Cloning and sequence analysis of thymidine kinase from the oral bacterium Streptococcus gordonii

ELSEVIER

FEMS Microbiology

Letters 135 (1996) 103-l IO

Cloning and sequence analysis of thymidine kinase from the oral bacterium Streptococcus gordonii Roderick McNib Department of Owl Btology and Oml ,Pathology, nnd Centre

for

Received 18 Qctobtr

Gene Resect&.

* .Uniwrpit~

1995: accepted.~3 Notiember

qf Orago. PO Box 647. Drtnedtn. NW Awland

199s

--Abstract k&se is an impom enqme in M pyrimidine n@eoti& salvage pathway and catalyzza the formation of ‘from thymidine using ATP as a phosphate donor. Thc~geirc encoding thymidine kinase of the oral bacterium Srreptococcus gordonii was cloned and ihe mrcle&de .sequence determined. The inferred amino acid sequence of thymidine k.inase (191 amino acids) exhibit@ 43% .kien$titywith type B thj&&ne kinase from Escherichitr co/i. The S. gordonii thymidine kinase expressed in Es~?herichiu koli KY895 @dlc-) wasinhibited by thymidine triphosphate, a feature tjfpical of type II thymidine kinases. Immediately 3’ to the rd/c gene, and pos’s&ly co-transcribed with it, was the gene encoding release factor 1 (p-$4). Dymidine

thyhidylate

Kqworr/.~:Strrpror~orr~ts gordonii; Thymidine kinase; Release factor

1. Introduction

gordonii

Streptococcus gordonii is a prominent component of human dental plaque and colonizes most oral sites [I]. Because S. gordonii binds with high affinity to salivary pellicle [2] and to a multitude of other plaque organisms [3], this bacterium is an important influence in plaque development. Like other streptococci, S. gordonii is fastidious in its growth requirements [4] and is adapted to grow and survive in the complex nutritional environment of the human host. Understanding the metabolic processes essential for growth in vivo of these bacteria is important in order to control streptococcal infections. Research on S.

_ Tel.: +64 (3) 479 7080; Fax: [email protected].

f64

Federation of European Microbiological ssD/0378-1097(95)00437-8

(3) 479 0673; E-mail:

Societies

has centred on its adherence ability (reviewed’ by Jenkinson [5]). In the course of work attempting to clone the S. gordonii gene endoding a putative cell surface hydrophobin (43 kDa) 161, a library of S. gordonii DNA was screened using antiserum raised to the 43-kDa adhesin. Several clones were isolated that were found to encode a 2 I -kDa polypeptide that cross-reacted wkh antiserum to the 43-kDa polypeptide and that was identified through sequence homology as thymidine kinase. Thymidine kinase (TK; EC 2.7. I.2 I), which catalyzes the formation of thymidylate (TMP) from thymidine using ATP as a phosphate donor, is a key enzyme in the pyrimidine nucleotide salvage pathway. This paper describes the characterization of the S. gordonii thymidine kinase which is immediately upstream of a DNA sequence encoding release factor

I (RFl) thesis.

essential

2. Materials

for the termination

of protein syn-

and methods

2.1. Bacteria and culture conditions Streptococcus gordonii DL 1 (Challis) was grown on TSBY agar [7] in a GasPak System (Becton Dickinson Microbiology Systems, Cockeysville, MD) at 37°C. Liquid cultures were grown in BHY medium [7] without shaking in screwcap tubes or bottles. Escherichia co/i strain KY895 (F-, tdk-I, ill,), originally described by Igarashi et al. [8], was a kind gift from M.E. Black, University of Washington, Seattle, WA. E. coli XLI-Blue (Stratagene, La Jolla, CA) was used as host strain for hZAPII and pBluescript. pUC19 clones were maintained in E. coli JM83. 2.2. Preparation of antibodies, struction and screening

