Cloning and identification of the pig ribosomal gene promoter

Gene, 150 (1994) 375-379 0 1994 Elsevier Science B.V. All rights reserved. 0378-I 119/94/$07.00

375

GENE 08321

Cloning and identification of the pig ribosomal gene promoter (Transcription;

rRNA; polymerase chain reaction)

Xiaobing Ling* and Norman Arnheim Molecular Biology Program, University ofSouthern

Cul(fornia, Los Angeles, CA 90089-1340, USA

Received by J.L. Slightom: 9 April 1994; Revised/Accepte~ 28 June/6 July 1994; Received at publishers: 4 August 1994

SUMMARY

Pig ribosomal RNA-encoding gene (rl)NA) clones were obtained by screening a pig genomic DNA library. A 742-bp segment containing the promoter was sequenced. Using total pig RNA, the tsp (transcription start point) was defined by primer extension. A promoter-like region was found immediately upstream from the active promoter. Promoter function was studied by transfection of pig tissue culture cells and assayed by a highly sensitive RT-PCR method. Alignment of five mammalian YDNA promoter sequences, human, mouse, rat, rabbit and pig, showed five conserved subregions which may be important in transcriptional regulation. An unusual feature of the pig rDNA promoter is that instead of a G at - 16, which is conserved in eukaryotes, there is a C.

INTRODUCTION

t-DNA transcription is known to be species-specific (Grummt et al,, 1982). A rDNA gene from one species can only be transcribed in vitro in its own cell extract or the cell extract from a close relative. Our understanding of the evolution of species-specificity in mammals may be biased by the fact that detailed molecular studies have been carried out on only two orders, primates (human) and rodents (mouse and rat). To reduce this bias, an rDNA promoter from the order ~~~~~~~c~y~~ (domestic

Correspondence to: Dr. N. Arnheim, Molecular Biology Program, University of Southern California, Los Angeles, CA 90089-1340, USA. TeI (1-213) 740-7675; Fax (l-213) 740-8631; e-mail: arnheim~molbio-09.usc.edu *Present address: Department of Molecular Pharmacology and Toxicology, School of Pharmacy, University of Southern California, 1985 Zonal Avenue, Los Angeles, CA 90033, USA. Tel (1-213) 342-2770.

Abbreviations: bp, base pair(s); CPE, core promoter element; DCS, distal conserved sequence; kb, kiIobase(s) or 1000 bp; MCS, multiple cloning site (polyIinker); nt, nucIeotide(s); PA, polyacrylamide; PCR, polymerase chain reaction; PCS, proximal conserved sequence; pol, RNA polymerase; r, ribosomal; rDNA, rRNA-encoding gene; RT, reverse transcription; SCS, slart site conserved sequence; SLl, speciesspecific transcription factor; tsp, transcription start point(s); UBF, upstream binding factor; UPE, upstream promoter element. SSDf 0378-I 119(94)0053~-X

pig) was cloned, sequenced and its transcription was studied in pig tissue culture cells. The pig sequence was compared to the rDNA promoter sequences of human, mouse, rat and rabbit.

EXPERIMENTAL AND DISCUSSION

(a) Cloning the pig rDNA promoter region A pig partial MboI library cloned in hCharon28 was a gift from Dr. Nobuyo Maeda. Six clones were selected using a mouse 18s gene as a probe. Two clones with identical restriction maps also hybridized to a mouse 28s probe. Southern blotting with pig genomic DNA showed a map consistent with the clones (data not shown). The other four clones may have resulted from cloning artifacts or represent PDNA pseudogenes. The restriction map of the two pig rDNA clones (Fig. 1A) showed the evolutionarily conserved EcoRI sites and BumHI sites in the putative 18s and 28s regions. A Sal1 site was found about 4.3 kb upstream from the BumHI site in the 18s gene at a distance about the same as the Sal1 site found in other species. This ‘Sal box’ acts as a terminator for rDNA transcription from upstream promoters (Henderson and Sollner-Webb, 1986; Grummt et al., 1986).

