liver samples were removed, wrapped in foil, frozen in liquid nitrogen,
4
Life Technologies, Carlsbad, CA. 5 Promega, Madison, WI. 6 ABI, Foster City, CA. 7 Scientific and Educational Software, Durham, NC. 8 Amersham-Pharmacia Biotech Ltd., Amersham, Bucks, UK.
16:0 16:1 18:0 18:1 18:2 18:3 20:4 22:6
n-6 n-3 n-6 n-3
18.33 4.34 8.90 40.39 22.08 3.97 1.59 0.00
19.46 4.92 7.95 38.81 20.76 3.70 1.39 1.98
21.64 5.11 8.00 36.99 21.82 3.54 1.17 6.32
1
Docosahexanoic acid. Total fatty acids = C14:0 + C14:1 + C16:0 + C16:1 + C18:0 + C18:1 + C18:2 + C18:3 + C20:0 + C20:1 + C20:4 + C20:5 + C24:0 + C24:1 + C22:6. 2
and stored at −70°C until analysis of DHA content and mRNA concentration of Lb-FABP. Total RNA was extracted by the guanidinium-phenol-chloroform extraction method of Chomczynski and Sacchi (1987), as described previously (Hsu and Ding, 2003).
Cloning of the Duck Lb-FABP Gene Liver total RNA from one Tsaiya duck was reverse transcribed at 42°C with a SuperScript II kit.4 The transcribed cDNA was amplified by PCR for 35 cycles, using paired sense (ACACTGCGTTGTACCTTCCA) and antisense (AGAGGTGTCACGAGGAAGGT) primers designed from a mallard Lb-FABP mRNA sequence that covered the sequence of the full open reading frame. The conditions for PCR were denaturation at 94°C for 30 s (5 min in the first cycle), annealing at 58°C for 30 s, and extension at 72°C for 1 min (11 min in the final cycle). The PCR products were purified by gel electrophoresis and gel extraction. The PCR products were cloned into pGEM T-Easy vector using the Promega kit.5 Sequences were determined using a modification of the Sanger et al. (1977) method with fluorescent dideoxy termination in an automated Applied Biosystems 3100 DNA Sequencer.6 Sequence comparisons were performed with the Align Plus 2 software program.7
Northern Analysis The mRNA concentrations of Lb-FABP and 18S were quantified by Northern blot analysis. Twenty micrograms of total RNA was electrophoresed and transferred to a Hybond-N+ nylon membrane.8 The membranes TABLE 3. Effect of dietary algal DHA on docosahexaenoic acid (DHA) on DHA levels in livers of laying Tsaiya ducks1 Liver DHA concentration
Control (2% butter)
0.5% DHA oil
2% DHA oil
Total fatty acids2 (%)
1.43 ± 0.59B
4.43 ± 1.13C
10.13 ± 3.91A
A-C Means within the same row with no common superscripts differ significantly (P < 0.01). 1 Means ± SD. 2 Total fatty acids = C14:0 + C14:1 + C16:0 + C16:1 + C18:0 + C18:1 + C18:2 + C18:3 + C20:0 + C20:1 + C20:4 + C20:5 + C24:0 + C24:1 + C22:6.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
1 Docosahexanoic acid (DHA) oil was extracted from alga and contained 0.56% C10:0, 3.29% C12:0, 11.33% C14:0, 0.18% C14:1, 10.55% C16:0, 2.12% C16:1, 0.98% C18:0, 24.52% C18:1n-9, 1.11% C18:2n-6, <0.1% C18:3n-3, <0.1% C20:4n-6, <0.1% C20:5n-3, 0.24% C22:5n-3, and 43.90% C22:6n-3 (Martek Biosciences Corp., Columbia, MD). 2 Supplied per kilogram of diet: vitamin A, 11,250 IU; vitamin D3, 1,200 IU; vitamin E, 37.5 IU; vitamin K, 2 mg; vitamin B1, 2.6 mg; vitamin B2, 8 mg; vitamin B6, 3 mg; pantothenic acid, 15 mg; niacin, 60 mg; biotin, 0.2 mg; folic acid, 0.65 mg; and vitamin B12, 0.013 mg. 3 Supplied per kilogram of diet: Cu, 10 mg; Fe, 100 mg; Mn, 60 mg; Zn, 65 mg; and Se, 0.15 mg.
2% DHA oil
(% of total fatty acids2)
2% DHA oil 61.27 26.65 0.00 2.00 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
0.5% DHA1 oil
Control
1834
KO ET AL.
were hybridized with each probe labeled with Psoranlen-Biotin using a nonisotopic labeling kit9 and then detected by a BrightStar BioDetect kit.9 The membranes were exposed to Kodak BioMax Light film.10 The films were processed with GBX developer10 for 1 to 4 min, rinsed under running water for 30 s, and fixed with GBX fixer9 for 4 min. Abundance of each RNA was quantified by its color density.
FA Analysis
Statistical Analysis The data for transcript concentrations were analyzed using a one-way ANOVA with tissue or dietary treatment as main effects. The significant differences between treatments were tested by Duncan’s new multiple test (SAS Institute, 2001). The means and SE for each transcript were presented.
RESULTS AND DISCUSSION The cloned full-length Lb-FABP cDNA of the Tsaiya duck was sequenced, and the homologies between the Tsaiya duck and the mallard (GenBank AF440683), chicken (AF380998), Iquana (U28756), and zebrafish (NM 152960) sequences were 99, 88, 73, and 69%, respectively (Figure 1). The amino acid sequence of the Tsaiya duck Lb-FABP was deduced from the cDNA sequence. It was a small protein with 126 amino acids and molecular weight of 14,043 g/mol, similar to that of mallards (GenBank AF440683) and domestic chickens (Sewell et al., 1989). The predicted pI for the cloned duck Lb-FABP13 was 8.52 similar to the chicken Lb-FABP with a predicted pI of 8.69 using the same software; the measured pI for the chicken Lb-FABP was 9.0 (Scapin et al., 1988). The Lb-FABP amino acid sequence of the Tsaiya duck was very similar to those of the mallard (98%), chicken (91%), iguana (76%), and zebrafish (71%) (Figure 2). The similar amino acid sequences among poultry species suggest that the functions of Lb-FABP in these fowls are similar.
