- Email: [email protected]
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
Agricultural Sciences in China
March 2009
2009, 8(3): 369-379
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii LI Yan-he1, 3, ZHENG Fang-liang2, CHEN Hong-quan1, WANG Han-zhong2, WANG Liu-quan3 and XU Di-ping4 1 2 3 4
Anhui Agricultural University, Hefei 230036, P.R.China State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, P.R.China The Fishery Institute, Anhui Academy of Agricultural Sciences, Hefei 230031, P.R.China Huibei Key Laboratory of Animal Embryo & Molecular Breeding, Hubei Academy of Agricultural Sciences, Wuhan 430064, P.R.China
Abstract The full-length cDNA sequence of prophenoloxidase was obtained through RACE technology. The complete cDNA sequence is 3 721-bp long, containing an open reading frame (ORF) of 1 881 bp, a 154-bp 5´-untranslated region, and a 1 686bp 3´-untranslated region with three potential functional poly(A) signals (AATAAA). The molecular mass of the deduced amino acid sequence (627 aa) was 72.3 kDa with an estimated pI of 5.88. It contained putative copper-binding sites (copper A: 131, 135, 167 and copper B: 301, 305, 341), and a tentative complement-like motif (GCGWPDHL). Eight potential N-linked glycosylation sites were predicted to be present in P. clarkii prophenoloxidase. Similar to those in other arthropod prophenoloxidases reported so far, no signal peptide was detected in the crayfish prophenoloxidase. The phylogenetic trees confirmed that P. clarkii prophenoloxidase was most closely related to that of freshwater crayfish P. leniusculus and more closely related to other crustacean prophenoloxidases from shrimp, prawn, and lobster than to the insect prophenoloxidases. Besides, two putative introns were found in this sequence of genomic DNA. Key words: prophenoloxidase cDNA, Procambarus clarkii, nucleotide sequence, copper-binding sites, intron
INTRODUCTION High economic losses of crustacean aquaculture owing to disease outbreaks are widespread among the crustacean producing countries around the world. Different strategies have been used to solve the problem, such as improving the management of cultivation conditions and using different chemicals to kill the pathogens or maintaining a stable quality of pond water (Lu et al. 2006). In order to prevent and control disease in cultured crustaceans, an understanding of their defense system is becoming an important issue.
Crustaceans have an innate immune system, including humoral and cellular immune responses. The haemocytes play a critical role in these immune reactions and are capable of phagocytosis, encapsulation of foreign material, nodule formation, mediation of cytotoxicity and cellagglutination, and melanisation by activation of the prophenoloxidase activating system (Hughes 1999; Johansson et al. 2000). The similarity between prophenoloxidase of Procambarus clarkii and other species of freshwater crayfish can enable us to examine some of the factors that activate this system (Cárdenas et al. 2000, 2004). The prophenoloxidase activating system is an enzy-
Received 26 June, 2008 Accepted 8 October, 2008 LI Yan-he, MSc, E-mail: [email protected]; Correspondence CHEN Hong-quan, Professor, Tel: +86-551-5786329, E-mail: [email protected]
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
370
matic cascade associated with the pathogen defense mechanisms and is considered as an important mechanism of innate defense in arthropods (Wang et al. 2004; Lu et al. 2006; Claire et al. 2007). This enzymatic cascade has been studied in crustaceans such as the crayfishes Astacus astacus and Pacifastacus leniusculus. Prophenoloxidase resides in circulating granular cells and semi-granular cells of haemocytes in crustaceans (Söderhäll 1985; Johansson et al. 2000). Understanding the activation of the proPO system and the structure of some species proPO can enable us to evaluate the health of crustaceans stocks and to serve crustaceans diseases-controlling. While proPO cDNA has been cloned from the crayfish P. leniusculus (Aspán et al. 1995), giant freshwater prawn Macrobarchium rosenbergii (Liu et al. 2006; Lu et al. 2006), giant tiger shrimp Penaeus monodon (Sritunyalucksana et al. 1999), white shrimp Litopenaeus vannamei (Lai et al. 2005), kuruma shrimp Marsupenaeus japonicus (AB065371, AB073223), green tiger shrimp Penaeus semisculcatus (AF521949), American lobster H. americanus (AY655139), European lobster H. gammarus (HGA581662), and Dungeness crab Cancer magister (DQ230981), there are still no reports on the prophenoloxidase cDNA sequence of freshwater crayfish P. clarkii. In this study, the full-length prophenoloxidase cDNA sequence was cloned from the hemocytes of P. clarkii. The deduced amino acid sequences were then used for phylogenetic relationship with other known arthropod prophenoloxidases.
MATERIALS AND METHODS Collection and maintenance of red swamp crayfish P. clarkii P. clarkii obtained from a commercial farm in Wuhan, Hubei, China, were acclimatized in plastic containers and artificially fed twice a day before experimentation.
Primers design Primers for the amplification of Procambarus clarkii prophenoloxidase partial cDNA sequence were designed
LI Yan-he et al.
based on the highly conserved nucleotides of prophenoloxidase of the known crustaceas. The sense primer and antisense primer were proPOF and proPOR (Table 1). The primers for 3´-rapid amplification of cDNA ends (RACE) and 5´-RACE, and the specific primer pair PPO-F and PPO-R were used to amplify the genomic DNA and obtain the partial cDNA sequence of P. clarkii prophenoloxidase.
Total RNA isolation and RT-PCR Haemolymph was collected from the sinus of P. clarkii using a 5 mL syringe containing pre-cooled (4°C) crayfish anticoagulant buffer (Lin et al. 2007). The sample was centrifuged at 500 × g for 20 min at 4°C and the pellet was harvested. The haemocyte pellet was used for isolation of total RNA. The total hemocyte RNA was extracted using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s recommendations, and the concentration of the total RNA was determined by measuring the absorbance at 260 nm. To clone the partial cDNA of prophenoloxidase gene from P. clarkii, total RNA was reversely transcribed using ThermoScript TM Reverse Transcriptase (Invitrogen, CA, USA) and oligodT-anchor as the primer to obtain the first-strand of cDNA. The primers of proPOF and proPOR were used to amplify the partial cDNA of prophenoloxidase gene. The PCR reaction was performed in a total volume of 50 L. The PCR mixture contained: 5 L of 10 × PCR buffer with 200 mM Tris-HCl (pH 8.4), 500 mM KCl, 1.5 L of 50 mM MgCl2, 1 L of 10 mM dNTP mix, 1 L of 10 M each primer, 36.3 L of sterile deionised water, and 0.2 L of platinum Taq DNA polymerase (5 U L-1) (Invitrogen, CA, USA). The reaction condition was as follows: 5 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 45 s, and elongation at 72°C for 2 min, and 30 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 45 s, and elongation at 72°C for 2 min, followed by a 10 min extension at 72°C and cooling to 4°C.
Genomic DNA extraction and amplification of two introns Muscle tissue (50 mg) excised from the abdomen of
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
the crayfish was rapidly frozen in liquid nitrogen and crushed to a fine powder. Genomic DNA of muscle tissue was extracted using phenol-chloroform method and was stored at -20°C until usage. PCR was performed as follows: 5 cycles of denaturalization at 94°C for 30 s, annealing at 57°C for 45 s, and elongation at 72°C for 3 min, and 24 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 45 s, and elongation at 72°C for 3 min, followed by a 10 min extension at 72°C and cooling to 4°C.
5´- and 3´-rapid amplification of cDNA ends (5´and 3´-RACE) For 5´-RACE, 3 mg of total RNA was reverse-transcribed with the first nested primer proPO5´1R that is specific to P. clarkii prophenoloxidase gene. The firststrand cDNA used for the 5´-RACE was synthesized w i t h T h e r m o S c r i p t TM R e v e r s e T r a n s c r i p t a s e (Invitrogen, CA, USA). Terminal transferase TdT and dATP were attached to the 5´-end of the first-strand cDNA. The primer sets are proPO5´2R plus oligodTanchor for the first-run PCR, and proPO5´3R plus anchor primer for the second-run PCR (Table 1). The first-run PCR reaction was the same as that described above, except that the annealing temperature was 60°C for the first 5 cycles and 56°C for the following 30 cycles. The second-run PCR reaction condition was as follows: 35 cycles of denaturalization at 94°C for 30 s, annealing at 59°C for 45 s, and elongation at 72°C for 1 min, followed by a 10 min extension at 72°C and cooling to 4°C. For the 3´-RACE, the reverse transcription reaction remained the same as that for obtaining the cDNA
371
fragment. Two successive PCRs were carried out with primer pairs of proPO3´1F plus anchor primer and proPO3´2F plus anchor primer for the first and second runs, respectively (Table 1). Again, the PCR reaction was the same as that in the 5´-RACE second-run PCR described above, except that the elongation time of 35 cycles was 2 min.