376

B. *

I

t

L

t

-539

ggatccQgagacggtggacggtaccccgccggccccctgctcccgggtgtggccggg~ag

-479

gQtQCaCCtgggcCtgagQCQtQcccatgcagQgtcccQQtcQttggacaaQacttcQtt

-419

tCCCaCgCtCtCatttCCCgcccc~cgccctcggagtQtttccctgtcggtc~

-359

~tcgggaggtgggg?.Ccggcctgagctggatggatggtgtgtcctggatt

*

-La B'

-119 ~agtgtccgqatqQQggttccggggatacccccacgtcctgtggQtQggcccc B -59 gctgctgggcatggacatttttcgcggCCgaaatacgaaatacgccttttctgtcaccaQQtaga~

+122

gccgctcgcctgggcctgtgcgccggctctcacttgtgcatccagctggcccgtQctgcQ

1182

gtgtCtCCCCcggtctctggct

+1

203

Fig. 1. Pig rDNA clones and DNA sequence. (A) Restriction map of pig rDNA clones. The solid bars are putative 18s and 28s regions. E, EcoRI; B, BamHI; H, HindIII; S, SalI; T, &I. (B) The sequence of the 742nt non-coding strand surrounding the tsp.Fragments of the rDNA h clone were subcloned into the vector pBluescript KS(-) and sequenced using the standard dideoxynucleotide method (T7 polymerase. US Biochemical). The underlined sequences are known to be conserved in mammalian rDNA promoters: A or A’, S-GGTCGACCAG-3’ around - 170; B or B’, 5’-TTGGGGACA-3’ around - 120; C or C’, S-TGCTGACACGCT-3’ around the tsp. Capital letters are nt identical to the conserved sequences and small letters are non-identical nt. Two promoter-like regions are revealed; the region from - 178 to - 367 with the segments A’, B’ and C’ and the region from + 11to -172 containing A, B and C. Positions + 1’ and + 1 are the putative tsp for the two promoter-like elements. The numbering system uses + 1 as the tsp. GenBank accession No. L31782.

TABLE I Primers used in primer extension and RT-PCR Primer

Sequence ( 5’-+3’)

A81

GGGTCAGGCCTTGGACAGCA

A106

CGGAACCCCCATCCGGACA

CAT2 CAT3 PIG1

TCCAGCTGAACGGTCTGGTT GCTCCTGAAAATCTCGCCAAGC GCCTTTTCTGTCACCAGGTAGAT

PIG2

GCTGACACGATCCTCTTCA

Fig. 1B shows the DNA sequence of a 742”bp region surrounding the Sal1 site. A search was made for three motifs known to be conserved at + 1, - 120 and - 170 of mammalian rDNA promoters. Surprisingly, two distinct promoter-like regions were revealed, which are located from + IO to - 172 and from - 178 to - 367, respectively.

5’ +1

G A C A / C 3’

Fig. 2. Autoradiograph of the primer extension assay with pig cellular RNA. PE, the primer extension product using pig RNA with the primer A81 (see Table I). The sequence of the expected tsp from position + 1 to +8 is shown. RT was performed using primer A81 and pig RNA extracted from ST cells by using the single-step method (Chomczynski and Sacchi, 1987) and run on an 8 M urea-8% PA gel. The sequencing ladder was made by the d~deoxynucleotide method with A81. The main primer extension product is located at + 1. A minor band is seen at nt -130.

(b) Identification of the pig rRNA tsp

Primer extension was performed with pig cellular RNA extracted from a testis cell line (ST, ATCC-CRL 1746). Primer A81 was complementary to the sequence 3’ of the

377 downstream promoter and the location of primer A106 was between the upstream promoter and downstream promoter (see Table I). A major band was found only in the assay with the primer A81 and located the tsp to the expected + 1 nt of the downstream promoter (Fig. 2). The primer extension assay did not show any transcripts from the upstream promoter (+ 1’). Any ~011transcripts initiated at + 1’ may have been terminated by the ‘Sal box’ well before reaching the sequences where primer A106 would have annealed. Among mammals, functional spacer promoters have been found in rodents (Cassidy et al., 1987; Kohn and Grummt, 1987; Tower et al., 1989) but unlike the pig, these spacer promoters show limited sequence similarity with the gene promoters. However, the rodent spacer promoters and the pig promoter-like sequence have a common structural feature, a ‘Sal-box’-like element located immediately downstream from the spacer tsp site. This element is 70-bp downstream from the spacer tsp in rodents (Tower et al., 1989) and about 20-bp from the + 1’ site in pig (Fig. 1B).