9
Ambion, Inc., Austin, TX. Eastman Kodak Co., New Haven, CT. 11 Supleco Inc., Elysian, MN. 12 NuCheck Prep Inc., Elysian, MN. 13 Determined by Sequence Analyzer at http://www.protein chemist.com. 10
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
Total lipids were extracted with chloroform:methanol (2:1 vol/vol) according to the procedure of Folch et al. (1957). Briefly, 1 g of diet or 0.5 g of liver tissue was used for extracting total lipids. Total lipids were then converted to FA methyl esters and separated by gas chromatography on a 30 m × 0.25 mm i.d., 0.20 µm film thickness, SP-2380 capillary column11 with a Varian Star 3400cx gas chromatograph equipped with a hydrogen flame-ionization detector. Individual FA was identified by comparison with the retention times of standards.12
The Lb-FABP gene was highly expressed in the liver and, to a lesser extent, in leg skeletal muscle of the Tsaiya duck and was not detectable in the heart, ovary, small intestine, or abdominal fat (Figure 3). Because the expression of the Lb-FABP gene in skeletal muscle was not expected, the presence of Lb-FABP mRNA was also confirmed in all the samples using reverse transcription PCR (data not shown). The gene sequence for skeletal muscle Lb-FABP was determined and confirmed as LbFABP. Because the Lb-FABP mRNA concentration in the duck muscle tissue is relatively low, we speculated that it might assist other major muscle FABP for transportation of FA in this tissue. The high expression of Lb-FABP in the liver confirms similar observations in domestic chickens (Collins and Hargis, 1989) and suggests a similar function of this protein in Tsaiya ducks as in other species. The Lb-FABP was expressed highly in the livers of laying Tsaiya ducks, and a lower level was detected in prelaying Tsaiya ducks (Figure 4). The laying duck hepatic Lb-FABP mRNA was about 30% higher than that in prelaying ducks. Hepatic FA metabolism in laying ducks was much higher than that in prelaying ducks because the layers need to assemble yolk lipids for the egg yolk lipid accumulation. Laying creates a demand to move more fat into assembly of yolk lipids and suggests greater Lb-FABP is required for the FA movement in cytosol of hepatocytes. Similar results were reported by Sewell et al. (1989) who showed that the concentrations of L-FABP protein from chickens were highest in 1-d-old chicks and laying hens compared with juvenile birds, suggesting that the L-FABP level in the liver parallels the physiological lipid metabolism activity. The liver FA composition reflected the dietary FA composition to some extent (Table 2). The DHA content in the liver increased as the level of DHA oil increased in the diet (P < 0.01, Table 3). The mRNA concentration of hepatic Lb-FABP in laying Tsaiya ducks was similar in butter-fed and DHA oil-fed birds (Figure 5, P > 0.05). These data indicated that increased dietary DHA had no effect on the expression of Lb-FABP in the liver of Tsaiya ducks. It has been well established that dietary fat and clofibrate increase the expression of hepatic FABP in liver (Bass et al., 1985; Bass, 1990). In a rat hepatoma cell culture system, Meunier-Durmort et al. (1996) showed that the addition of palmitic, oleic, linoleic, linolenic, or arachidonic acid to media all increased the expression of L-FABP. Although the role of liver type FABP in fatty acid and lipid metabolism is not well defined, it has been shown that L-FABP binds not only FA but also sterols; the L-FABP may enhance FA and sterol transfer between different cellular compartments (Ockner et al., 1972; Woodford et al., 1995; Luxon et al., 2000). It is also well described that clofibrates increase the expression of LFABP and FA influx and efflux concomitantly (Bass et al., 1985; Nakagawa et al., 1994; Luxon et al., 2000), indicating a role of L-FABP in FA metabolism. Because FA metabolism paralleled the change in tissue levels of
DUCK FATTY ACID BINDING PROTEIN
1835
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 1. Full length cDNA sequence for the Tsaiya duck liver-basic fatty acid-binding protein (Lb-FABP). This fragment was obtained from Tsaiya duck liver. The boldface type sequences are primer sequences for the reverse transcription PCR. Dots indicate the same nucleotides. The homologies between the Tsaiya duck and the mallard (AF440683), chicken (AF380998), iguana (U28756), and zebrafish (NM 152960) sequences were 99, 90, 74, and 67%, respectively. The mallard sequence was from 52 to 432 nucleotides, chicken sequence was from 60 to 440 nucleotides, iguana sequence was from 33 to 413 nucleotides, and zebrafish sequence was from 13 to 393 nucleotides.
L-FABP, Haq and Shrago (1985) speculated that L-FABP might have a role in lipid metabolism through its interaction with enzymes. Murphy et al. (1996) used a cell culture system to overexpress L-FABP and found that LFABP not only stimulated FA uptake but also increased intracellular esterification of exogenously supplied FA. Additional evidence from an L-FABP null mouse model showed that L-FABP was an important determinant for
hepatic lipid deposition and turnover (Martin et al., 2003). The current study is the first to report cloned Tsaiya duck Lb-FABP cDNA full-length sequence. This sequence is highly homologous to that of mallards and chickens, indicating a close genetic relationship between these birds. In our study, we have found that although the expression of Lb-FABP was affected by different
1836
KO ET AL.