genomic library con-

Antibodies to the 43-kDa polypeptide were raised as described by McNab and Jenkinson [9]. Briefly, the polypeptide was purified from a cell envelope preparation by electroelution following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Purified polypeptide was dialyzed extensively against distilled Hz0 and freeze-dried. Antibodies were raised in New Zealand rabbits by intramuscular injection of 20 pg of protein with two boosts of 5 pg over 2-3 months. The generation of a partial Suu3Al library of S. gordonii DLI DNA in AZAPII (Stratagene) and in vivo excision of phagemid pBluescript was performed according to the manufacturer’s instructions. For library screening, A phage were plated in top agarose [lo] at approximately 2 X 10” pfu per 90-mm diameter plate and incubated for 2 to 3 h at 42°C when very small plaques were detected. Plates were overlayered with nitrocellulose discs that had previously been soaked in isopropyl-P-D-thiogalactopyranoside (IPTG) solution (10 mM) and allowed to dry at room temperature. Plates and discs were subsequently incubated for 4 h at 37°C then chilled for I5 min at 4°C and the nitrocellulose discs were removed carefully and then washed in TBS (10 mM

Tris . HCI pH 7.5. 0. I5 M NaCI). Discs were reacted with antiserum to the 43-kDa polypeptide diluted I :500. Antibody binding was detected by incubation of discs with peroxidase-conjugated swine immunoglobulins to rabbit immunoglobulin G (diluted I: 1000). Positive plaques were picked and phage were purified following a further two cycles of plaque screening. 2.3. DNA manipulations Routine molecular biology techniques were performed according to Sambrook et al. [IO]. Plasmid subclones in pUC19 were prepared for DNA sequencing using an alkaline lysis miniprep procedure [IO]. Single-stranded templates were prepared as described previously [9] and sequencing was performed using Sequenase (United States Biochemical Corp., Cleveland, OH) with M I3 forward or reverse primers or with custom-synthesized primers (DNA Express, Colorado State University, Fort Collins, CO). The BLAST algorithm [I I] was used for database searches. Inferred amino acid sequence data were analyzed using the University of Wisconcin GCG package [ 121. The nucleotide sequence reported in this paper appears in the GSDB/EMBL/DDJB/ NCBI Nucleotide Sequence Data Libraries under the accession number L404 15. 2.4. Bacterial cell extract preparation kinase as.suv~

and thynidine

E. co/i cultures (20 ml) were grown to an OD,,,,, of 0.8 and cells were harvested by centrifugation (4 500 X g, 10 min, 4°C). Cells were washed once in PBSM (0.14 M NaCl, 2.7 mM KCl, 10.1 mM Na,HPO,. 1.8 mM KH,PO,, pH 7.3 containing 1 mM MgC12) and suspended in I ml TK assay buffer (50 mM Tris . HCI, 5 mM MgCl,, pH 7.5 containing 1 mM PMSF and I pg ml- ’ ,pepstatin A). Bacterial cells were disrupted by sonication (twice for 30 s each time with cooling on ice) and bacterial debris was removed by centrifugation ( 12 000 X g. 10 min. 4°C). TK assays were performed as soon as possible on fresh cell extracts since activities were not stable on storage at -20°C (E. coli cell extracts lost approximately 50% activity after 2 weeks at - 20°C). Protein concentrations were determined with the

R. McNah

/ FEMS

Microbiology

BioRad protein assay system (BioRad Laboratories, Richmond, CA) using bovine plasma y globulin as a standard. TK activity was determined using a filter binding assay measuring the production of ‘H-labelled thymidylate (TMP). Reaction mixtures (70 ~1) contained cell extract in TK assay buffer with dithiothreitol (5 mM1, ATP (2 mM), unlabelled thymidine (2 PM) and [methyl-‘Hlthymidine (3 PCi, specific Amersham International plc., activity 85 Ci mmoll ’ ; Buckinghamshire, UK). Reactions were started by the addition of an equal volume of cell extract to a two-fold concentration of reaction components, and were incubated at 37°C. For inhibition experiments, TTP was included at 0.1 mM. Samples (10 ~1) were removed at intervals and added to ice-cold thymidine solution (10 PM in dH,O, 40 ~1). A portion (40 ~1) of each of the stopped reactions was spotted onto a DE81 ion exchange paper filter (2.3 cm diameter, Whatman International, Maidstone, UK) that had been soaked previously in 4 mM ammonium formate, pH 6.0, containing 10 PM thymidine and allowed to air dry. The filters were washed extensively at room temperature to remove non-phosphorylated thymidine [ 131. The filters were then dried. transferred to scintillation vials containing 4 ml OptiPhase HiSafe 3 lluid (LKB Scintillation Products. Bromma. Sweden) and counted for radioactivity. 2.5. Analysis

