- Email: [email protected]
Cloning and sequencing an ovine interleukin-4-encoding cDNA
Gene, 124 (1993) 291-293 c 1993 Elsevier Science Publishers
GENE
B.V. All rights reserved.
291
0378-I 119/93/$06.00
0691.5
Cloning and sequencing an ovine interleukin-4-encoding
cDNA
(Lymphokine; PCR; B-cell stimulatory factor; B-cell growth factor; amplification; ruminant)
Heng-Fong
Seow, James S. Rothel and Paul R. Wood
CSIRO Division ofAnimal Health, Animal Health Research Laboratory, Parkuille, Victoria 3052, Australia Received by J.R. Kinghorn:
24 July 1992; Revised/Accepted:
1 September/l6
September
1992; Received at publishers:
2 November
1992
SUMMARY
We have cloned a cDNA containing the complete coding sequence of ovine (ov) interleukin 4 (IL4) by the polymerase chain reaction using primers based on the 5’ and 3’ untranslated regions of the human IL4 gene. RNA was isolated from phorbol myristate acetate- and calcium ionophore A23187-stimulated mesenteric lymph node cells. The ovlL4 cDNA is 535 bp in length and contains an open reading frame of 408 nucleotides (nt) coding for a 15.1-kDa IL4 precursor of 135 amino acids (aa). Cleavage of the putative signal peptide of 22 aa yields the mature form of 13.2 kDa. Analysis of the mature aa sequence shows two potential N-linked glycosylation sites and six Cys residues. Ovine and bovine IL4 are shorter than human, mouse and rat ZL4, because of a 51-nt deletion in the coding region. Comparison of the predicted aa sequence shows that ovIL4 shares 92, 57, 37 and 42% identity with the bovine, human, mouse and rat IL4s, respectively.
INTRODUCTION
IL4 was originally characterised by its ability to costimulate the in vitro proliferation of activated B cells (Howard et al., 1982). The cDNAs for bovine, human, mouse and rat IL4 have been cloned (Heussler et al., 1992; Yokota et al., 1986; Lee et al., 1986; M&night et al., 1991). Human IL4 shares 50% aa homology with the mur-IL4 and the biological activities are species-specific (Mosmann et al., 1987). In addition to its proliferative effect on B cells, IL4 can induce expression of class-II major histocompatibility Correspondence to: Dr. H.-F. Seow, CSIRO Division of Animal Health, Animal Health Research Laboratory, Private Bag No. 1, Parkville, Victoria 3052, Australia. Tel. (61-3) 342 9700; Fax (61-3) 347 4042; e-mail: [email protected]. Abbreviations: aa, amino acid(s); bov, bovine; bp, base pair(s); cDNA, DNA complementary to mRNA; Fc, Fc region of immunoglobulin; hum, human; Ig, immunoglobulin; IL4, interleukin-4; 1L4, gene (DNA) encoding IL4; kb, kilobase or 1000 bp; mur, mouse (murine); NMR, nuclear magnetic resonance; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame; ov, ovine; PCR, polymerase chain reaction;
PMA, phorbol
myristate
acetate.
complex antigens on resting B cells and the low-affinity receptors for the Fc portion of IgE. IL4 enhances the secretion and cell surface expression of IgE and IgGl. It appears to be required to generate and sustain in vivo IgE responses and acts by causing heavy chain switching to IgE (see Paul and O’Hara, 1987, for a review). IL4 has also been shown to stimulate proliferation of T lymphocytes and thymocytes in the presence of phorbol esters. IL4 acts on connective tissue-type mast cells, haematopoietic cells and enhances the antigen presenting ability of macrophages (see Paul and O’Hara, 1987, for a review). The main source of IL4 is a subset of helper T cells (Th2) which are clearly defined in murine T cell clones (Mosmann et al., 1986). The Th2 subset contains the most effective helper activity for B cells, a large part of which can be attributed to IL4. It is predicted that Th2 cells play a central role in modulating humoral responses to different antigenic stimuli. Studies on immunity against parasites have suggested that in many cases, the humoral antibody response plays a protective role. IgE is involved in antiparasite immunity, and it appears that IL4 may be
292 the only cytokine that can induce high IgE levels (Coffman et al., 1988). In view of species specificity and the importance of IL4 in the control of the immune response, the ovZL4 cDNA was cloned and sequenced.