physiological conditions (laying or not), the dietary DHA content did not affect its expression. Because only one subtype of FABP was studied, the effects on other subtypes are not known. Poirier et al. (1997) found a dose-related increase in L-FABP mRNA and protein levels in the duodenum and proximal jejunum with infusion of a minute quantity of linoleic acid, and the upregulation was mediated in a dose-dependent man-
FIGURE 3. The tissue distribution on liver basic fatty acid-binding protein (Lb-FABP) in laying Tsaiya ducks. Total RNA was isolated from liver (L), leg muscle (LM), heart (H) ovary (O), small intestine (SI), and abdominal fat (AF) of 30-wk-old laying Tsaiya ducks. Twenty micrograms of total RNA was electrophoresed and transferred to nylon membranes. The membranes were hybridized with Tsaiya duck probes for Lb-FABP and 18S rRNA (18S). These data represent the average of 4 birds. The data for a given gene fragment were obtained from a single hybridization with a single probe so that data could be compared across tissues. The data in each lane were corrected for the value of the 18S rRNA in that lane. The SE is indicated by the bar in the graph. The upper panel indicates the images from representative Northern blots for the tissues. The size of the primary transcript detected in Tsaiya duck total RNA samples by each gene fragment was Lb-FABP = 0.7 kb, 18S = 1.9 kb. **Significant difference (P < 0.01).
ner. They also found that although the L-FABP was increased, the intestinal FABP expression was not affected. Ding and Mersmann (2001) found that DHA stimulated the expression of adipocyte FABP to a greater extent than oleic acid in pig adipocyte cell culture. Therefore the effect of FA composition on FABP may
FIGURE 4. The mRNA concentrations of liver basic fatty acid-binding protein (Lb-FABP) in the livers of laying and prelaying Tsaiya ducks. Total RNA was isolated from liver of 18-wk-old (prelaying) and 30wk-old (laying) female ducks. Twenty micrograms of total RNA was electrophoresed and transferred to nylon membranes. The membranes were hybridized with duck DNA probes. The data are indicated arbitrary units offer normalization using 18S ribosomal RNA. Bars indicate SE of the means. The hepatic concentration of Lb-FABP mRNA was higher in the laying ducks than that of prelaying ducks. *Significant difference (P < 0.05).
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 2. The amino acid sequence for Tsaiya duck liver fatty acid-binding protein. The boldface type sequences are amino acids replaced by very different characteristic amino acids, whereas the regular type mismatch sequences indicate the conservative amino acid replacements. The amino acid sequence homologies between the Tsaiya duck and the mallard (AF440683), chicken (AF380998), iguana (U28756), and zebrafish (NM 152960) were 98, 91, 76, and 71%, respectively.
DUCK FATTY ACID BINDING PROTEIN
depend on the subtype of FABP. The current data demonstrated that dietary DHA or oleic acid did not differentially affect the expression of hepatic Lb-FABP in laying Tsaiya ducks. The effects of other FA await further investigation.
ACKNOWLEDGMENTS The authors thank M. K. Yeh and Y. M. Wong at National Taiwan University for their technical assistance. We also thank W. L. Chen at the Experimental Farm at National Taiwan University for her technical support.
REFERENCES Bass, N. M. 1990. Fatty acid-binding protein expression in the liver: its regulation and relationship to the zonation of fatty acid metabolism. Mol. Cell. Biochem. 98:167–176. Bass, N. M., J. A. Manning, R. K. Ockner, J. I. Gordon, S. Seetharam, and D. H. Alpers. 1985. Regulation of the biosynthesis of two distinct fatty acid-binding proteins in rat liver and intestine. Influence of sex difference and of clofibrate. J. Biol. Chem. 260:1432–1436. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenolchloroform extraction. Anal. Biochem. 162:156–159.
Collins, D. M., and P. S. Hargis. 1989. Distribution of fatty acid binding proteins in tissues and plasma of Gallus domesticus. Comp. Biochem. Physiol. 92B:283–289. Ding, S. T., and H. J. Mersmann. 2001. Fatty acids modulate porcine adipocyte differentiation and transcripts for transcription factors and adipocyte-characteristic proteins. J. Nutr. Biochem. 12:101–108. Ding, S. T., and M. S. Lilburn. 2002. The ontogeny of fatty acidbinding protein in turkeys (Meleagridis gallopavo) intestine and yolk sac membrane during embryonic and early posthatch development. Poult. Sci. 81:1065–1070. Ding, S. T., W. L. Bacon, and M. S. Lilburn. 2002. The development of an immunoblotting assay for the quantification of liver fatty acid-binding protein during embryonic and early posthatch development of turkeys (Meleagridis gallopavo). Poult. Sci. 81:1057–1064. Folch, J., M. Lees, and G. H. S. Stanley. 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226:497–509. Glatz, J. F. C., A. M. Janssen, C. C. F. Baerwaldt, and J. K. Veerkamp. 1985. Purification and characterization of fatty acid-binding proteins from rat heart and liver. Biochim. Biophys. Acta 837:57–66. Glatz, J. F. C., and J. K. Veerkamp. 1985. Intracellular fatty acidbinding proteins. Int. J. Biochem. 17:13–22. Glatz, J. F. C., M. M. Vork, D. P. Cisola, and G. J. van der Vusse. 1993. Cytoplasmic fatty acid-binding proteins: Significance for intracellular transport of fatty acids and putative role on signal transduction pathways. Prostaglandins Leukot. Essent. Fatty Acids 48:33–41. Haq, R. U., and E. Shrago. 1985. Dietary and nutritional aspects of fatty acid binding proteins. Chem. Phys. Lipids 38:131–135. Hsu, J. M., and S. T. Ding. 2003. Effect of polyunsaturated fatty acids on the expression of transcription factor adipocyte determination and differentiation-dependent factor 1 and of lipogenic and fatty acid oxidation enzymes in porcine differentiating adipocytes. Br. J. Nutr. 90:507–513. Huang, H., O. Starodub, A. McIntosh, A. B. Kier, and F. Schroeder. 