of bacterial proteins

For analysis of recombinant proteins in E. coli XL1 -Blue, cells from a 3 ml culture grown to midL P

s

0.5 kb

Lettrrs

135 (lYY61

103-l

105

IO

exponential phase in the presence or absence of IPTG (5 mM) were harvested by centrifugation (4 500 X g, 10 min, 4°C). The pellets were washed once in TBS. then suspended in 200 ~1 SDS-PAGE sample buffer (0.125 M Tris . HCI, pH 6.8 containing 0.02% (v/v) 2-mercaptoethanol and 2% (w/v) SDS) and heated at 100°C for 10 min. S. gordonii cells were broken by Braun homogenization [14] and samples of cell-free extract were mixed with an equal volume of SDS-PAGE sample buffer and heated (80°C 10 min). Following electrophoresis through 12% (w/v> polyacrylamide [ 151, proteins were stained with Coomassie brilliant blue or were transferred to Hybond-C nitrocellulose membrane (Amersham) by electroblotting [ 161 for 90 min at 20 V cm-‘. Immunoblots were incubated with antiserum to 43-kDa polypeptide diluted accordingly and antibody binding was detected using peroxidase-conjugated swine immunoglobulins to rabbit IgG.

3. Results and discussion 3. I. Cloning

of the S. gordonii thymidine kinase gene

In attempting to isolate the gene encoding a 43kDa lipoprotein of S. gordonii DLl a AZAPII library of S. gordonii DLl genomic DNA was screened for clones producing antigens reacting with antibodies to the 43-kDa polypeptide [9]. From approximately 4 X 10” A plaques screened, 69 positive plaques were detected. Six phagemid clones were

I

S

D

P

I

I

I

I I

I

1

C

Fig. I. Cloning of the S. gordonii Subclone pL42OI

(0

represents vector DNA below CC). D. 0~1:

thymidine kinase gene. Physical maps of overlapping group

I

(A) and group 2 (B) phagemids are shown.

was generated by digestion of phagemid pL42 with fsr1 and religation of the vector-insert fragment. The bold line (not to scale). The open reading frames identified from nucleotide sequence analysis are shown as open arrows

P. PsrI; S, .Suu3AI; X. XhoI. The Sau3Al

sites marked do not constitute a complete restriction map for thia enzyme.

selected for further study and the inserts were restriction-endonuclease mapped. Two phagemids (clones pL1 and pL42) contained identical inserts of approximately 1600 bp (Fig. 1A). Four other phagemids (clones pL2, pL39, pL4.5 and pL47) contained identical inserts of approximately 1350 bp (Fig. 1B). The inserts within the two groups of phagemids overlapped and shared a common 3’ Su~13Al cloning site (Fig. 1A and 1B). All phagemids expressed an identical pattern of polypeptides in E. coli XLl-Blue that reacted with antibodies to the 43-kDa polypeptide (Fig. 2A, lanes 2 and 3). A prominent band of approximate molecular mass 21 kDa was observed. Production of antigenic polypeptides was not dependent upon the inclusion of IPTG in the culture medium suggesting that transcription of the genes encoding the antigens did not procede from the vector (luc) promotor. To locate more precisely the gene encoding the recombinant polypeptide, the smaller PstI fragment of phagemid pL42 (600 bp) was sybcloned into. pUCl9. In E. c&i ha&outing this construct, no antigen was detected (not shown). The remaining vecfor-insert fragment of pL42 fol-

kOa lOO.S_

2

,I .