BaxtUiI

A.

I ori-SVlQ

ECORI

B. pig-rDNA

cat

I--+

(c) Transcription potential of the pig J-DNA promoter Pig rDNA promoter function was studied in pig ST cells using pSV-pig which contains the putative rDNA promoter and the first 91-bp of the transcribed sequence (Fig. 3A). Since primer extension and Sl mapping failed to detect pSV-pig transcript, a highly sensitive RT-PCR assay was devised. Four primers were used (Fig. 3B). The downstream primers CAT2 and CAT3 are complementary to sequences in the vector. CAT2 is used for the RT reaction and CAT3 for PCR. The upstream primer PIG2 is identical to the sequence from + 1 to + 19 while PIG1 contains the sequence from - 1 to -23 (see Table I and Fig. 1B). RT-PCR assays will only amplify the transcript from pSV-pig because the downstream primers are complementary only to vector sequences. If the tsp defined in the primer extension assay is cor-

--

PIG1

PIG2

c.

CAT2

CAT3

i 6 7 8 9 10 1112

bp 141 118

Fig. 3. Transfection expression plasmid

analysis of a pig rDNA clone. (A) Structure of the pSV-pig. pSV-pig was constructed by insertion of

a pig rDNA fragment (from -539 to +91) into the MCS of pSVHXOOCO (a gift from Dr. Dennis Sakai). ori-SV40, the SV40 replication origin; pig-rDNA, the fragment containing the putative pig rDNA promoter and tsg that is indicated by an arrow; cut, the gene for chloramphenicol

acetyltransferase;

Location

of the primers

ApR, the gene for ampicillin used in RT-PCR.

Primer

resistance.

sequences

(B)

are shown

in Table I. (C) RT-PCR assay with total RNA from pSV-pig transfected ST cells. Odd-numbered lanes are RT-PCR samples amplified with the primer PIG1 and the downstream primers. The expected product size is 141 bp. Even-numbered lanes are samples amplified with PIG2 and the downstream primers and should produce a 118-bp band. Lanes 1 and 2 are positive controls for the PCR reaction using the plasmid pSV-pig as a template. Lanes 3 and 4 show the result of the RT-PCR assay with RNA from the STcells transfected with pSV-pig. Lanes 5 and 6 are controls using the same RNA as lanes 3 and 4, but without a RT reaction to estimate plasmid contamination in the RNA prepara-

tion. Lanes 7 and 8 are controls

using RNA from cells transfected

with

the plasmid itself. Lanes

pSVHX-OOCO to look for transcripts from the vector 9 and 10 are the controls with RNA from untransfected

cells. Lanes

11 and 12 are blanks

for the PCR reaction.

M, 1-kb DNA

size marker (GIBCO-BRL). Methods:Transfectionof ST cells with pSV-pig was carried out using the lipofectin method. After RNA extraction, for the first cDNA strand synthesis, reverse transcription was performed using 10 pg of RNA and primer CATZ. Then, the RT product was used in two PCR reactions, one with 20 pmol of the primer PIG1 and 20 pmol of CAT3, another with 15 pmol of PIG2 and 20 pmol of CAT3. A fifty microliter PCR reaction included l/50 of the RT product, each pair of the primers, 0.25 mM dNTPs and 1 unit of Taqpolymerase in 1 x standard PCR buffer. After denaturation at 94°C for 5 min, 30 cycles of PCR were carried out. Each cycle consisted of denaturing at 94°C for 1 min, annealing at 56°C for 1 min and extension at 72°C for 30 s. Each sample (10 )rl) was run on an 8% PA gel.