2002. Liver fatty acid-binding protein targets fatty acids to the nucleus. Real time confocal and multiphoton fluorescence imaging in living cells. J. Biol. Chem. 277:29139–29151. Leveille, G. A., E. K. O’Hea, and K. Chkrabarty. 1968. In vivo lipogenesis in the domestic chicken. Proc. Soc. Exp. Biol. Med. 128:398–401. Luxon, B. A., M. T. Milliano, and R. A. Weisiger. 2000. Induction of hepatic cytosolic fatty acid binding protein with clofibrate accelerates both membrane and cytoplasmic transport of palmitate. Biochim. Biophys. Acta 1487:309–318. Martin, G. G., H. Danneberg, L. S. Kumar, B. P. Atshaves, E. Erol, M. Bader, F. Schroeder, and B. Binas. 2003. Decreased liver fatty acid binding capacity and altered liver lipid distribution in mice lacking the liver fatty acid-binding protein gene. J. Biol. Chem. 278:21429–21438. Meunier-Durmort, C., H. Poirier, I. Niot, C. Forest, and P. Besnard. 1996. Up-regulation of the expression of the gene for liver fatty acid- binding protein by long-chain fatty acids. Biochem. J. 319:483–487. Murphy, E. J., D. R. Prows, J. R. Jefferson, and F. Schroeder. 1996. Liver fatty acid-binding protein expression in transfected fibroblasts stimulates fatty acid uptake and metabolism. Biochim. Biophys. Acta 1301:191–198. Nakagawa, S., Y. Kawashima, A. Hirose, and H. Kozuka. 1994. Regulation of hepatic level of fatty-acid-binding protein by hormones and clofibric acid in the rat. Biochem. J. 297:581–584. Ockner, R. K., J. A. Manning, R. B. Poppenhausen, and W. K. L. Ho. 1972. A binding protein for fatty acids in cytosol of intestinal mucosa, liver, myocardium, and other tissues. Science 177:56–58.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 5. The effect of dietary algal docosahexanoic acid (DHA) supplement on the abundance of liver basic fatty acid-binding protein mRNA in laying Tsaiya duck. Tsaiya ducks were fed 0, 0.5, or 2% DHA oil for 14 d (10 ducks per group). On the day of sampling, ducks were killed 2 h after feeding. The liver basic fatty acid-binding protein (LbFABP) mRNA and 18S rRNA concentrations were determined by Northern analysis. The Lb-FABP mRNA abundances were depicted relative to the control. The mRNA values were normalized to the 18S rRNA content in the same sample. There was no detectable treatment effect (P > 0.05).
1837
1838
KO ET AL.
Poirier, H., I. Niot, P. Degrace, M. C. Monnot, A. Bernard, and P. Besnard. 1997. Fatty acid regulation of fatty acid-binding protein expression in the small intestine. Am. J. Physiol. 273:G289–G295. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitor. Proc. Natl. Acad. Sci. USA 74:5463–5467. SAS Institute. 2001. SAS User’s Guide: Statistics. SAS Institute Inc., Cary, NC. Scapin, G., P. Spadon, L. Pengo, M. Mammi, G. Zanotti, and H. L. Monaco. 1988. Chicken liver basic fatty acid-binding
protein (PI = 9.0): Purification, crystallization and preliminary x-ray data. FEBS Lett. 240:196–200. Sewell, J. E., S. K. Davis, and P. S. Hargis. 1989. Isolation, characterization, and expression of fatty acid binding protein in the liver of Gallus domesticus. Comp. Biochem. Physiol. B 92:509–516. Woodford, J. K., W. D. Behnke, and F. Schroeder. 1995. Liver fatty acid binding protein enhances sterol transfer by membrane interaction. Mol. Cell. Biochem. 152:51–62.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
(Key words: Tsaiya duck, laying, liver, gene expression, liver basic fatty acid-binding protein) 2004 Poultry Science 83:1832–1838
INTRODUCTION The primary site of de novo fatty acid (FA) synthesis in avian species is the liver (Leveille et al., 1968). In addition to the enzymes involved in the synthesis procedures, cytosolic proteins with low molecular weight (12 to 15 kD) that bind FA [i.e., FA-binding protein (FABP)] with high affinity have been proposed to transport FA to different metabolic sites (Ockner et al., 1972; Glatz et al., 1985, 1993; Glatz and Veerkamp, 1985; Huang et al., 2002). Huang et al. (2002) showed that liver FABP (L-FABP) enhanced uptake and intracellular targeting of long and medium chain fatty acids to the nucleus to enhance the interaction of FA with transcription factors that might regulate gene expression. Two forms of hepatic FABP have been purified from chicken livers. One is a basic form (liver basic FABP; LbFABP) with a molecular weight of 16 kD and an isoelectric point (pI) of 9.0 (Scapin et al., 1988) and the other form (LFABP) with a molecular weight of 14 kD and a pI of 7.0 (Collins and Hargis, 1989; Sewell et al., 1989). It has been documented that the ontogeny of FABP in turkey liver
2004 Poultry Science Association, Inc. Received for publication April 4, 2004 Accepted for publication July 26, 2004 1 This work was supported by Council of Agriculture in Taiwan. 2 To whom correspondence should be addressed: [email protected]. 3 CP Feed Company, Taipei, Taiwan.
and intestine is associated with FA metabolism in turkey embryos and poults (Ding et al., 2002; Ding and Lilburn, 2002). Because the gene sequence for Lb-FABP in Tsaiya ducks is not known, one objective of the current study was to clone Lb-FABP from the Tsaiya duck. Other objectives were to determine the effects of the onset of egg laying and dietary docosahexaenoic acid (DHA) on the mRNA concentrations of Lb-FABP mRNA in the livers of Tsaiya ducks.
MATERIALS AND METHODS Ducks and Treatments Tsaiya ducks (Anas platyrhynchos var. domestica), purchased from a commercial farm at 7 wk of age, were raised at the farm facility at the National Taiwan University. The animal protocols were approved by the Animal Care and Use Committee at National Taiwan University. The ducks were raised in individual cages and offered growing diets3 containing 16% CP and 2,800 kcal/kg ME on an as-fed basis, ad libitum. The ducks were then fed layer diets from 20 wk of age under a lighting program of 15L:9D.
Abbreviation Key: DHA = docosahexanoic acid; FA = fatty acid; LFABP = liver fatty acid binding protein; Lb-FABP = liver basic type fatty acid binding protein; pI = isoelectric point.