‘:.

3

4

lowing PstI digestion was self-ligated to generate plasmid pL4201 shown in Fig. 1C. Recombinant pL420 1 produced a pattern of antigenic polypeptides in E. coli XLl-Blue indistinguishable from that of E. coli XLl-Blue harbouring pL42 (compare Fig. 2A, lanes 2 and 4). On blots of S. gordonii cell extract polypeptides probed with antiserum, a band at 21 kDa was detected faintly (arrowed in Fig. 2, lane 5) in addition to the 43 kDa polypeptide to which antiserum was raised. The reason for this cross-reactivity is not known. The nucleotide sequence of the insert within phagemid pL4201 (Fig. 3) revealed a complete open reading frame that showed similarity to protein sequences in GenBank. ORFl (nucleotides 236-813, Fig. 31, encoded a polypeptide of 191 amino acids with a predicted molecular mass of 21843 Da, and exhibited similarity with type II thymidine kinases from E. coli, bacteriophage T4 and Bacillus subtilis (Fig. 4A). A search for protein sequence motifs within the putative S. gordonii tdk gene product using Prosite revealed the presence of a phosphatebinding P-loop [20] at the N-terminal end, and a TK cellular-type signature that overlaps with domain VII identified by Black and Hruby [17] that is well conserved across type II TKs. This suggested that the S. gordonii gene encoded a type II TK enzyme.

:

3.2. Expression

enalysis of S. gardotii TL. -8 t%tarQ *Cl ~g of p3Wein from E: deli :xtl-St ha&oaring phagemids pBluescript (lane I), pt42 &k.,2); pL47 (lane 3). pL4201 &.a6 4) or cell extract of S. gordanii DLI (24 fig protein, lane 5) were subjected to SDS-PAGE and separated proteins electroblotted onto nitrocellulose membrane. The blot was reacted with antiserum to the S. gordonii 4%kDa pplypelltide (1:XN dilution). The tiow head i&iica$es the p&i&&$ k knd at 21 kDa reacting with the antiserum.

Fig. 2. Immunobiot

hg approximately

of S. gordonii TK activity in E. coli

To determine if the gene product expressed by phagemid pL4201 could complement a TK- strain of E. coli, phagemids pL4201 and pBluescript were transformed into E. coli KY895 and cell extracts were prepared for determination of thymidine kinase activity. No [ ‘Hlthymidine-phosphorylating activity was present in extracts of E. coli KY895 harbouring pBlue,s&t. 80% inhibited by the addition of 0.1 mM TTP (Fig. 5). Inhibition of activity by TTP is a feature demonstrated by type II TK enzymes. Control experiments showed that the PT&F~ce d TTp did I$$ i&ibit biti@ of t3Hj’I?MP ~&I_%81 p&r is t& TK assay.

R. McNab/

FEMS Microbiology

required for the termination of protein synthesis (reviewed by Tate and Brown, [23]), and the genes encoding RF1 (pr$A) and RF2 ( pr~‘B) are essential for cell viability in E. coli. Bacterial p$A sequences reported to date from Gram-negative bactefiia show similar genetic organization. All are founld Y-adjacent to hemA, the gene encoding glutamyl-tRNA reductase, an important enzyme in the heme biosynthetic pathway [21, 24, 251. In E. cnli [242 and S. typhimurium [25] pr$A is cotranscribed with hemA and a model has been invoked which allows autoregulation of RF-I expression via readthrough of the RFl-dependent hemA stop codon [25]. The putative

3.3. Sequence 3’ adjacent to the S. gordonii tdk gene encodes a protein with homology to release factor I A second, incomplete, open reading frame was identified (ORF2, nucleotides 845- 1045, Fig. 3) that extended through the 3’ Sa~3Al cloning site (Fig. lC> and encoded 67 amino acids of a protein with significant sequence similarities to bacterial release factor 1 (RFl) polypeptides (Fig. 4B). For example, the inferred amino acid sequence of the putative S. gordonii RF1 (incomplete) was 29% identical and 49% similar to Pseudomonas aeruginosa RF1 over the first 67 amino acids (Fig. 4B). Bacterial RFs are