378 * human: mouse: rat: rabbit: pig: human: mouse: rat: rabbit:

*

*

*

*

*

tcctggggttgaccagagggccccgggcgctccgtgtgtggctgcg.atggtggcgtttt -tg-ca ---~------~~-~~--~~~-a-g----g~-c-.tt-cg~~----.--~ca---

-122

-~--aa---~------~~-~~--~~~---g----g~-c-c~~-c~ac----.--ac~-~-

a--cca---c------gt----aga--a-tgt-c-c-aacaga-...----gt-gca--___~~_~~~~~~~~~~_~-_-~-~-~-~--g-~-g--~----g~-~~-~-~---~-g~ Sal Box tggggacaggtgtccgtgtcgcgcgtcgcctgggccggcggcgtg..gtcggtgacgcga -t---c--cc-cca-ag--atga-t--caggtatt-t.-t-t-gcct---.actt.t-ct --------c--ca---aacatga-t--cagac-tt-c.gt-t-gcct---.at-t.ttat

-64

human: mouse: rat: rabbit: pig:

cctcccggccccggggaggtatatctttcg.ctccgag.tcggcattttgggacgccggg --ctgtct-ttttat-cttgtg------tcta--.....-gtt-c-a----a--tgga-a --ctgt-t-ttttacactt-tc------gcta--.....-gtc-t-a---ta--tgga-a --ctgt-t--t-tc-cgt-g-c ~~~_~~~~~__~g___~-g~-g~~~~~--~~-~g-~~_~___~_~_g_~__~_____~gg----~~-~c-_c---_c~~~~~--~---cg-t-... DCS PCS

-6

human: mouse: rat: rabbit: pig:

ttattgctgacacgctgtcctctggcgacctgtcgctggagaggttgggcctccggatgc -agg-a---------------t-cc-tattaacac.....t-aaggaca-tataa--ga-ata-----------------t-t-actt--g-ttg-catt-aaggac-ttggaa--g--

+55

pig:

--~-----a---a---g---c-caag-~-aga--~.---~-~--~~~--g~~~.,.~-ag g-------a-------ga-g-g-g~--cggg-a~a-cc-~a---cc~--g---...-g-c

-agg______________ t____--~--~-------ca-g----,~~__a_-_____c_~ -aga_____--em_ __~a---,----------____~~_________~____-_ scs

Fig. 4. Alignment of several mammalian rDN.4 promoter sequences. rDNA promoter sequences of human (Miesfeld and Arnheim, 1982), mouse (Urano et al., 1980), rat (Rothblum et al., 1982), rabbit (P. Seperack and N.A., unpublished data) and pig are aligned and the numbering system for human is used. Underlined sequences are conserved. Dots represent gaps and short dashes represent identical nt compared to the human rDNA sequence.

rect, then the pSV-pig transcript should be amplified using PIG2 but not PIGl. If transcription of pSV-pig starts upstream from the proposed site, RT-PCR product will be seen with both primers. Fig. 3C shows a strong 118-bp band from the RT-PCR reaction using PIG2 (Fig. 3C, lane 4) but only a very faint band of 141-bp band was observed using PIG1 (Fig. 3C, lane 3). The obviously different intensities of the two bands show that the products of the two RT-PCR reactions were not made from the same transcript because pSV-pig DNA as template gave products of almost equal intensity (Fig. 3C, lanes 1 and 2). Possibly, among all transcripts initiated at the + 1 site, a few extended around the whole plasmid passing through the tsp again due to inefficient termination at the ‘Sal box’. Alternatively, ~0111 transcription coming from a TATA-like sequence somewhere else in the plasmid could be responsible (Smale and Tjian, 1985). Additional controls are described in the legend to Fig. 3C. Subsequent anchoredPCR experiments (data not shown) on the pSV-pig RNA showed that the tsp was at the same nt observed in the primer extension experiments on pig cell RNA. (d) Alignment of five mammalian rDNA promoter sequences rDNA promoters in mammals are usually separated into two functional regions; the CPE (+ 10 to -45) and the UPE (- 100 to - 160). The exact locations and length of the two promoter elements vary among species. The