1832
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
ABSTRACT Liver basic fatty acid (FA)-binding protein (Lb-FABP) cDNA was cloned from the livers of laying Tsaiya ducks and used to generate probes for quantification of the Lb-FABP mRNA in Tsaiya ducks. The fulllength Lb-FABP cDNA of the Tsaiya duck was highly homologous with that of the mallard (99%), chicken (88%), and iguana (73%). The amino acid sequence was also highly homologous to Lb-FABP found in birds and reptiles, indicating a similar function of the Tsaiya duck Lb-FABP to those species. The calculated molecular weight for the cloned duck Lb-FABP was 14,043g/mol. The Lb-FABP was highly expressed in the liver of laying Tsaiya ducks and not detectable in heart, ovary, intestine, or adipose tissues. The expression of Tsaiya duck LbFABP in the skeletal muscle was also detected, and the
1833
DUCK FATTY ACID BINDING PROTEIN TABLE 1. Dietary composition
TABLE 2. Fatty acid compositions of experimental diets
Diet1 Ingredient, % Yellow corn, % Soybean meal, % Butter, % DHA oil,1 % Dicalcium phosphate, % Limestone, pulverized, % Salt, iodized, % Vitamin-premix,2 % Mineral-premix,3 % DL-Methionine, % Calculated value CP, % ME, kcal/kg Ca, %
Control 61.27 26.65 2.00 0.00 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
0.5% DHA oil 61.27 26.65 1.50 0.50 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
Fatty acid profile
Experiment 1 used 4 ducks with very high egg production rates (>80%) to clone Lb-FABP cDNA. From these ducks, tissues (liver, leg muscle, heart, ovary, small intestine, and abdominal adipose tissue) were taken to study the tissue distribution of the Lb-FABP mRNA. Experiment 2 was conducted to compare the differences of gene expression between ducks before laying and ducks that had reached the plateau of egg production. Tissue samples were taken from 5 ducks before the first egg was laid and from 5 ducks of the same population at an egg production rate of 80% (30 wk old) to determine the LbFABP mRNA concentrations. The average BW for 5 ducks before laying and 5 ducks after laying were 1.11 and 1.35 kg, respectively. In experiment 3, 30 laying Tsaiya ducks (approximately 42 wk of age) were raised in individual cages. Ducks were allocated into 3 groups of 10 ducks each and were fed experimental diets based on a cornsoybean meal diet (2,803 kcal/kg ME, 17.1% CP, and 3.4% Ca on an as-fed basis) supplemented with 0, 0.5, or 2%, algal DHA oil (Table 1). The differences in dietary fat content were balanced by adding butter. After laying ducks were fed the control diet (0% DHA + 2% butter) for 1 wk to adapt to the experimental diet, birds were fed ad libitum with the experimental diets for 14 d. Ducks were then killed at the 14th day without feed withdrawal, and liver samples were removed, wrapped in foil, frozen in liquid nitrogen,
4
Life Technologies, Carlsbad, CA. 5 Promega, Madison, WI. 6 ABI, Foster City, CA. 7 Scientific and Educational Software, Durham, NC. 8 Amersham-Pharmacia Biotech Ltd., Amersham, Bucks, UK.
16:0 16:1 18:0 18:1 18:2 18:3 20:4 22:6
n-6 n-3 n-6 n-3
18.33 4.34 8.90 40.39 22.08 3.97 1.59 0.00
19.46 4.92 7.95 38.81 20.76 3.70 1.39 1.98
21.64 5.11 8.00 36.99 21.82 3.54 1.17 6.32
1
Docosahexanoic acid. Total fatty acids = C14:0 + C14:1 + C16:0 + C16:1 + C18:0 + C18:1 + C18:2 + C18:3 + C20:0 + C20:1 + C20:4 + C20:5 + C24:0 + C24:1 + C22:6. 2
and stored at −70°C until analysis of DHA content and mRNA concentration of Lb-FABP. Total RNA was extracted by the guanidinium-phenol-chloroform extraction method of Chomczynski and Sacchi (1987), as described previously (Hsu and Ding, 2003).
Cloning of the Duck Lb-FABP Gene Liver total RNA from one Tsaiya duck was reverse transcribed at 42°C with a SuperScript II kit.4 The transcribed cDNA was amplified by PCR for 35 cycles, using paired sense (ACACTGCGTTGTACCTTCCA) and antisense (AGAGGTGTCACGAGGAAGGT) primers designed from a mallard Lb-FABP mRNA sequence that covered the sequence of the full open reading frame. The conditions for PCR were denaturation at 94°C for 30 s (5 min in the first cycle), annealing at 58°C for 30 s, and extension at 72°C for 1 min (11 min in the final cycle). The PCR products were purified by gel electrophoresis and gel extraction. The PCR products were cloned into pGEM T-Easy vector using the Promega kit.5 Sequences were determined using a modification of the Sanger et al. (1977) method with fluorescent dideoxy termination in an automated Applied Biosystems 3100 DNA Sequencer.6 Sequence comparisons were performed with the Align Plus 2 software program.7
Northern Analysis The mRNA concentrations of Lb-FABP and 18S were quantified by Northern blot analysis. Twenty micrograms of total RNA was electrophoresed and transferred to a Hybond-N+ nylon membrane.8 The membranes TABLE 3. Effect of dietary algal DHA on docosahexaenoic acid (DHA) on DHA levels in livers of laying Tsaiya ducks1 Liver DHA concentration
Control (2% butter)
0.5% DHA oil
2% DHA oil
Total fatty acids2 (%)
1.43 ± 0.59B
4.43 ± 1.13C
10.13 ± 3.91A
A-C Means within the same row with no common superscripts differ significantly (P < 0.01). 1 Means ± SD. 2 Total fatty acids = C14:0 + C14:1 + C16:0 + C16:1 + C18:0 + C18:1 + C18:2 + C18:3 + C20:0 + C20:1 + C20:4 + C20:5 + C24:0 + C24:1 + C22:6.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
1 Docosahexanoic acid (DHA) oil was extracted from alga and contained 0.56% C10:0, 3.29% C12:0, 11.33% C14:0, 0.18% C14:1, 10.55% C16:0, 2.12% C16:1, 0.98% C18:0, 24.52% C18:1n-9, 1.11% C18:2n-6, <0.1% C18:3n-3, <0.1% C20:4n-6, <0.1% C20:5n-3, 0.24% C22:5n-3, and 43.90% C22:6n-3 (Martek Biosciences Corp., Columbia, MD). 2 Supplied per kilogram of diet: vitamin A, 11,250 IU; vitamin D3, 1,200 IU; vitamin E, 37.5 IU; vitamin K, 2 mg; vitamin B1, 2.6 mg; vitamin B2, 8 mg; vitamin B6, 3 mg; pantothenic acid, 15 mg; niacin, 60 mg; biotin, 0.2 mg; folic acid, 0.65 mg; and vitamin B12, 0.013 mg. 3 Supplied per kilogram of diet: Cu, 10 mg; Fe, 100 mg; Mn, 60 mg; Zn, 65 mg; and Se, 0.15 mg.