1 79

157 235

313

391

107

Letters 135 (1996) 103-I 10

CTGCAGATTGAGGAGCACCAGTATTTCTGACAACAGCCTCAGCTTTCTTTTGTTCGAGCG TACGACCTTCAAATAAATCATTCTAACAAATGGC_ATTAGATT~TCCTTTATTTTCTT~CATTATTTTATCAC~ -35 -10 TTTAGGTTTTAATGCTTGTCCAATTATGGTACAATTAAATA TTATGGCTCAATTATATTATAAATACGGCACGGCACTCCT LYYKYGTMNSGKTIEILKVAHNY M A Q 1 20 ACGAAGAACAGGGCAAGGGTGTTGTGATTATGACCAGCGCAGTTGACACTCGAGACGGTGTTGGGTATGTATC~~CC E E Q G KGVVIMTSAVDTRDGVGYVSSR 40 GAATTGGTATG~CGCCAGGCAATGGCAATTGGC~TTG~GACGATACAGATATTTTGGGCTATATC~TTTACCAG~~ IGMKRQAMA IEDDTDILGYIKNLPEK

60 469

541

625

703

781

AACCTTACTGTATTTTAATTGATGAGGCTCAGTTTTTAAAG PYCILIDEAQ FLKRHHVYDLARVVDE 80 100 AGCTAGATGTTCCTGTTATGGCCTTTGGCCTT~TGATTTTCGCAATGAACTCTTTGACACCTCT LDVPVMAFGLKNDFRNELFEGSKHLL 120 TGCTCTTGGCTGATAAGATAGAGGAAATCAAGACTATCTGCCAATACTGTTCACGCAAAGCGACTATGGTTTTACG~_~ LLADKI EEIKTICQYC SRKATMVLRT 140 CAGATCACGGGAAACCAGTGTATGACGGTGAACAGATTCAGATTC~TCGGTGGT~TG~CT~ATATCCCAGTCTGTCGCA DHGKFVYDGEQIQIGGNETYI?VCRK 160 AACATTATTTTAAGCCAGACATT~T~T~T~T~~~TGATG~TC~ATG~~ATTTA~G~

180

HYFKPDTNN'

MN

I

'I 5

059 20 937

1015

GCGTTiTATCOAACrnCXA~~C~C~GTG~ACGGTGAC~C~ATCGC~TAT~C~GTCCT RPHEiSKtEASTRDTVTAYREYKQVL 4Q CCIUAACA'PC;GTC t3AcGaGAAG~T~TC QNIVDA E’EM I 60

Fig. 3. Nucleotidc sequence of the pL4201 acids L-67). is ptsant PO&WC

Potentid Slime-w

at nuclcdi&s

j tI-

aad.ttwm&w

TCWMlr are ovel’limd, nis.stdp Vb&$ntd

I (amino A potential stem-lot@ terminator by a RWI of T ros&o&ndalincd). RF’& is p%cn~ aho in,fbe + 1 and

insen and deduced amino acid sequencer of thymidine kinase and release factor

13$‘..@&to the stwt of &. wpi is de-

- IO apd - 35 wjuet~~

+2 reading fra&s.

DNA

ribos~~~~~-binding siscs for T& and RF! ere *“II

‘l$cQsfi8a&

w&n

ppuabr,

ciy Mencd fbr TK @GA,

in boldfw

type.

arrows foMved recogniti

by

~vnsbar for thb sc&enCe is UWl51

K. McNtrh / FEMS Microhich,yy

108

Lettrrv

pfA gene in S. gordonii downstream of tdk represents a novel genetic organization. In the Gram-positive organism B. subtilis, 3’ sequence to tdk does

135

(I YWiiIO_?/ 10

not encode a putative RF1 [19]. The tdk-pt-$4 intergenie region in S. gordonii (32 bp) contained no recognizable factor-independent transcription-

A K UOH

MTSR

0

44

QS$V

VTRE

F

44

I RgH

LKPR

D

44

RRUK

[31

SUCE

[41

SERR

[ll

IQ'+

IKQEON

I. TSMTSVR

I

TDM II SSRR

RKQE

50

FKPU

‘I’

KR

92

E

TR

94

FV~WRERQKDIH

KT

94

HISESTD.....