CPE region is essential in rDNA transcription regulation and the UPE region modulates the level of transcription. Alignment of the pig rDNA promoter sequence with four other mammalian promoters shows five conserved subregions with few variations (Fig. 4). In the CPE there are three highly conserved subsegments (Ishikawa et al., 1991), SCS, PCS and DCS. Sequence determinants for species-specificity have been found within the CPE region. In human it is from -43 to + 17 (Ishikawa et al., 1991), and in mouse from - 32 to - 14 (Safrany et al., 1989). In the mouse, the species-specific transcription factor SLl binds to the - 32 to - 14 region (Bell et al., 1990). A conserved region around -120 is a part of the upstream promoter element and overlaps the binding site for UBF-SLl complex in human (Bell et al. 1988). The region was shown to have a moderate effect in ~011 transcription in human (Jones et al., 1988) and rat (Xie et al., 1991), but its role is not yet clear. The region at about - 168 containing the ‘Sal box’ is highly conserved in all species (Fig. 4) and has been shown to have an important function in mouse and human (Henderson and Sollner-Webb, 1986; Pfleiderer et al., 1990) acting to terminate transcription from upstream or spacer promoters (Henderson et al., 1989). The pig rDNA promoter has a C-16, whereas a G-l6 is highly conserved in all other eukaryotic species. For a G-l6 +A substitution, mouse rDNA transcription was decreased by 95% (Skinner et al., 1984) and SLl binding

379

to the CPE region was abolished (Bell et al., 1990). However, Tower et al. (1989) found that the active spacer promoter in hamster has a G at - 17 but not at - 16. A single substitution experiment made by Xie and Rothblum (1992) showed that a CPE mutant carrying an A-l6 instead of a G in the rat rDNA promoter could weaken the promoter function if the UPE sequence is missing, but it could be rescued by connecting a UPE fragment to the CPE. In fact, no G-i6+C substitution has been specifically tested. It is not unreasonable to suggest that a change from a G:C to a C:G base pair in the pig might be of less consequence than a G:C to A:T change.

merase

I initiation

the rat rRNA Chomczynski,

P. and Sacchi, N.: Single-step

Grummt,

I., Kuhn,

terminator

spacer

method

A., Bartsch,

located

I. and Rosenbauer,

upstream

in vitro is species-specific. Henderson,

region

of

of RNA isolation

Nature

S. and Sollner-Webb,

novel element

extraction.

H.: A transcription

from the mouse

rDNA

affects rRNA synthesis. Cell 47 (1986) 9Oll911. Grummt, I., Roth, E. and Paule, M.R.: Ribosomal

site

RNA transcription

296 (1982) 173-174.

B.: A transcriptional

of the promoter

initiation

terminator

of the mouse ribosomal

is a

RNA gene.

Cell 47 (1986) 891-900. Henderson,

S.L., Kenneth,

ruption

(e) Conclusions

of the stable

augments

transcription

B.: The promoter-

initiation

complex

by preventing

caused

dis-

by polymerase

Genes Dev. 3 (1989) 212-223. Y., Safrany,

H., Kominami, moter

R. and Sollner-Webb,

rDNA terminator

proximal read-in.

tent with that of pig genomic DNA and contains conserved restriction sites found in other mammalian rDNAs. (2) The pig rDNA tsp was defined and the promoter function was determined. The putative rDNA promoter sequence shows all conserved regions found in other mammalian rDNA promoters. An unusual feature of the pig rDNA promoter is that there is a C-l6 instead of G-16, which is conserved in eukaryotes. (3) A large duplication of the promoter region was observed upstream from the functional promoter (Fig. 1B) and shares 52% sequence identity with it. The duplicated region contains conserved sequences around - 170’, - 120’ and + 1’ (with a few variations) but lacks a PCS and DCS.

the nontranscribed

by acid guanidinium thiocyanate-phenol-chloroform Anal. Biochem. 162 (1987) 1566159.