2% DHA oil
(% of total fatty acids2)
2% DHA oil 61.27 26.65 0.00 2.00 1.11 8.00 0.30 0.30 0.20 0.17 17.1 2,803 3.41
0.5% DHA1 oil
Control
1834
KO ET AL.
were hybridized with each probe labeled with Psoranlen-Biotin using a nonisotopic labeling kit9 and then detected by a BrightStar BioDetect kit.9 The membranes were exposed to Kodak BioMax Light film.10 The films were processed with GBX developer10 for 1 to 4 min, rinsed under running water for 30 s, and fixed with GBX fixer9 for 4 min. Abundance of each RNA was quantified by its color density.
FA Analysis
Statistical Analysis The data for transcript concentrations were analyzed using a one-way ANOVA with tissue or dietary treatment as main effects. The significant differences between treatments were tested by Duncan’s new multiple test (SAS Institute, 2001). The means and SE for each transcript were presented.
RESULTS AND DISCUSSION The cloned full-length Lb-FABP cDNA of the Tsaiya duck was sequenced, and the homologies between the Tsaiya duck and the mallard (GenBank AF440683), chicken (AF380998), Iquana (U28756), and zebrafish (NM 152960) sequences were 99, 88, 73, and 69%, respectively (Figure 1). The amino acid sequence of the Tsaiya duck Lb-FABP was deduced from the cDNA sequence. It was a small protein with 126 amino acids and molecular weight of 14,043 g/mol, similar to that of mallards (GenBank AF440683) and domestic chickens (Sewell et al., 1989). The predicted pI for the cloned duck Lb-FABP13 was 8.52 similar to the chicken Lb-FABP with a predicted pI of 8.69 using the same software; the measured pI for the chicken Lb-FABP was 9.0 (Scapin et al., 1988). The Lb-FABP amino acid sequence of the Tsaiya duck was very similar to those of the mallard (98%), chicken (91%), iguana (76%), and zebrafish (71%) (Figure 2). The similar amino acid sequences among poultry species suggest that the functions of Lb-FABP in these fowls are similar.
9
Ambion, Inc., Austin, TX. Eastman Kodak Co., New Haven, CT. 11 Supleco Inc., Elysian, MN. 12 NuCheck Prep Inc., Elysian, MN. 13 Determined by Sequence Analyzer at http://www.protein chemist.com. 10
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
Total lipids were extracted with chloroform:methanol (2:1 vol/vol) according to the procedure of Folch et al. (1957). Briefly, 1 g of diet or 0.5 g of liver tissue was used for extracting total lipids. Total lipids were then converted to FA methyl esters and separated by gas chromatography on a 30 m × 0.25 mm i.d., 0.20 µm film thickness, SP-2380 capillary column11 with a Varian Star 3400cx gas chromatograph equipped with a hydrogen flame-ionization detector. Individual FA was identified by comparison with the retention times of standards.12
The Lb-FABP gene was highly expressed in the liver and, to a lesser extent, in leg skeletal muscle of the Tsaiya duck and was not detectable in the heart, ovary, small intestine, or abdominal fat (Figure 3). Because the expression of the Lb-FABP gene in skeletal muscle was not expected, the presence of Lb-FABP mRNA was also confirmed in all the samples using reverse transcription PCR (data not shown). The gene sequence for skeletal muscle Lb-FABP was determined and confirmed as LbFABP. Because the Lb-FABP mRNA concentration in the duck muscle tissue is relatively low, we speculated that it might assist other major muscle FABP for transportation of FA in this tissue. The high expression of Lb-FABP in the liver confirms similar observations in domestic chickens (Collins and Hargis, 1989) and suggests a similar function of this protein in Tsaiya ducks as in other species. The Lb-FABP was expressed highly in the livers of laying Tsaiya ducks, and a lower level was detected in prelaying Tsaiya ducks (Figure 4). The laying duck hepatic Lb-FABP mRNA was about 30% higher than that in prelaying ducks. Hepatic FA metabolism in laying ducks was much higher than that in prelaying ducks because the layers need to assemble yolk lipids for the egg yolk lipid accumulation. Laying creates a demand to move more fat into assembly of yolk lipids and suggests greater Lb-FABP is required for the FA movement in cytosol of hepatocytes. Similar results were reported by Sewell et al. (1989) who showed that the concentrations of L-FABP protein from chickens were highest in 1-d-old chicks and laying hens compared with juvenile birds, suggesting that the L-FABP level in the liver parallels the physiological lipid metabolism activity. The liver FA composition reflected the dietary FA composition to some extent (Table 2). The DHA content in the liver increased as the level of DHA oil increased in the diet (P < 0.01, Table 3). The mRNA concentration of hepatic Lb-FABP in laying Tsaiya ducks was similar in butter-fed and DHA oil-fed birds (Figure 5, P > 0.05). These data indicated that increased dietary DHA had no effect on the expression of Lb-FABP in the liver of Tsaiya ducks. It has been well established that dietary fat and clofibrate increase the expression of hepatic FABP in liver (Bass et al., 1985; Bass, 1990). In a rat hepatoma cell culture system, Meunier-Durmort et al. (1996) showed that the addition of palmitic, oleic, linoleic, linolenic, or arachidonic acid to media all increased the expression of L-FABP. Although the role of liver type FABP in fatty acid and lipid metabolism is not well defined, it has been shown that L-FABP binds not only FA but also sterols; the L-FABP may enhance FA and sterol transfer between different cellular compartments (Ockner et al., 1972; Woodford et al., 1995; Luxon et al., 2000). It is also well described that clofibrates increase the expression of LFABP and FA influx and efflux concomitantly (Bass et al., 1985; Nakagawa et al., 1994; Luxon et al., 2000), indicating a role of L-FABP in FA metabolism. Because FA metabolism paralleled the change in tissue levels of
DUCK FATTY ACID BINDING PROTEIN
1835
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 1. Full length cDNA sequence for the Tsaiya duck liver-basic fatty acid-binding protein (Lb-FABP). This fragment was obtained from Tsaiya duck liver. The boldface type sequences are primer sequences for the reverse transcription PCR. Dots indicate the same nucleotides. The homologies between the Tsaiya duck and the mallard (AF440683), chicken (AF380998), iguana (U28756), and zebrafish (NM 152960) sequences were 99, 90, 74, and 67%, respectively. The mallard sequence was from 52 to 432 nucleotides, chicken sequence was from 60 to 440 nucleotides, iguana sequence was from 33 to 413 nucleotides, and zebrafish sequence was from 13 to 393 nucleotides.