Sequence analysis The prophenoloxidase cDNA sequence was analyzed using the BLASTX and BLASTP search programs (http:// www.blast.genome.ad.jp) and compared with the homolog sequences in the GenBank database. The alignment of multiple amino acid sequences was done using DNAStar software, and phylogenetic reports were constructed by the Neighbor-joining method using MEGA3.1 software. GenBank accession numbers of the sequences used for this analysis are included in Table 2.
Parameter analysis of codons’ usage frequencies The deduced amino acids of amplified prophenoloxidase cDNA were analyzed by the parameters of codons’ usage frequencies (F) (Zhang et al. 2007). The codons’ usage frequencies were obtained using the formula: F = mk/n. In the formula, the type of certain amino acid synonymous codon was signed as m, n denotes the times that certain amino acid appears in the protein, and k represents the frequency of certain codon used for the amino acid. When synonymous codon used for the amino acid appears randomly, the frequency of each codon is equal to one.
Table 1 Sequence of different primers used in this experiment Primer
Predicted size (kb)
proPOF proPOR proPO5´1R proPO5´2R proPO5´3R proPO3´1F proPO3´2F OligodT-anchor Anchor PPO-F PPO-R
About 1.3 About 0.6
Above 0.5
Sequence (from 5´ to 3´) HCACCACTGGCACTGGCA GTCGAAWGGGAARCCCAT TACCTGGCTATCATCTGCTG AGTTCTCCTTTACGGTCCCGG CGGTTAACATTCGTGTCAATGGG ACCTGGACAAGGATGAGGTGG CTGGACGCCAAGTTCCCTGACA GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV GACCACGCGTATCGATGTCGAC GCCAGGATAATACCCTACTC TGTCATGGCAGAATGCCAGC
H = A or C or T; W = A or T; R = A or G; V = A or C or G.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
372
LI Yan-he et al.
Table 2 GenBank accession numbers of prophenoloxidase sequences analyzed Species Pacifastacus leniusculus (freshwater crayfish) Macrobrachium rosenbergii (giant freshwater prawn) Penaeus monodon1 (tiger shrimp) Penaeus monodon2 (tiger shrimp) Penaeus semisulcatus (green tiger shrimp) Litopenaeus vannamei (Pacific white shrimp) Marsupenaeus japonicus1 (kuruma shrimp) Marsupenaeus japonicus2 (kuruma shrimp) Scylla serrata (mud crab) Cancer magister (Dungeness crab) Homarus americanus (American lobster) Homarus gammarus (European lobster) Galleria mellonella (greater wax moth) Plodia interpunctella (Indianmeal moth) Musca domestica (house fly) Apis mellifera (honey bee)
RESULTS Cloning and sequence analysis of partial cDNA from P. clarkii An expected cDNA fragment of about 1.3 kb from haemocytes of P. clarkii was amplified with the primer pair of proPOF plus proPOR (Fig.1). The PCR products were purified and cloned into the pGEM-T Easy vector. Four clones were sequenced and found to contain the same cDNA fragment of 1 336 bp. cDNA sequence of the fragment showed significant similarity to that of prophenoloxidases for other decapod crustaceans in GenBank database. Using similar approaches, a cDNA fragment of 660 bp was obtained by 5´-RACE and a cDNA fragment of 1 885 bp was also amplified by 3´-RACE. The full-length of prophenoloxidase cDNA for P. clarkii was finally obtained by overlapping three cDNA fragments. The genomic DNA fragment obtained by the specific primer pair of PPO-F plus PPO-R was determined to be 1 679 bp (Fig.2), and two putative introns were found in this sequence of genomic DNA (Fig.3). The full-length cDNA of prophenoloxidase has 3 721 bp containing an open reading frame (ORF) of 1 884 bp, a 5´-untranslated region of 154 bp, and a 3´-untranslated region of 1686 bp with three typical polyA signals (AATAAA) and the polyA tail. It codes a protein of 627 amino acids with the putative initiation methionine codon (ATG) beginning at nucleotide 155 and the stop codon beginning at nucleotide 2 035. The calculated molecular mass is 72.3 kDa, and the estimated pI of this protein is
Abbreviation P. leniusculus M. rosenbergii P. monodon1 P. monodon2 P. semisulcatus L.vannamei M. japonicus1 M. japonicus2 S. serrata C. magister H.americanus H. gammarus G. mellonella P. interpunctella M. domestica A. mellifera
Prophenoloxidase X83494 DQ182596 AF099741 AF521948 AF521949 AY723296 AB073223 AB065371 DQ435606 DQ230981 AY655139 AJ581662 AF336289 AY665397 AY494738 AY242387
5.88. No signal peptide exists in the prophenoloxidase. One thiol ester region-like motif (GCGWPDHL) and eight potential N-glycosyslayion sites were found in P. clarkii
Fig. 1 The results of 1.0% agarose gel electrophoresis of PCR product of proPO cDNA fragment. M, 3 000 bp DNA ladder; lane 1, PCR product of proPO cDNA fragment; lane 2, negative comparison.
Fig. 2 The results of 0.8% agarose gel electrophoresis of PCR product of proPO DNA fragment. M, 2 000 bp DNA ladder.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
prophenoloxidase. The P. clarkii prophenoloxidase cDNA sequence with deduced amino acid sequence has been submitted to the NCBI GenBank (Accession number: EF595973) (Fig.4). Sequence comparison of the 5´-end 600 nucleotides in EF595973 with the remaining sequence in EF595973 by the BLASTX shows that nucleotides 124-575 are almost identical to nucleotides 619-1 070. Sequence analysis with ClustalW (DNAStar software) indicated that the deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 63.6, 54.5, 53.7, 52.3, 51.4, 51.2, 51.2, and 50.7% to that of prophenoloxidases from freshwater crayfish P. leniusculus, European lobster H. gammarus, American lobster H. americanus, Pacific white shrimp L. vannamei, kuruma shrimp M. japonicus1, tiger shrimp P. monodon1 and P. monodon2, and green tiger shrimp P. semisulcatus, respectively. The deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 31.9-36.5% with that of prophenoloxidases from insecta that include greater wax moth G. mellonella, Indianmeal moth P. interpunctella, honey bee A. mellifera, and house fly M. domestica. Comparison of the deduced amino acid sequences of copper-binding sites in prophenoloxidases of P. clarkii and other decapod crustaceans showed that P. clarkii proPO contains a putative copper-binding domain with six histidines (Fig.5) and a tentative complement-like motif (thiol ester region-like motif) (GCGWPDHL). Amino acid sequences around the thiol
373
ester region-like motif were aligned with those in arthropod prophenoloxidase (Fig.6). A molecular phylogenetic tree was constructed using MEGA3.1 to further analyze the evolutionary relationships among prophenoloxidases of crustacea and insecta (Fig.7). Arthropod prophenoloxidases can be classified into two major groups including insect and crustacean prophenoloxidases. Crustacean prophenoloxidasess can be further classified into five subgroups. One subgroup contains prophenoloxidases of Penaeus monodon1 (tiger shrimp), Marsupenaeus japonicus2 (kuruma shrimp), Penaeus semisulcatus (green tiger shrimp), Litopenaeus vannamei (Pacific white shrimp), Marsupenaeus japonicus1 (kuruma shrimp), and Penaeus monodon2 (tiger shrimp). The second subgroup contains prophenoloxidases of Pacifastacus leniusculus (freshwater crayfish) and P. clarkii (red swamp crayfish). The third subgroup contains prophenoloxidases of Homarus americanus (American lobster) and Homarus gammarus (European lobster). The fourth subgroup contains prophenolo-xidases of Macrobrachium rosenbergii (giant freshwater prawn). The fifth subgroup includes prophenolo-xidases of Cancer magister (Dungeness crab) and Scylla serrata (mud crab).
Codons’ usage analysis of P . clarkii prophenoloxidase 627 amino acids were deduced from the cDNA ORF
Fig. 3 Sequence of prophenoloxidase gene fragment from P. clarkii. Underlined letters represent sequence of exons and the others represent sequence of introns.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
374
LI Yan-he et al.