Ishikawa,

(I) The restriction map of the pig rDNA clone is consis-

site within

gene. Mol. Cell. Biol. 7 (1987) 2388-2396.

G., Hisatake,

K., Tanaca,

R. and Muramatsu,

of human

species-specific

and mouse transcription.

N., Maeda,

M.: Structure

ribosomal

Y., Kato,

of the core pro-

RNA gene: asymmetry

of

J. Mol. Biol. 218 (1991) 55-67.

Jones, M.H., Learned, R.M. and Tjian, R.: Analysis of clustered point mutations in the human ribosomal RNA gene promoter by transient expression

in uiuo. Proc. Natl. Acad. Sci. USA 85 (1988) 6699673.

Kohn, A. and Grummt, Miesfeld,

in the mouse rDNA spacer

I.: A novel promoter

is active in uiuo and in vitro. EMBO R. and Arnheim,

origin of transcription

J. 6 (1987) 3487-3492. of the in uiuo and in vitro

N.: Identification in human

rDNA. Nucleic Acids Res. 10 (1982)

3933-3949. Pfleiderer,

C., Smid, A., Bartsch,

I. and Grummt,

I.: An undecamer

DNA sequence directs termination of human ribosomal scription Nucleic Acids Res. 18 (1990) 4727-4736. Rothblum,

L.I., Reddy, R. and Cassidy,

of rat ribosomal Safrany,

G.,

DNA. Nucleic

Tanaka,

N.,

B.: Transcription

gene tran-

initiation

site

Acids Res. 10 (1982) 734557362.

Kishimoto,

T., Ishikawa,

Y., Kato,

H.,

Kominami, R. and Muramatsu, M.: Structural determinant of the species-specific transcription of the mouse rDNA gene promoter. Mol. Cell. Biol. 9 (1989) 3499353. Skinner,

J.A., Ghrein,

transcriptional

A. and Grummt,

analysis

of a mouse

I.: In vitro mutagenesis ribosomal

promoter

and

element,

Proc. Natl. Acad. Sci. USA 81 (1984) 213772141. NOTE

ADDED

IN PROOF

Smale,

ST.

sequences

The pig sequence in Fig. 4 between nt positions -134 to -128 should read ta--.-c, which is consistent with the data in Fig. 1.

and

polymerase Tower,

Tjian,

I promoters.

J., Henderson,

Sollner-Webb,

H.-M. and Tjian, R.: Assembly

protein complexes (1990) 943-954. Bell, S.P., Learned,

directs rRNA promoter R.M., Jan&en,

H.-M.

of alternative

selectivity. and Tjian,

multi-

Genes Dev. 4 R.: Functional

cooperativity between transcription factors UBFl and SLl mediates human ribosomal RNA synthesis. Science 241 (1988) 1192-1197. Cassidy, B., Yang-Yen, H.F. and Rothblum, L.: Additional RNA poly-

simplex

and mutant

virus tk

human

RNA

Mol. Cell. Biol. 5 (1985) 352-362.

S.L., Dougherty,

K.M.,

Wejksnora,

I promoter

P.J. and

located

in the

CHO and mouse ribosomal DNA spacers: functional analysis and factor and sequence requirements. Mol. Cell. Biol. 9 (1989) 151331525.

cloned ribosomal Bell, S.P., Jantzen,

of herpes

of wild-type

B.,: An RNA polymerase

Urano, Y., Kominami, nucleotide sequence

REFERENCES

T.: Transcription

under the control

Xie,

R., Mishima, of the putative

RNA. Nucleic

Y. and Muramatsu, M.: The transcription initiation site of a

Acids Res. 8 (1980) 6043-6058.

W.Q., O’Mahony, D.J., Smith, D. and Rothblum, L.: Complementary in uiuo and in vitro analysis of the interactions between the cis-acting elements Cell. Biol. 104 (1991) 127-135.

of the rat rDNA promoter.

Mol.

Xie, W.Q. and Rothblum, L.I.: Domains of the rat rDNA promoter must be aligned stereospecifically. Mol. Cell. Biol. 12 (1992) 126661275.