L-FABP, Haq and Shrago (1985) speculated that L-FABP might have a role in lipid metabolism through its interaction with enzymes. Murphy et al. (1996) used a cell culture system to overexpress L-FABP and found that LFABP not only stimulated FA uptake but also increased intracellular esterification of exogenously supplied FA. Additional evidence from an L-FABP null mouse model showed that L-FABP was an important determinant for
hepatic lipid deposition and turnover (Martin et al., 2003). The current study is the first to report cloned Tsaiya duck Lb-FABP cDNA full-length sequence. This sequence is highly homologous to that of mallards and chickens, indicating a close genetic relationship between these birds. In our study, we have found that although the expression of Lb-FABP was affected by different
1836
KO ET AL.
physiological conditions (laying or not), the dietary DHA content did not affect its expression. Because only one subtype of FABP was studied, the effects on other subtypes are not known. Poirier et al. (1997) found a dose-related increase in L-FABP mRNA and protein levels in the duodenum and proximal jejunum with infusion of a minute quantity of linoleic acid, and the upregulation was mediated in a dose-dependent man-
FIGURE 3. The tissue distribution on liver basic fatty acid-binding protein (Lb-FABP) in laying Tsaiya ducks. Total RNA was isolated from liver (L), leg muscle (LM), heart (H) ovary (O), small intestine (SI), and abdominal fat (AF) of 30-wk-old laying Tsaiya ducks. Twenty micrograms of total RNA was electrophoresed and transferred to nylon membranes. The membranes were hybridized with Tsaiya duck probes for Lb-FABP and 18S rRNA (18S). These data represent the average of 4 birds. The data for a given gene fragment were obtained from a single hybridization with a single probe so that data could be compared across tissues. The data in each lane were corrected for the value of the 18S rRNA in that lane. The SE is indicated by the bar in the graph. The upper panel indicates the images from representative Northern blots for the tissues. The size of the primary transcript detected in Tsaiya duck total RNA samples by each gene fragment was Lb-FABP = 0.7 kb, 18S = 1.9 kb. **Significant difference (P < 0.01).
ner. They also found that although the L-FABP was increased, the intestinal FABP expression was not affected. Ding and Mersmann (2001) found that DHA stimulated the expression of adipocyte FABP to a greater extent than oleic acid in pig adipocyte cell culture. Therefore the effect of FA composition on FABP may
FIGURE 4. The mRNA concentrations of liver basic fatty acid-binding protein (Lb-FABP) in the livers of laying and prelaying Tsaiya ducks. Total RNA was isolated from liver of 18-wk-old (prelaying) and 30wk-old (laying) female ducks. Twenty micrograms of total RNA was electrophoresed and transferred to nylon membranes. The membranes were hybridized with duck DNA probes. The data are indicated arbitrary units offer normalization using 18S ribosomal RNA. Bars indicate SE of the means. The hepatic concentration of Lb-FABP mRNA was higher in the laying ducks than that of prelaying ducks. *Significant difference (P < 0.05).
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 2. The amino acid sequence for Tsaiya duck liver fatty acid-binding protein. The boldface type sequences are amino acids replaced by very different characteristic amino acids, whereas the regular type mismatch sequences indicate the conservative amino acid replacements. The amino acid sequence homologies between the Tsaiya duck and the mallard (AF440683), chicken (AF380998), iguana (U28756), and zebrafish (NM 152960) were 98, 91, 76, and 71%, respectively.
DUCK FATTY ACID BINDING PROTEIN
depend on the subtype of FABP. The current data demonstrated that dietary DHA or oleic acid did not differentially affect the expression of hepatic Lb-FABP in laying Tsaiya ducks. The effects of other FA await further investigation.
ACKNOWLEDGMENTS The authors thank M. K. Yeh and Y. M. Wong at National Taiwan University for their technical assistance. We also thank W. L. Chen at the Experimental Farm at National Taiwan University for her technical support.
REFERENCES Bass, N. M. 1990. Fatty acid-binding protein expression in the liver: its regulation and relationship to the zonation of fatty acid metabolism. Mol. Cell. Biochem. 98:167–176. Bass, N. M., J. A. Manning, R. K. Ockner, J. I. Gordon, S. Seetharam, and D. H. Alpers. 1985. Regulation of the biosynthesis of two distinct fatty acid-binding proteins in rat liver and intestine. Influence of sex difference and of clofibrate. J. Biol. Chem. 260:1432–1436. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenolchloroform extraction. Anal. Biochem. 162:156–159.