(from 154 to 2 035 bp) of P. clarkii prophenoloxidase (Fig.4). The composition of amino acids was obtained by DNAStar software, and the analysis of the frequencies of codons (Table 3) indicated a codons’ usage preference in P. clarkii prophenoloxidase. For 1 65 155 1 245 31 335 61 425 91 515 121 605 151 695 181 785 211 875 241 965 271 1 055 301 1 145 331 1 235 361 1 325 391 1 415 421 1 505 451 1 595 481 1 685 511 1 775 541 1 865 571 1 955 601 2 045 2 135 2 225 2 315 2 405 2 495 2 585 2 675 2 765 2 855 2 945 3 035 3 125 3 215 3 305 3 395 3 485 3 575 3 665
example, prophenoloxidase of P. clarkii prefers to use codons of GCU, GCA, or GCC, but not GCG for amino acid Ala. The correlation of codons’ usage frequencies for prophenoloxidases of P. clarkii and other arthro-
*
64 154 244 30 334 60 424 90 514 120 604 150 694 180 784 210 874 240 964 270 1 054 300 1 144 330 1 234 360 1 324 390 1 414 420 1 504 450 1 594 480 1 684 510 1 774 540 1 864 570 1 954 600 2 044 628 2 134 2 224 2 314 2 404 2 494 2 584 2 674 2 764 2 854 2 944 3 034 3 124 3 214 3 304 3 394 3 484 3 574 3 664 3 721
Fig. 4 Nucleotide sequence (above) and deduced amino acid sequence of P. clarkii prophenoloxidase. Nucleotides are numbered from the first base at the 5´ end. Amino acids are numbered from the initiating methionine. The possible N-glycosylation sites are underlined. The six histidine residues within the Cu A binding site (131, 135, 167) and the Cu B binding site (301, 305, 341) are shown in bold letter (H). The thiol-esterlike motif is shown in bold letter with double underlines. The asterisk (*) indicates the stop codon. The polyadenylation signal AATAAA is enclosed in solid lines. The sequence was submitted to GenBank with accession number of EF595973.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
pod (Table 4) indicated that P. clarkii prophenoloxidase has its special coding strategy. The correlation coefficient among P. clarkii and M. domestica was 0.068, indicating that the coding strategy for P. clarkii prophenoloxidase was less similar to that for M. domestica prophenoloxidase and synonymous codons were preferred to be used in P. clarkii prophenoloxidase.
375
The correlation coefficient among P. clarkii and A. mellifera was -0.360, indicating that the coding strategy for P. clarkii prophenoloxidase was different from that for A. mellifera prophenoloxidase. However, the coding strategy for P. clarkii prophenoloxidase was similar to that for other arthropod prophenoloxidases (0.5-0.8).
Fig. 5 Alignment of two copper-binding sites (A and B) with those in arthropod prophenoloxidase. Six highly conserved histidine residues are shown in black reverse print and boldfaced letters.
Fig. 6 Amino acid sequence alignment of thiol ester region-like motifs from arthropod prophenoloxidases.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
376
LI Yan-he et al.
DISCUSSION In crustaceans, prophenoloxidase exists in the haemocytes in an inactive form and is activated by microbial cell wall constituents (Saul et al. 1986; Perazzolo and Barracco 1997; Lai et al. 2005). The monomer prophenoloxidase has a mass of about 70-80 kDa, and the phenoloxidase has a mass of 60-70 kDa (Aspán et al. 1995; Anas et al. 1996; Cong et al. 2005; Lia et al. 2005). Prophenoloxidase genes have been cloned from haemocytes of penaeid shrimps, including P. monodon (78.7 kDa) (Sritunyalucksana et al. 1999), S. serrata (77.5 kDa) (Ko et al. 2007), L. vannamei (78.1 kDa) (Lai et al. 2005), M. rosenbergii (76.7 kDa) (Liu et al. 2006), and P. lenuisculus (80.7 kDa) (Aspán et al. 1991; Aspán et al. 1995). In the study, a 3 721-bp prophenoloxidase cDNA from haemocytes of the red
Fig. 7 A molecular phylogenetic tree of seventeen arthropod prophenoloxidases via the Neighbour-joining method. Values for each internal branch were determined by bootstrap analysis with 1 000 replications and indicated percentages along the branch.
Table 3 The codons’ usage frequencies for P. clarkia prophenoloxidase Amino acid
Codon
Frequencie (%)
Amino acid
Codon
Frequencies (%)
Amino acid
Codon
Frequencies (%)
Ala
GCA GCC GCG GCU AGA AGG CGA CGC CGG CGU AAC AAU GAC GAU UGC UGU AAA AAG GUA GUC GUG GUU
1.379 1.103 0.000 1.517 0.750 0.875 0.625 1.125 1.625 1.000 1.349 0.651 1.296 0.704 0.800 1.200 0.500 1.500 0.242 0.727 1.939 1.091
Gln
CAA CAG GAA GAG GGA GGC GGG GGU CAG CAU AUA AUC AUU CUA CUC CUG CUU UUA UUG UAC UAU
0.455 1.545 0.235 1.765 0.923 1.231 0.923 0.923 1.100 0.900 0.621 1.448 0.931 0.381 2.095 2.190 0.762 0.190 0.381 1.250 0.750
Phe
UUC UUU CCA CCC CCG CCU AGC AGU UCA UCC UCG UCU ACA ACC ACG ACU
1.667 0.333 1.333 1.333 0.364 0.970 1.742 0.581 0.194 2.516 0.194 0.774 0.865 1.405 0.541 1.189
Arg
Asn Asp Cys Lys Val
Glu Gly
His Ile
Leu
Tyr
swamp crayfish P. clarkii was obtained and its calculated molecular mass was 72.3 kDa. The results of similarity BLAST showed that the nucleotides 124-575 in EF595973 are almost identical to nucleotides 619-1 070, suggesting that sequence duplication has occurred within EF595973. It needs further investigation to know if the sequence duplication exists throughout the species of crayfish P. clarkii or is only found in the individual of P. clarkii.
Pro
Ser
Thr
Sequence analysis via the BLAST algorithm shows that the deduced amino acid sequence of P. clarkii prophenoloxidase has the highest similarity to that of freshwater crayfish P. leniusculus (63.6%) (Aspán et al. 1995), and has similarity of 48.3-54.5% to that of prophenoloxidases from other decapod crustaceans, including Dungeness crab C. magister (DQ230981), American lobster H. americanus (AY655139), European lobster H. gammarus (HGA581662), kuruma
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
377
Table 4 The correlation of codon usage in prophenoloxidases from 17 species 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
0.539 0.600 0.665 0.608 0.583 0.584 0.565 0.716 0.631 0.503 0.781 0.786 0.068 0.614 -0.360 0.537
0.507 0.564 0.864 0.965 0.959 0.614 0.543 0.769 0.811 0.567 0.428 0.139 0.695 -0.530 0.774
0.970 0.605 0.557 0.560 0.489 0.716 0.592 0.463 0.691 0.722 0.265 0.498 -0.120 0.351
0.642 0.600 0.599 0.519 0.784 0.614 0.473 0.728 0.746 0.241 0.539 -0.150 0.388
0.868 0.868 0.776 0.634 0.794 0.804 0.684 0.595 0.122 0.838 -0.680 0.840
0.998 0.653 0.533 0.826 0.837 0.590 0.499 0.106 0.730 -0.540 0.786
0.660 0.531 0.835 0.840 0.602 0.499 0.095 0.728 -0.540 0.790
0.513 0.611 0.600 0.676 0.535 0.053 0.704 -0.500 0.694
0.560 0.457 0.728 0.818 0.313 0.686 -0.300 0.545
0.873 0.632 0.515 -0.100 0.705 -0.520 0.721
0.509 0.411 -0.030 0.711 -0.600 0.805
0.778 0.080 0.657 -0.280 0.579
0.248 0.653 -0.250 0.510
0.149 0.175 0.101
15
-0.693 0.911
16
-0.712
1, P. clarkii; 2, P. semisuLcatus; 3, H. americanus; 4, H. gammarus; 5, L. vannamei; 6, P. monodon1; 7, P. monodon2; 8, M. rosenbergii; 9, C. magister; 10, M. japonicus1; 11, M. japonicus2; 12, P. leniusculus; 13, S. serrata; 14, M. domestica; 15, G. mellonella; 16, A. mellifera; 17, P. interpunctella.