OQ

95

FKP.DIN KERLQUD NELTKKL EUPGKSK

Cl1

N

191

[Z]

SLTRIQERHRHII

[31

G

205 193

[41

K

195

190 193 192 194

B Cl1 CZI

MNOVE

48

R ‘“LK

c31 c41

P UA P e :‘IE

50 50 50

Fig. 4. Amino acid sequence comparisons. (A) Alignment of the amino acid sequences of thymidine kinases from (I ) S. gordonii, (2) E. co/i [ 171, (3) Bacteriophage T4 [ 181, and (4) Bacillus suhtilis [ 191. The phosphate binding P-loop sequence is overscored. The TK cellular-type signature (Prosite feature PSOO603) is underscored. (B) Alignment of the N-terminal amino acid sequences (l-67) of release factor I proteins from (1) S. gordonii, (2) Pseudomonas aeruginosa 1211, (3) E. coli [22], and (4) Coxiella burnerri (GenBank accession number X78969). Periods represent gaps introduced to maximize alignment.

R. McN&

/ FEMS M;crob;olo,q~

Time (min) Fig. 5. Determination of S. ~ordorlii thymidine-phosphorylating activity. Measurement of TK activity in cell extracts of E. co/i KY895 harbouring pL420 I (0 ). pBluescript ( 0 ). or pL4201 in the presence of 0. I mM TTP (0 ). Assays contained 0.018 pg ki-’ protein. Points represent the means of at least three determinations. Standard deviations did not exceed 10% of the mean.

termination signals and no obvious - 10 or - 35 promotor sequences. It seems likely therefore that ~I$A may be co-transcribed with rdk in S. gordonii. The translation stop codon for TK was UGA (recognized by RF2) and is present also in the + I and +2 reading frames (see Fig. 3) thus regulation of RFI levels in S. gordonii would not be expected to conform to the model proposed for regulation of RF1 expression in S. typhimurium. Further sequencing and transcriptional analysis would elucidate the transcriptional and translational organization of this locus in S. gordonii.

Acknowledgements This work was supported by the Wellcome Trust, London and by the Health Research Council of New Zealand. I would like to thank M.E. Black for the gift of E. coli KY895 and for helpful discussions, and H.F. Jenkinson for valuable comments on the manuscript.

References [I] Frandsen, E.V.G., Pedrazzoli, V. and Kilian, M. (1991) Ecology of viridans streptococci in the oral cavity and pharynx. Oral Microbial. Immunol. 6, 129-133.

Letters

13.5 (19%)