Collins, D. M., and P. S. Hargis. 1989. Distribution of fatty acid binding proteins in tissues and plasma of Gallus domesticus. Comp. Biochem. Physiol. 92B:283–289. Ding, S. T., and H. J. Mersmann. 2001. Fatty acids modulate porcine adipocyte differentiation and transcripts for transcription factors and adipocyte-characteristic proteins. J. Nutr. Biochem. 12:101–108. Ding, S. T., and M. S. Lilburn. 2002. The ontogeny of fatty acidbinding protein in turkeys (Meleagridis gallopavo) intestine and yolk sac membrane during embryonic and early posthatch development. Poult. Sci. 81:1065–1070. Ding, S. T., W. L. Bacon, and M. S. Lilburn. 2002. The development of an immunoblotting assay for the quantification of liver fatty acid-binding protein during embryonic and early posthatch development of turkeys (Meleagridis gallopavo). Poult. Sci. 81:1057–1064. Folch, J., M. Lees, and G. H. S. Stanley. 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226:497–509. Glatz, J. F. C., A. M. Janssen, C. C. F. Baerwaldt, and J. K. Veerkamp. 1985. Purification and characterization of fatty acid-binding proteins from rat heart and liver. Biochim. Biophys. Acta 837:57–66. Glatz, J. F. C., and J. K. Veerkamp. 1985. Intracellular fatty acidbinding proteins. Int. J. Biochem. 17:13–22. Glatz, J. F. C., M. M. Vork, D. P. Cisola, and G. J. van der Vusse. 1993. Cytoplasmic fatty acid-binding proteins: Significance for intracellular transport of fatty acids and putative role on signal transduction pathways. Prostaglandins Leukot. Essent. Fatty Acids 48:33–41. Haq, R. U., and E. Shrago. 1985. Dietary and nutritional aspects of fatty acid binding proteins. Chem. Phys. Lipids 38:131–135. Hsu, J. M., and S. T. Ding. 2003. Effect of polyunsaturated fatty acids on the expression of transcription factor adipocyte determination and differentiation-dependent factor 1 and of lipogenic and fatty acid oxidation enzymes in porcine differentiating adipocytes. Br. J. Nutr. 90:507–513. Huang, H., O. Starodub, A. McIntosh, A. B. Kier, and F. Schroeder. 2002. Liver fatty acid-binding protein targets fatty acids to the nucleus. Real time confocal and multiphoton fluorescence imaging in living cells. J. Biol. Chem. 277:29139–29151. Leveille, G. A., E. K. O’Hea, and K. Chkrabarty. 1968. In vivo lipogenesis in the domestic chicken. Proc. Soc. Exp. Biol. Med. 128:398–401. Luxon, B. A., M. T. Milliano, and R. A. Weisiger. 2000. Induction of hepatic cytosolic fatty acid binding protein with clofibrate accelerates both membrane and cytoplasmic transport of palmitate. Biochim. Biophys. Acta 1487:309–318. Martin, G. G., H. Danneberg, L. S. Kumar, B. P. Atshaves, E. Erol, M. Bader, F. Schroeder, and B. Binas. 2003. Decreased liver fatty acid binding capacity and altered liver lipid distribution in mice lacking the liver fatty acid-binding protein gene. J. Biol. Chem. 278:21429–21438. Meunier-Durmort, C., H. Poirier, I. Niot, C. Forest, and P. Besnard. 1996. Up-regulation of the expression of the gene for liver fatty acid- binding protein by long-chain fatty acids. Biochem. J. 319:483–487. Murphy, E. J., D. R. Prows, J. R. Jefferson, and F. Schroeder. 1996. Liver fatty acid-binding protein expression in transfected fibroblasts stimulates fatty acid uptake and metabolism. Biochim. Biophys. Acta 1301:191–198. Nakagawa, S., Y. Kawashima, A. Hirose, and H. Kozuka. 1994. Regulation of hepatic level of fatty-acid-binding protein by hormones and clofibric acid in the rat. Biochem. J. 297:581–584. Ockner, R. K., J. A. Manning, R. B. Poppenhausen, and W. K. L. Ho. 1972. A binding protein for fatty acids in cytosol of intestinal mucosa, liver, myocardium, and other tissues. Science 177:56–58.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015
FIGURE 5. The effect of dietary algal docosahexanoic acid (DHA) supplement on the abundance of liver basic fatty acid-binding protein mRNA in laying Tsaiya duck. Tsaiya ducks were fed 0, 0.5, or 2% DHA oil for 14 d (10 ducks per group). On the day of sampling, ducks were killed 2 h after feeding. The liver basic fatty acid-binding protein (LbFABP) mRNA and 18S rRNA concentrations were determined by Northern analysis. The Lb-FABP mRNA abundances were depicted relative to the control. The mRNA values were normalized to the 18S rRNA content in the same sample. There was no detectable treatment effect (P > 0.05).
1837
1838
KO ET AL.
Poirier, H., I. Niot, P. Degrace, M. C. Monnot, A. Bernard, and P. Besnard. 1997. Fatty acid regulation of fatty acid-binding protein expression in the small intestine. Am. J. Physiol. 273:G289–G295. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitor. Proc. Natl. Acad. Sci. USA 74:5463–5467. SAS Institute. 2001. SAS User’s Guide: Statistics. SAS Institute Inc., Cary, NC. Scapin, G., P. Spadon, L. Pengo, M. Mammi, G. Zanotti, and H. L. Monaco. 1988. Chicken liver basic fatty acid-binding
protein (PI = 9.0): Purification, crystallization and preliminary x-ray data. FEBS Lett. 240:196–200. Sewell, J. E., S. K. Davis, and P. S. Hargis. 1989. Isolation, characterization, and expression of fatty acid binding protein in the liver of Gallus domesticus. Comp. Biochem. Physiol. B 92:509–516. Woodford, J. K., W. D. Behnke, and F. Schroeder. 1995. Liver fatty acid binding protein enhances sterol transfer by membrane interaction. Mol. Cell. Biochem. 152:51–62.
Downloaded from http://ps.oxfordjournals.org/ at Florida International University on June 8, 2015