shrimp M. japonicus1 and M. japonicus2 (AB065371, AB073223), white shrimp L. vannamei (Lai et al. 2005), tiger shrimp P. monodon1 and P. monodon2 (Sritunyalucksana et al. 1999), green tiger shrimp P. semisulcatus (AF521949), giant freshwater prawn M. rosenbergii (Liu et al. 2006; Lu et al. 2006), and mud crab S. serrata (Ko et al. 2007). The deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 31.9-36.5% to that of prophenoloxidase from insecta, including greater wax moth G. mellonella, Indian meal moth P. interpunctella, tobacco hornworm M. sexta, honey bee A. mellifera, and house fly M. domestica. Phylogenetic analysis revealed that red swamp crayfish P. clarkii prophenoloxidase is distinctly far away from prophenoloxidase of insecta, and is also distinct from prophenoloxidase of penaeid shrimps, lobster, and freshwater prawn. The present study also indicated that the decapod crustacean prophenoloxidases can be probably classified into five distinct branches: freshwater prawn, crayfish, lobster, penaeid shrimps, and crab. A thiolester-like motif (GCGWPQHM) was found in prophenoloxidase of green tiger shrimp P. semisculatus (AF521949), black tiger shrimp P. monodon (Sritunyalucksana et al. 1999), kuruma shrimp M. japonicus (AB065371, AB073223), white shrimp L. vannamei (Lai et al. 2005), Dungeness crab C. magister (DQ0230981), and mud crab S. serrata (DQ435606). A thiol-ester-like motif (GCGWPQHL) was observed in prophenoloxidase of lobster H. americanus
(AY655139), and H. gammarus (AJ581662). A thiolester-like motif (GCGWPRHM) was observed in prophenoloxidase of freshwater prawn M. rosenbergii (AY947400), and a thiol-ester-like motif (GCGWPEHL) was observed in prophenoloxidase of crayfish P. leniusculus (X83494), respectively. In the study, a thiol-ester-like motif (GCGWPDHL) was also observed in red swamp crayfish P. clarkii, but no signal peptide was detected in the red swamp crayfish P. clarkii prophenoloxidase as was in the black tiger shrimp P. monodon prophenoloxidase (Sritunyalucksana et al. 1999). Five N-glycosyslayion sites as well as six histidine residues in two copper-binding sites are observed in prophenoloxidases of black tiger shrimp P. monodon and other decapod crustaceans (Sritunyalucksana et al. 1999; Lai et al. 2005; Ko et al. 2007). In the present study, eight putative N-glycosyslayion sites and six histidine residues in two copper-binding sites were predicted in P. clarkii prophenoloxidase. The six-histidine residues within the two copper-binding motifs are highly conserved in all arthropod prophenoloxidases (Lai et al. 2005; Sritunyalucksana et al. 2000) including the red swamp crayfish P. clarkii prophenoloxidase (EF595973). The cDNA sequence of mud crab S. serrata prophenoloxidase consisted of 2 663 bp, containing an open reading frame (ORF) of 2 019 bp, a 5´-untranslated region of 124 bp, and a 3´-untranslated region of 520 bp with a poly A signal (AATAAA) (Ko et al. 2007). In the present study, the 3 721-bp cDNA of red swamp crayfish P. clarkii prophenoloxidase contains an open © 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
378
reading frame (ORF) of 1 881 bp, a 154-bp 5´untranslated region, and a 1 686-bp 3´-untranslated region that has three ployA signals (AATAAA), suggesting that this gene may have multiple transcripts. The phenomenon that synonymous codons were not used by several genes in a great variety of organisms was discovered by Grantham et al. (1980). In the present study, the analysis of codon usage frequency indicated that the codons’ usage of P. clarkii prophenoloxidase has its preference, but not randomness. The different level of tRNA in organism was speculated through analyzing the comparability of coding strategy in different species. In P. clarkii, the levels of tRNAs containing codons of CGC, GCC, UGA, GCU, and UCC were high. In conclusion, a 3 721-bp prophenoloxidase cDNA was cloned from haemocytes of the red swamp crayfish P. clarkii. It encoded a protein of 627 amino acids, and the calculated molecular mass was 72.3 kDa. Comparison of amino acid sequences showed that P. clarkii prophenoloxidase was most closely related to that of freshwater crayfish P. leniusculus and more closely related to other crustacean prophenoloxidases from shrimp, prawn, and lobster than to the insect prophenoloxidases.
Acknowledgements
LI Yan-he et al.
analysis of crayfish haemocytes activated by lipopolysaccharides. Fish & Shellfish Immunology, 17, 223233. Cherqui A, Duvic B, Brehelin M. 1996. Purification and characterization of prophenoloxidase from the haemolymph of Locusta migratoria. Archives of Insect Biochemistry and Physiology, 32, 225-235. Cong R, Sun W, Liu G, Fan T, Meng X, Yang L, Zhu L. 2005. Purification and characterization of phenoloxidase from clam Ruditapes philippinarum. Fish & Shellfish Immunology, 18, 61-70. Grantham R, Gautier C, Gouy M. 1980. Codon frequencies in 119 individual genes confirm consistent choices of degenerate bases according to genome type. Nucleic Acids Research, 8, 1893-1912. Hellio C, Bado-Willes A, Gagnaire B, Renault T, Thomas-Guyon H. 2007. Demonstration of a true phenoloxidase activity and activation of a proPO cascade in Pacific oyster, Crassostrea gigas (Thunberg) in vitro. Fish & Shellfish Immunology, 22, 433-440. Hughes A L. 1999. Evolution of the arthropod prophenoloxidase/ hexamerin protein family. Immunogenetics, 49, 106-114. Johansson M W, Keyser P, Sritunyalucksana K, Söderhäll K. 2000. Crustacean haemocytes and haematopoiesis. Aquaculture, 191, 45-52. Ko C F, Chiou T T, Vaseeharan B, Lu J K, Chen J C. 2007. Cloning and charaterisation of a prophenoloxidase from the haemocytes of mud crab Scylla serrata. Developmental and Comparative Immunology, 31, 12-22.
This study was financed by the Key Technology R&D Program from the Ministry of Science and Technology, China (2006BAD06A01), the Opening Subject of Hubei Key Lab of Animal Embryo & Molecular Breeding (2007ZD07), and the Promoting Fund of Anhui Province Finance Department, China (05C1001). The authors also express their gratitude to the staff at the Animal Virus Laboratory, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China, for technical assistance.
Lai C Y, Cheng W, Kuo C M. 2005. Molecular cloning and
References
Liu C H, Tseng D Y, Lai C Y, Cheng W, Kuo C M. 2006.
charaterisation of prophenoloxidase from haemocytes of the white shrimp, Litopenaeus vannamei. Fish & Shellfish Immunology, 18, 417-430. Li J S, Kim S R, Christensen B M, Li J. 2005. Purification and primary structural characterization of prophenoloxidases from Aedes aegypti larvae. Insect Biochemistry and Molecular Biology, 35, 1269-1283. Lin X, Cerenius L, Lee B L, Söderhäll K. 2007. Purification of properoxinectin, a myeloperoxidase homologue and its activation to a cell adhesion molecule. Biochimica et Biophysica Acta, 1770, 87-93.
Aspán A, Huang T S, Cerenius L, Söderhäll K. 1995. cDNA cloning of prophenoloxidase from the freshwater crayfish, Pacifastacus leniusculus and its activation. Proceedings of the National Academy of Sciences of the USA, 92, 939-943. Cárdenas W, Dankert J R. 2000. Cresolase, catecholase and laccase activities in haemocytes of the red swamp crayfish. Fish & Shellfish Immunology, 10, 33-46. Cárdenas W, Dankert J R, Jenkins J A. 2004. Flow cytometric
Molecular cloning and charaterisation of prophenoloxidase cDNA from haemocytes of the giant freshwater prawn, Macrobrachium rosenbergii, and its transcription in relation with the moult stage. Fish & Shellfish Immunology, 21, 6069. Lu K Y, Huang Y T, Lee H H, Sung H H. 2006. Cloning the prophenoloxidase cDNA and monitoring the expression of proPO mRNA in prawns (Macrobrachium rosenbergii)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
379
stimulated in vivo by CpG oligodeoxynucleotides. Fish & Shellfish Immunology, 20, 274-284.
system in crustaceans. Aquaculture, 191, 53-69. Söderhäll K. 1985. The bee venom melittin induces lysis of
Perazzolo L M, Barracco M A. 1997. The prophenoloxidase activation system of the shrimp Penaeus pauLensis and
arthropod granular cells and inhibits activation of the prophenoloxidase-activating system. Federation of European
associated factors. Developmental and Comparative Immunology, 21, 385-395.
Biochemical Societies, 192, 109-112. Wang Y, Jiang H. 2004. Prophenoloxidase (proPO) activation in
Saul S J, Sugumaran M. 1986. Protease inhibitor controls prophenoloxidase activation in Manduca sexta. Federation
Manduca sexta: an analysis of molecular interactions among proPO, proPO-activating proteinase-3, and a cofactor. Insect
of European Biochemical Societies, 208, 113-116. Sritunyalucksana K, Cerenius L, Söderhäll K. 1999. Molecular
Biochemistry and Molecular Biology, 34, 731-742. Zhang T Y, Chen H Q, Liang Z, Li Y H, Gan X W. 2007. Cloning
cloning and charaterisation of prophenoloxidase in the black tiger shrimp, Penaeus monodon. Developmental and
and sequence analysis of Melanocortin receptor-4 gene in goose. Acta Veterinaria et Zootechnica Sinica, 39, 913-919.