10% 110

IO0

[2] Gibbons. R.J. (1984) Adherent interactions which may affect microbial ecology in the mouth. J. Dent. Res. 63. 378-385 [3] Kolenbrander. P.E. and London, J. (1993) Adhere today, here tomorrow: oral bacterial adherence. J. Bacterial. 174. 3.!473252. [4] Carlsson. J. (1972) Nutritional requirements of StwpVowww .sm,yui.s. Arch. Oral Biol. 17, 1327- 1332. [5] Jenkinson. H.F. (1994) Adherence and accumulation of’ oral streptococci. Trends Microbial. 2, 209-212. [6] Jenkinson. H.F. and Carter, D.A. (1988) Cell surface mutants of Streptococcus.strngrris with altered adherence properties. Oral Microbial. Immunol. 3, 53-57. [7] Jenkinson, H.F.. Terry, S.D., McNab. R. and Tannock. G.W. (1993) Inactivation of the gene encoding surFace protein SspA in 5’trrptocwcu.s ~cywdo~tii DLI affect\ cell interaction\ with human salivary agglutinin and oral actinomyces. Infect. Immun. 61, 3199-3208. [8] Igarashi, K.. Hiraga, S. and Yura. T. (1967) A deoxythymdine kinase deficient mutant of E.sckrichir~ c,rdi II. mapping and transduction studies with phage 680. Genetic5 S7. 643654. [9] McNab. R. and Jenkinson. H.F. (1992) Gene disuption identifies a 290 kDa cell-surface polypeptide conferring hydrophobicity and coaggregation properties in Stwptoum~u~ ~~~~rdo~~ii. Mol. Microbial. 6, 2939-2949. [IO] Sambrook. J.. Fritach. E.F. and Mania& T. (19891 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. [I I] Altschul, S.F., Gish. W.. Miller, W., Myers. E.W. and Lipman. D.J. (1990) Basic local alignment tool. J. Mol. Biol. 21s. 403-410. 121 Devereux J.. Haeberli, P. and Smithies. 0. (1984) A comprehensive her of sequence analy&is programs for the VAX. Nucl. Acids. Rea. 12, 387-395. 131 Preston. C.M. (1977) Cell-free synthesis of herpes simplex virus-coded pyrimidine deoxyribonucleoside kinase enzyme. J. Viral. 23. 455460. 141 Jenkinson. H.F. ( 1986) Cell-surface proteina of Stwptocm~w.s .xmgui.\associated with cell hydrophobicity and coaggregation properties. .I. Gen. Microbial. 132, 1909-1918. [I 51 Laemmli, U.K. and Favre. M. (1973) Maturation of the head of bacteriophage T4. I. DNA packaging events. J. Mol. Biol. 80. 575-S99. [ 161 Towbin, H.. Staehelin. T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrytamide gels to nitrocellulose sheets: procedure and some applicati’ons Proc. Natl. Acad. Sci. USA 76. 4350-4354. [ 171 Black, M.E. and Hruby. D.E. (I 991) Nucleotide sequence of the Eschrrichitr co/i thymidine kinase gene provides evidence for conservation of functional domains and quaternary structure. Mol. Microbial. 5. 373-379. [I81 Valerie. K.. Stevens, J.. Lynch, M.. Henderson. E.E. and De Riet. J.K. (1986) Nucleotide sequence and analysis of the S8.3 to 65.5 kb early region of bacteriophage T4. Nucl. Acids Res. 14, 8637-8654. [I91 Quirk, P.G.. Dunkley. E.A.. Jr., Lee, P. and Krulwich, T.A. (I 993) Identification of a putative Bnc~i//u.s .suhti/isrho gene. J. Bacterial. 175. 647-654.

110

R. McNub / FEMS Microbiology

[20] Walker, J.E., Saraste, M., Runswick, M.J. and Gay. N.J. (1982) Distantly related sequences in the a- and b-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945-95 1. [21] Hungerer, C., Troup, B., Romling, U. and Jahn, D. (1995) Regulation of the hemA gene during S-aminolevulinic acid formation in Pseudomonas aeruginoua. J. Bacterial. 177. 1435-1443. [22] Craigen, W.J., Cook, R.G., Tate, W.P. and Caskey, CT. (1985) Bacterial peptide chain release factors: conserved primary structures and possible frameshift regulation of release factor 2. Proc. Natl. Acad. Sci. USA 82, 3616-3620.

Letters IS.5

(I9961JOJ-

J JO

[23] Tate, W.P. and Brown, C.M. (1992) Translational termination: ‘stop’ for protein synthesis or ‘pause’ for regulation of gene expression. Biochem. 3 1, 2443-2450. [241 Verkamp, E. and Chelm, B.K. (1989) Isolation, nucleotide sequence, and preliminary characterization of the Escherichio cofi K-12 hemA gene. J. Bacterial. 171, 47284135. [25] Elliott, T. (1989) Cloning, genetic characterization, and nucleotide sequence of the hemA-prfA operon of Salmonella f.vphimurium. J. Bacterial. 17 1, 3948-3960.