Comparative Immunology, 23, 176-186. Sritunyalucksana K, Söderhäll K. 2000. The proPO and clotting
(in Chinese) (Edited by ZHANG Juan)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
March 2009
2009, 8(3): 369-379
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii LI Yan-he1, 3, ZHENG Fang-liang2, CHEN Hong-quan1, WANG Han-zhong2, WANG Liu-quan3 and XU Di-ping4 1 2 3 4
Anhui Agricultural University, Hefei 230036, P.R.China State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, P.R.China The Fishery Institute, Anhui Academy of Agricultural Sciences, Hefei 230031, P.R.China Huibei Key Laboratory of Animal Embryo & Molecular Breeding, Hubei Academy of Agricultural Sciences, Wuhan 430064, P.R.China
Abstract The full-length cDNA sequence of prophenoloxidase was obtained through RACE technology. The complete cDNA sequence is 3 721-bp long, containing an open reading frame (ORF) of 1 881 bp, a 154-bp 5´-untranslated region, and a 1 686bp 3´-untranslated region with three potential functional poly(A) signals (AATAAA). The molecular mass of the deduced amino acid sequence (627 aa) was 72.3 kDa with an estimated pI of 5.88. It contained putative copper-binding sites (copper A: 131, 135, 167 and copper B: 301, 305, 341), and a tentative complement-like motif (GCGWPDHL). Eight potential N-linked glycosylation sites were predicted to be present in P. clarkii prophenoloxidase. Similar to those in other arthropod prophenoloxidases reported so far, no signal peptide was detected in the crayfish prophenoloxidase. The phylogenetic trees confirmed that P. clarkii prophenoloxidase was most closely related to that of freshwater crayfish P. leniusculus and more closely related to other crustacean prophenoloxidases from shrimp, prawn, and lobster than to the insect prophenoloxidases. Besides, two putative introns were found in this sequence of genomic DNA. Key words: prophenoloxidase cDNA, Procambarus clarkii, nucleotide sequence, copper-binding sites, intron
INTRODUCTION High economic losses of crustacean aquaculture owing to disease outbreaks are widespread among the crustacean producing countries around the world. Different strategies have been used to solve the problem, such as improving the management of cultivation conditions and using different chemicals to kill the pathogens or maintaining a stable quality of pond water (Lu et al. 2006). In order to prevent and control disease in cultured crustaceans, an understanding of their defense system is becoming an important issue.
Crustaceans have an innate immune system, including humoral and cellular immune responses. The haemocytes play a critical role in these immune reactions and are capable of phagocytosis, encapsulation of foreign material, nodule formation, mediation of cytotoxicity and cellagglutination, and melanisation by activation of the prophenoloxidase activating system (Hughes 1999; Johansson et al. 2000). The similarity between prophenoloxidase of Procambarus clarkii and other species of freshwater crayfish can enable us to examine some of the factors that activate this system (Cárdenas et al. 2000, 2004). The prophenoloxidase activating system is an enzy-
Received 26 June, 2008 Accepted 8 October, 2008 LI Yan-he, MSc, E-mail: [email protected]; Correspondence CHEN Hong-quan, Professor, Tel: +86-551-5786329, E-mail: [email protected]
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
370
matic cascade associated with the pathogen defense mechanisms and is considered as an important mechanism of innate defense in arthropods (Wang et al. 2004; Lu et al. 2006; Claire et al. 2007). This enzymatic cascade has been studied in crustaceans such as the crayfishes Astacus astacus and Pacifastacus leniusculus. Prophenoloxidase resides in circulating granular cells and semi-granular cells of haemocytes in crustaceans (Söderhäll 1985; Johansson et al. 2000). Understanding the activation of the proPO system and the structure of some species proPO can enable us to evaluate the health of crustaceans stocks and to serve crustaceans diseases-controlling. While proPO cDNA has been cloned from the crayfish P. leniusculus (Aspán et al. 1995), giant freshwater prawn Macrobarchium rosenbergii (Liu et al. 2006; Lu et al. 2006), giant tiger shrimp Penaeus monodon (Sritunyalucksana et al. 1999), white shrimp Litopenaeus vannamei (Lai et al. 2005), kuruma shrimp Marsupenaeus japonicus (AB065371, AB073223), green tiger shrimp Penaeus semisculcatus (AF521949), American lobster H. americanus (AY655139), European lobster H. gammarus (HGA581662), and Dungeness crab Cancer magister (DQ230981), there are still no reports on the prophenoloxidase cDNA sequence of freshwater crayfish P. clarkii. In this study, the full-length prophenoloxidase cDNA sequence was cloned from the hemocytes of P. clarkii. The deduced amino acid sequences were then used for phylogenetic relationship with other known arthropod prophenoloxidases.
MATERIALS AND METHODS Collection and maintenance of red swamp crayfish P. clarkii P. clarkii obtained from a commercial farm in Wuhan, Hubei, China, were acclimatized in plastic containers and artificially fed twice a day before experimentation.
Primers design Primers for the amplification of Procambarus clarkii prophenoloxidase partial cDNA sequence were designed
LI Yan-he et al.
based on the highly conserved nucleotides of prophenoloxidase of the known crustaceas. The sense primer and antisense primer were proPOF and proPOR (Table 1). The primers for 3´-rapid amplification of cDNA ends (RACE) and 5´-RACE, and the specific primer pair PPO-F and PPO-R were used to amplify the genomic DNA and obtain the partial cDNA sequence of P. clarkii prophenoloxidase.
Total RNA isolation and RT-PCR Haemolymph was collected from the sinus of P. clarkii using a 5 mL syringe containing pre-cooled (4°C) crayfish anticoagulant buffer (Lin et al. 2007). The sample was centrifuged at 500 × g for 20 min at 4°C and the pellet was harvested. The haemocyte pellet was used for isolation of total RNA. The total hemocyte RNA was extracted using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s recommendations, and the concentration of the total RNA was determined by measuring the absorbance at 260 nm. To clone the partial cDNA of prophenoloxidase gene from P. clarkii, total RNA was reversely transcribed using ThermoScript TM Reverse Transcriptase (Invitrogen, CA, USA) and oligodT-anchor as the primer to obtain the first-strand of cDNA. The primers of proPOF and proPOR were used to amplify the partial cDNA of prophenoloxidase gene. The PCR reaction was performed in a total volume of 50 L. The PCR mixture contained: 5 L of 10 × PCR buffer with 200 mM Tris-HCl (pH 8.4), 500 mM KCl, 1.5 L of 50 mM MgCl2, 1 L of 10 mM dNTP mix, 1 L of 10 M each primer, 36.3 L of sterile deionised water, and 0.2 L of platinum Taq DNA polymerase (5 U L-1) (Invitrogen, CA, USA). The reaction condition was as follows: 5 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 45 s, and elongation at 72°C for 2 min, and 30 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 45 s, and elongation at 72°C for 2 min, followed by a 10 min extension at 72°C and cooling to 4°C.
Genomic DNA extraction and amplification of two introns Muscle tissue (50 mg) excised from the abdomen of
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
the crayfish was rapidly frozen in liquid nitrogen and crushed to a fine powder. Genomic DNA of muscle tissue was extracted using phenol-chloroform method and was stored at -20°C until usage. PCR was performed as follows: 5 cycles of denaturalization at 94°C for 30 s, annealing at 57°C for 45 s, and elongation at 72°C for 3 min, and 24 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 45 s, and elongation at 72°C for 3 min, followed by a 10 min extension at 72°C and cooling to 4°C.
5´- and 3´-rapid amplification of cDNA ends (5´and 3´-RACE) For 5´-RACE, 3 mg of total RNA was reverse-transcribed with the first nested primer proPO5´1R that is specific to P. clarkii prophenoloxidase gene. The firststrand cDNA used for the 5´-RACE was synthesized w i t h T h e r m o S c r i p t TM R e v e r s e T r a n s c r i p t a s e (Invitrogen, CA, USA). Terminal transferase TdT and dATP were attached to the 5´-end of the first-strand cDNA. The primer sets are proPO5´2R plus oligodTanchor for the first-run PCR, and proPO5´3R plus anchor primer for the second-run PCR (Table 1). The first-run PCR reaction was the same as that described above, except that the annealing temperature was 60°C for the first 5 cycles and 56°C for the following 30 cycles. The second-run PCR reaction condition was as follows: 35 cycles of denaturalization at 94°C for 30 s, annealing at 59°C for 45 s, and elongation at 72°C for 1 min, followed by a 10 min extension at 72°C and cooling to 4°C. For the 3´-RACE, the reverse transcription reaction remained the same as that for obtaining the cDNA
371
fragment. Two successive PCRs were carried out with primer pairs of proPO3´1F plus anchor primer and proPO3´2F plus anchor primer for the first and second runs, respectively (Table 1). Again, the PCR reaction was the same as that in the 5´-RACE second-run PCR described above, except that the elongation time of 35 cycles was 2 min.
Sequence analysis The prophenoloxidase cDNA sequence was analyzed using the BLASTX and BLASTP search programs (http:// www.blast.genome.ad.jp) and compared with the homolog sequences in the GenBank database. The alignment of multiple amino acid sequences was done using DNAStar software, and phylogenetic reports were constructed by the Neighbor-joining method using MEGA3.1 software. GenBank accession numbers of the sequences used for this analysis are included in Table 2.
Parameter analysis of codons’ usage frequencies The deduced amino acids of amplified prophenoloxidase cDNA were analyzed by the parameters of codons’ usage frequencies (F) (Zhang et al. 2007). The codons’ usage frequencies were obtained using the formula: F = mk/n. In the formula, the type of certain amino acid synonymous codon was signed as m, n denotes the times that certain amino acid appears in the protein, and k represents the frequency of certain codon used for the amino acid. When synonymous codon used for the amino acid appears randomly, the frequency of each codon is equal to one.
Table 1 Sequence of different primers used in this experiment Primer
Predicted size (kb)
proPOF proPOR proPO5´1R proPO5´2R proPO5´3R proPO3´1F proPO3´2F OligodT-anchor Anchor PPO-F PPO-R
About 1.3 About 0.6
Above 0.5
Sequence (from 5´ to 3´) HCACCACTGGCACTGGCA GTCGAAWGGGAARCCCAT TACCTGGCTATCATCTGCTG AGTTCTCCTTTACGGTCCCGG CGGTTAACATTCGTGTCAATGGG ACCTGGACAAGGATGAGGTGG CTGGACGCCAAGTTCCCTGACA GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV GACCACGCGTATCGATGTCGAC GCCAGGATAATACCCTACTC TGTCATGGCAGAATGCCAGC
H = A or C or T; W = A or T; R = A or G; V = A or C or G.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
372
LI Yan-he et al.
Table 2 GenBank accession numbers of prophenoloxidase sequences analyzed Species Pacifastacus leniusculus (freshwater crayfish) Macrobrachium rosenbergii (giant freshwater prawn) Penaeus monodon1 (tiger shrimp) Penaeus monodon2 (tiger shrimp) Penaeus semisulcatus (green tiger shrimp) Litopenaeus vannamei (Pacific white shrimp) Marsupenaeus japonicus1 (kuruma shrimp) Marsupenaeus japonicus2 (kuruma shrimp) Scylla serrata (mud crab) Cancer magister (Dungeness crab) Homarus americanus (American lobster) Homarus gammarus (European lobster) Galleria mellonella (greater wax moth) Plodia interpunctella (Indianmeal moth) Musca domestica (house fly) Apis mellifera (honey bee)
RESULTS Cloning and sequence analysis of partial cDNA from P. clarkii An expected cDNA fragment of about 1.3 kb from haemocytes of P. clarkii was amplified with the primer pair of proPOF plus proPOR (Fig.1). The PCR products were purified and cloned into the pGEM-T Easy vector. Four clones were sequenced and found to contain the same cDNA fragment of 1 336 bp. cDNA sequence of the fragment showed significant similarity to that of prophenoloxidases for other decapod crustaceans in GenBank database. Using similar approaches, a cDNA fragment of 660 bp was obtained by 5´-RACE and a cDNA fragment of 1 885 bp was also amplified by 3´-RACE. The full-length of prophenoloxidase cDNA for P. clarkii was finally obtained by overlapping three cDNA fragments. The genomic DNA fragment obtained by the specific primer pair of PPO-F plus PPO-R was determined to be 1 679 bp (Fig.2), and two putative introns were found in this sequence of genomic DNA (Fig.3). The full-length cDNA of prophenoloxidase has 3 721 bp containing an open reading frame (ORF) of 1 884 bp, a 5´-untranslated region of 154 bp, and a 3´-untranslated region of 1686 bp with three typical polyA signals (AATAAA) and the polyA tail. It codes a protein of 627 amino acids with the putative initiation methionine codon (ATG) beginning at nucleotide 155 and the stop codon beginning at nucleotide 2 035. The calculated molecular mass is 72.3 kDa, and the estimated pI of this protein is
Abbreviation P. leniusculus M. rosenbergii P. monodon1 P. monodon2 P. semisulcatus L.vannamei M. japonicus1 M. japonicus2 S. serrata C. magister H.americanus H. gammarus G. mellonella P. interpunctella M. domestica A. mellifera
Prophenoloxidase X83494 DQ182596 AF099741 AF521948 AF521949 AY723296 AB073223 AB065371 DQ435606 DQ230981 AY655139 AJ581662 AF336289 AY665397 AY494738 AY242387
5.88. No signal peptide exists in the prophenoloxidase. One thiol ester region-like motif (GCGWPDHL) and eight potential N-glycosyslayion sites were found in P. clarkii
Fig. 1 The results of 1.0% agarose gel electrophoresis of PCR product of proPO cDNA fragment. M, 3 000 bp DNA ladder; lane 1, PCR product of proPO cDNA fragment; lane 2, negative comparison.
Fig. 2 The results of 0.8% agarose gel electrophoresis of PCR product of proPO DNA fragment. M, 2 000 bp DNA ladder.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
prophenoloxidase. The P. clarkii prophenoloxidase cDNA sequence with deduced amino acid sequence has been submitted to the NCBI GenBank (Accession number: EF595973) (Fig.4). Sequence comparison of the 5´-end 600 nucleotides in EF595973 with the remaining sequence in EF595973 by the BLASTX shows that nucleotides 124-575 are almost identical to nucleotides 619-1 070. Sequence analysis with ClustalW (DNAStar software) indicated that the deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 63.6, 54.5, 53.7, 52.3, 51.4, 51.2, 51.2, and 50.7% to that of prophenoloxidases from freshwater crayfish P. leniusculus, European lobster H. gammarus, American lobster H. americanus, Pacific white shrimp L. vannamei, kuruma shrimp M. japonicus1, tiger shrimp P. monodon1 and P. monodon2, and green tiger shrimp P. semisulcatus, respectively. The deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 31.9-36.5% with that of prophenoloxidases from insecta that include greater wax moth G. mellonella, Indianmeal moth P. interpunctella, honey bee A. mellifera, and house fly M. domestica. Comparison of the deduced amino acid sequences of copper-binding sites in prophenoloxidases of P. clarkii and other decapod crustaceans showed that P. clarkii proPO contains a putative copper-binding domain with six histidines (Fig.5) and a tentative complement-like motif (thiol ester region-like motif) (GCGWPDHL). Amino acid sequences around the thiol
373
ester region-like motif were aligned with those in arthropod prophenoloxidase (Fig.6). A molecular phylogenetic tree was constructed using MEGA3.1 to further analyze the evolutionary relationships among prophenoloxidases of crustacea and insecta (Fig.7). Arthropod prophenoloxidases can be classified into two major groups including insect and crustacean prophenoloxidases. Crustacean prophenoloxidasess can be further classified into five subgroups. One subgroup contains prophenoloxidases of Penaeus monodon1 (tiger shrimp), Marsupenaeus japonicus2 (kuruma shrimp), Penaeus semisulcatus (green tiger shrimp), Litopenaeus vannamei (Pacific white shrimp), Marsupenaeus japonicus1 (kuruma shrimp), and Penaeus monodon2 (tiger shrimp). The second subgroup contains prophenoloxidases of Pacifastacus leniusculus (freshwater crayfish) and P. clarkii (red swamp crayfish). The third subgroup contains prophenoloxidases of Homarus americanus (American lobster) and Homarus gammarus (European lobster). The fourth subgroup contains prophenolo-xidases of Macrobrachium rosenbergii (giant freshwater prawn). The fifth subgroup includes prophenolo-xidases of Cancer magister (Dungeness crab) and Scylla serrata (mud crab).
Codons’ usage analysis of P . clarkii prophenoloxidase 627 amino acids were deduced from the cDNA ORF
Fig. 3 Sequence of prophenoloxidase gene fragment from P. clarkii. Underlined letters represent sequence of exons and the others represent sequence of introns.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
374
LI Yan-he et al.
(from 154 to 2 035 bp) of P. clarkii prophenoloxidase (Fig.4). The composition of amino acids was obtained by DNAStar software, and the analysis of the frequencies of codons (Table 3) indicated a codons’ usage preference in P. clarkii prophenoloxidase. For 1 65 155 1 245 31 335 61 425 91 515 121 605 151 695 181 785 211 875 241 965 271 1 055 301 1 145 331 1 235 361 1 325 391 1 415 421 1 505 451 1 595 481 1 685 511 1 775 541 1 865 571 1 955 601 2 045 2 135 2 225 2 315 2 405 2 495 2 585 2 675 2 765 2 855 2 945 3 035 3 125 3 215 3 305 3 395 3 485 3 575 3 665
example, prophenoloxidase of P. clarkii prefers to use codons of GCU, GCA, or GCC, but not GCG for amino acid Ala. The correlation of codons’ usage frequencies for prophenoloxidases of P. clarkii and other arthro-
*
64 154 244 30 334 60 424 90 514 120 604 150 694 180 784 210 874 240 964 270 1 054 300 1 144 330 1 234 360 1 324 390 1 414 420 1 504 450 1 594 480 1 684 510 1 774 540 1 864 570 1 954 600 2 044 628 2 134 2 224 2 314 2 404 2 494 2 584 2 674 2 764 2 854 2 944 3 034 3 124 3 214 3 304 3 394 3 484 3 574 3 664 3 721
Fig. 4 Nucleotide sequence (above) and deduced amino acid sequence of P. clarkii prophenoloxidase. Nucleotides are numbered from the first base at the 5´ end. Amino acids are numbered from the initiating methionine. The possible N-glycosylation sites are underlined. The six histidine residues within the Cu A binding site (131, 135, 167) and the Cu B binding site (301, 305, 341) are shown in bold letter (H). The thiol-esterlike motif is shown in bold letter with double underlines. The asterisk (*) indicates the stop codon. The polyadenylation signal AATAAA is enclosed in solid lines. The sequence was submitted to GenBank with accession number of EF595973.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
pod (Table 4) indicated that P. clarkii prophenoloxidase has its special coding strategy. The correlation coefficient among P. clarkii and M. domestica was 0.068, indicating that the coding strategy for P. clarkii prophenoloxidase was less similar to that for M. domestica prophenoloxidase and synonymous codons were preferred to be used in P. clarkii prophenoloxidase.
375
The correlation coefficient among P. clarkii and A. mellifera was -0.360, indicating that the coding strategy for P. clarkii prophenoloxidase was different from that for A. mellifera prophenoloxidase. However, the coding strategy for P. clarkii prophenoloxidase was similar to that for other arthropod prophenoloxidases (0.5-0.8).
Fig. 5 Alignment of two copper-binding sites (A and B) with those in arthropod prophenoloxidase. Six highly conserved histidine residues are shown in black reverse print and boldfaced letters.
Fig. 6 Amino acid sequence alignment of thiol ester region-like motifs from arthropod prophenoloxidases.
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
376
LI Yan-he et al.
DISCUSSION In crustaceans, prophenoloxidase exists in the haemocytes in an inactive form and is activated by microbial cell wall constituents (Saul et al. 1986; Perazzolo and Barracco 1997; Lai et al. 2005). The monomer prophenoloxidase has a mass of about 70-80 kDa, and the phenoloxidase has a mass of 60-70 kDa (Aspán et al. 1995; Anas et al. 1996; Cong et al. 2005; Lia et al. 2005). Prophenoloxidase genes have been cloned from haemocytes of penaeid shrimps, including P. monodon (78.7 kDa) (Sritunyalucksana et al. 1999), S. serrata (77.5 kDa) (Ko et al. 2007), L. vannamei (78.1 kDa) (Lai et al. 2005), M. rosenbergii (76.7 kDa) (Liu et al. 2006), and P. lenuisculus (80.7 kDa) (Aspán et al. 1991; Aspán et al. 1995). In the study, a 3 721-bp prophenoloxidase cDNA from haemocytes of the red
Fig. 7 A molecular phylogenetic tree of seventeen arthropod prophenoloxidases via the Neighbour-joining method. Values for each internal branch were determined by bootstrap analysis with 1 000 replications and indicated percentages along the branch.
Table 3 The codons’ usage frequencies for P. clarkia prophenoloxidase Amino acid
Codon
Frequencie (%)
Amino acid
Codon
Frequencies (%)
Amino acid
Codon
Frequencies (%)
Ala
GCA GCC GCG GCU AGA AGG CGA CGC CGG CGU AAC AAU GAC GAU UGC UGU AAA AAG GUA GUC GUG GUU
1.379 1.103 0.000 1.517 0.750 0.875 0.625 1.125 1.625 1.000 1.349 0.651 1.296 0.704 0.800 1.200 0.500 1.500 0.242 0.727 1.939 1.091
Gln
CAA CAG GAA GAG GGA GGC GGG GGU CAG CAU AUA AUC AUU CUA CUC CUG CUU UUA UUG UAC UAU
0.455 1.545 0.235 1.765 0.923 1.231 0.923 0.923 1.100 0.900 0.621 1.448 0.931 0.381 2.095 2.190 0.762 0.190 0.381 1.250 0.750
Phe
UUC UUU CCA CCC CCG CCU AGC AGU UCA UCC UCG UCU ACA ACC ACG ACU
1.667 0.333 1.333 1.333 0.364 0.970 1.742 0.581 0.194 2.516 0.194 0.774 0.865 1.405 0.541 1.189
Arg
Asn Asp Cys Lys Val
Glu Gly
His Ile
Leu
Tyr
swamp crayfish P. clarkii was obtained and its calculated molecular mass was 72.3 kDa. The results of similarity BLAST showed that the nucleotides 124-575 in EF595973 are almost identical to nucleotides 619-1 070, suggesting that sequence duplication has occurred within EF595973. It needs further investigation to know if the sequence duplication exists throughout the species of crayfish P. clarkii or is only found in the individual of P. clarkii.
Pro
Ser
Thr
Sequence analysis via the BLAST algorithm shows that the deduced amino acid sequence of P. clarkii prophenoloxidase has the highest similarity to that of freshwater crayfish P. leniusculus (63.6%) (Aspán et al. 1995), and has similarity of 48.3-54.5% to that of prophenoloxidases from other decapod crustaceans, including Dungeness crab C. magister (DQ230981), American lobster H. americanus (AY655139), European lobster H. gammarus (HGA581662), kuruma
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
377
Table 4 The correlation of codon usage in prophenoloxidases from 17 species 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
0.539 0.600 0.665 0.608 0.583 0.584 0.565 0.716 0.631 0.503 0.781 0.786 0.068 0.614 -0.360 0.537
0.507 0.564 0.864 0.965 0.959 0.614 0.543 0.769 0.811 0.567 0.428 0.139 0.695 -0.530 0.774
0.970 0.605 0.557 0.560 0.489 0.716 0.592 0.463 0.691 0.722 0.265 0.498 -0.120 0.351
0.642 0.600 0.599 0.519 0.784 0.614 0.473 0.728 0.746 0.241 0.539 -0.150 0.388
0.868 0.868 0.776 0.634 0.794 0.804 0.684 0.595 0.122 0.838 -0.680 0.840
0.998 0.653 0.533 0.826 0.837 0.590 0.499 0.106 0.730 -0.540 0.786
0.660 0.531 0.835 0.840 0.602 0.499 0.095 0.728 -0.540 0.790
0.513 0.611 0.600 0.676 0.535 0.053 0.704 -0.500 0.694
0.560 0.457 0.728 0.818 0.313 0.686 -0.300 0.545
0.873 0.632 0.515 -0.100 0.705 -0.520 0.721
0.509 0.411 -0.030 0.711 -0.600 0.805
0.778 0.080 0.657 -0.280 0.579
0.248 0.653 -0.250 0.510
0.149 0.175 0.101
15
-0.693 0.911
16
-0.712
1, P. clarkii; 2, P. semisuLcatus; 3, H. americanus; 4, H. gammarus; 5, L. vannamei; 6, P. monodon1; 7, P. monodon2; 8, M. rosenbergii; 9, C. magister; 10, M. japonicus1; 11, M. japonicus2; 12, P. leniusculus; 13, S. serrata; 14, M. domestica; 15, G. mellonella; 16, A. mellifera; 17, P. interpunctella.
shrimp M. japonicus1 and M. japonicus2 (AB065371, AB073223), white shrimp L. vannamei (Lai et al. 2005), tiger shrimp P. monodon1 and P. monodon2 (Sritunyalucksana et al. 1999), green tiger shrimp P. semisulcatus (AF521949), giant freshwater prawn M. rosenbergii (Liu et al. 2006; Lu et al. 2006), and mud crab S. serrata (Ko et al. 2007). The deduced amino acid sequence of P. clarkii prophenoloxidase has similarity of 31.9-36.5% to that of prophenoloxidase from insecta, including greater wax moth G. mellonella, Indian meal moth P. interpunctella, tobacco hornworm M. sexta, honey bee A. mellifera, and house fly M. domestica. Phylogenetic analysis revealed that red swamp crayfish P. clarkii prophenoloxidase is distinctly far away from prophenoloxidase of insecta, and is also distinct from prophenoloxidase of penaeid shrimps, lobster, and freshwater prawn. The present study also indicated that the decapod crustacean prophenoloxidases can be probably classified into five distinct branches: freshwater prawn, crayfish, lobster, penaeid shrimps, and crab. A thiolester-like motif (GCGWPQHM) was found in prophenoloxidase of green tiger shrimp P. semisculatus (AF521949), black tiger shrimp P. monodon (Sritunyalucksana et al. 1999), kuruma shrimp M. japonicus (AB065371, AB073223), white shrimp L. vannamei (Lai et al. 2005), Dungeness crab C. magister (DQ0230981), and mud crab S. serrata (DQ435606). A thiol-ester-like motif (GCGWPQHL) was observed in prophenoloxidase of lobster H. americanus
(AY655139), and H. gammarus (AJ581662). A thiolester-like motif (GCGWPRHM) was observed in prophenoloxidase of freshwater prawn M. rosenbergii (AY947400), and a thiol-ester-like motif (GCGWPEHL) was observed in prophenoloxidase of crayfish P. leniusculus (X83494), respectively. In the study, a thiol-ester-like motif (GCGWPDHL) was also observed in red swamp crayfish P. clarkii, but no signal peptide was detected in the red swamp crayfish P. clarkii prophenoloxidase as was in the black tiger shrimp P. monodon prophenoloxidase (Sritunyalucksana et al. 1999). Five N-glycosyslayion sites as well as six histidine residues in two copper-binding sites are observed in prophenoloxidases of black tiger shrimp P. monodon and other decapod crustaceans (Sritunyalucksana et al. 1999; Lai et al. 2005; Ko et al. 2007). In the present study, eight putative N-glycosyslayion sites and six histidine residues in two copper-binding sites were predicted in P. clarkii prophenoloxidase. The six-histidine residues within the two copper-binding motifs are highly conserved in all arthropod prophenoloxidases (Lai et al. 2005; Sritunyalucksana et al. 2000) including the red swamp crayfish P. clarkii prophenoloxidase (EF595973). The cDNA sequence of mud crab S. serrata prophenoloxidase consisted of 2 663 bp, containing an open reading frame (ORF) of 2 019 bp, a 5´-untranslated region of 124 bp, and a 3´-untranslated region of 520 bp with a poly A signal (AATAAA) (Ko et al. 2007). In the present study, the 3 721-bp cDNA of red swamp crayfish P. clarkii prophenoloxidase contains an open © 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
378
reading frame (ORF) of 1 881 bp, a 154-bp 5´untranslated region, and a 1 686-bp 3´-untranslated region that has three ployA signals (AATAAA), suggesting that this gene may have multiple transcripts. The phenomenon that synonymous codons were not used by several genes in a great variety of organisms was discovered by Grantham et al. (1980). In the present study, the analysis of codon usage frequency indicated that the codons’ usage of P. clarkii prophenoloxidase has its preference, but not randomness. The different level of tRNA in organism was speculated through analyzing the comparability of coding strategy in different species. In P. clarkii, the levels of tRNAs containing codons of CGC, GCC, UGA, GCU, and UCC were high. In conclusion, a 3 721-bp prophenoloxidase cDNA was cloned from haemocytes of the red swamp crayfish P. clarkii. It encoded a protein of 627 amino acids, and the calculated molecular mass was 72.3 kDa. Comparison of amino acid sequences showed that P. clarkii prophenoloxidase was most closely related to that of freshwater crayfish P. leniusculus and more closely related to other crustacean prophenoloxidases from shrimp, prawn, and lobster than to the insect prophenoloxidases.
Acknowledgements
LI Yan-he et al.
analysis of crayfish haemocytes activated by lipopolysaccharides. Fish & Shellfish Immunology, 17, 223233. Cherqui A, Duvic B, Brehelin M. 1996. Purification and characterization of prophenoloxidase from the haemolymph of Locusta migratoria. Archives of Insect Biochemistry and Physiology, 32, 225-235. Cong R, Sun W, Liu G, Fan T, Meng X, Yang L, Zhu L. 2005. Purification and characterization of phenoloxidase from clam Ruditapes philippinarum. Fish & Shellfish Immunology, 18, 61-70. Grantham R, Gautier C, Gouy M. 1980. Codon frequencies in 119 individual genes confirm consistent choices of degenerate bases according to genome type. Nucleic Acids Research, 8, 1893-1912. Hellio C, Bado-Willes A, Gagnaire B, Renault T, Thomas-Guyon H. 2007. Demonstration of a true phenoloxidase activity and activation of a proPO cascade in Pacific oyster, Crassostrea gigas (Thunberg) in vitro. Fish & Shellfish Immunology, 22, 433-440. Hughes A L. 1999. Evolution of the arthropod prophenoloxidase/ hexamerin protein family. Immunogenetics, 49, 106-114. Johansson M W, Keyser P, Sritunyalucksana K, Söderhäll K. 2000. Crustacean haemocytes and haematopoiesis. Aquaculture, 191, 45-52. Ko C F, Chiou T T, Vaseeharan B, Lu J K, Chen J C. 2007. Cloning and charaterisation of a prophenoloxidase from the haemocytes of mud crab Scylla serrata. Developmental and Comparative Immunology, 31, 12-22.
This study was financed by the Key Technology R&D Program from the Ministry of Science and Technology, China (2006BAD06A01), the Opening Subject of Hubei Key Lab of Animal Embryo & Molecular Breeding (2007ZD07), and the Promoting Fund of Anhui Province Finance Department, China (05C1001). The authors also express their gratitude to the staff at the Animal Virus Laboratory, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China, for technical assistance.
Lai C Y, Cheng W, Kuo C M. 2005. Molecular cloning and
References
Liu C H, Tseng D Y, Lai C Y, Cheng W, Kuo C M. 2006.
charaterisation of prophenoloxidase from haemocytes of the white shrimp, Litopenaeus vannamei. Fish & Shellfish Immunology, 18, 417-430. Li J S, Kim S R, Christensen B M, Li J. 2005. Purification and primary structural characterization of prophenoloxidases from Aedes aegypti larvae. Insect Biochemistry and Molecular Biology, 35, 1269-1283. Lin X, Cerenius L, Lee B L, Söderhäll K. 2007. Purification of properoxinectin, a myeloperoxidase homologue and its activation to a cell adhesion molecule. Biochimica et Biophysica Acta, 1770, 87-93.
Aspán A, Huang T S, Cerenius L, Söderhäll K. 1995. cDNA cloning of prophenoloxidase from the freshwater crayfish, Pacifastacus leniusculus and its activation. Proceedings of the National Academy of Sciences of the USA, 92, 939-943. Cárdenas W, Dankert J R. 2000. Cresolase, catecholase and laccase activities in haemocytes of the red swamp crayfish. Fish & Shellfish Immunology, 10, 33-46. Cárdenas W, Dankert J R, Jenkins J A. 2004. Flow cytometric
Molecular cloning and charaterisation of prophenoloxidase cDNA from haemocytes of the giant freshwater prawn, Macrobrachium rosenbergii, and its transcription in relation with the moult stage. Fish & Shellfish Immunology, 21, 6069. Lu K Y, Huang Y T, Lee H H, Sung H H. 2006. Cloning the prophenoloxidase cDNA and monitoring the expression of proPO mRNA in prawns (Macrobrachium rosenbergii)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.
Cloning and Sequence Analysis of Prophenoloxidase from Haemocytes of the Red Swamp Crayfish, Procambarus clarkii
379
stimulated in vivo by CpG oligodeoxynucleotides. Fish & Shellfish Immunology, 20, 274-284.
system in crustaceans. Aquaculture, 191, 53-69. Söderhäll K. 1985. The bee venom melittin induces lysis of
Perazzolo L M, Barracco M A. 1997. The prophenoloxidase activation system of the shrimp Penaeus pauLensis and
arthropod granular cells and inhibits activation of the prophenoloxidase-activating system. Federation of European
associated factors. Developmental and Comparative Immunology, 21, 385-395.
Biochemical Societies, 192, 109-112. Wang Y, Jiang H. 2004. Prophenoloxidase (proPO) activation in
Saul S J, Sugumaran M. 1986. Protease inhibitor controls prophenoloxidase activation in Manduca sexta. Federation
Manduca sexta: an analysis of molecular interactions among proPO, proPO-activating proteinase-3, and a cofactor. Insect
of European Biochemical Societies, 208, 113-116. Sritunyalucksana K, Cerenius L, Söderhäll K. 1999. Molecular
Biochemistry and Molecular Biology, 34, 731-742. Zhang T Y, Chen H Q, Liang Z, Li Y H, Gan X W. 2007. Cloning
cloning and charaterisation of prophenoloxidase in the black tiger shrimp, Penaeus monodon. Developmental and
and sequence analysis of Melanocortin receptor-4 gene in goose. Acta Veterinaria et Zootechnica Sinica, 39, 913-919.
Comparative Immunology, 23, 176-186. Sritunyalucksana K, Söderhäll K. 2000. The proPO and clotting
(in Chinese) (Edited by ZHANG Juan)
© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.