(Glu+Ala), C171-+T (Pro+Leu), Gz4’-+A (Ala-+Thr), C273-+T (Met+Thr), G3’l +A (Ser+Asn), and GU +A (Arg+Lys). Eight of conserved aa changes.
T18’-+A (Ser+Thr), (Ala+Val), T309+C G411-+A (Arg+Lys) these alterations were
(b) Cross-species comparison of IL4 EXPERIMENTAL
AND DISCUSSION
(a) Nucleotide and aa sequence of ovZL4 cDNA
Fig. 1 shows the nt sequence of ovZL4 cDNA and inferred aa sequence. Four clones were sequenced and identical sequence was obtained. The cDNA insert is 535 bp long. There is a single ORF, with the first ATG codon beginning at nt 59 and ending with the stop TAG codon at nt 466-468. Comparison of the nt sequences of ovZL4 with bov, hum, mur and rat IL4 cDNA showed that the level of homology was 97, 66, 51 and 56%, respectively. Interestingly, a single nt change, C467+A in the hum sequence, resulted in a stop codon. Thus, ov and bov IL4 do not have the last two Ser residues in contrast to the hum homolog. The nt sequence of ovZL4 encodes an ORF of 135 aa equal to the number of aa in bov IL4. A comparison of the ov and bov nt sequences revealed ten differences in the coding region which resulted in changes in the aa residue. These are C87+T (Ala+Val), Als3-+C
Fig. 2 shows the alignment of the aa sequences of IL4 of the various species as deduced from their nt sequence. The deletion of a continuous stretch of 51 nt resulted in the absence of 17 aa present in the hum sequence. This absence of 17 aa is also found in the bov IL4 sequence (Heussler et al., 1992). From the same region in the mur IL4 (Lee et al., 1986) and rat IL4 (M&night et al., 1991) 7 aa are not present. In this region, a Cys residue (marked #) is conserved in the hum, mur and rat protein. At the aa level, ovIL4 shares 92, 57, 37 and 42% identity with bov, hum, mur and rat IL4, respectively. The start of the mature protein for hum and mur IL4 is at His23 and His*’ (respectively) based on the N-terminal aa sequence of the secreted protein (Paul and Ohara, 1987). In the case of rat IL4, the predicted start of the mature protein is at His 23 based on the consensus sequences for signal peptides (McKnight et al., 199 1). Based on homology, we predict that the start of the ov protein 1
10
20
*
MGLTSQLlPALVCLLVCTSHFVHGHK --v_-_--___________ -__-_-___-_
TAGCTTCTCCTGATAAliCTMTTGCCTCAGTGAGATACTATTA
58
MGLTSQLIPALVCLLYCTSH
Murine
-NP--““I-LFF-E--RSHI--CD -SPH-AVT-F-F-I--GNGI--CN
_
_
ovine Bovine
CDITLEEIIKTPN~LTSRKNSCMELP
20
ATGGGTCTCACCTCCCAGCTGATCCCAGCGCTGCTTGTACCAGCCAC
118
FVHGHKCDITLEEIIKTPNI TTCGTCCATGGACACAAGTGTGATA~ACCTTAGMGAGATCATC-CGCCGMCATC
40 178
LTSRKNSCMELPVADVPAAP
CTCACATCGAGAAAGMTTCATGCATGGAGCTGCCTGCTGCCCCA
60 238
KNATEKETFCRAGIELRRIY AAGAACGCAACTGAGAAGGAAACCTTCTGCAGGGCPGGAAC
80 298
RSHMCLNKFLGGLDRNLSSL AGGAGCCACATGTGCTTGMCIVLATTCCTGGGCGGA~GA~GGMTCTCAGCAGC~G
100 358
30
ASK T C S” N EAK T S T S T GCMGCAAGACCTGTTCTGTG~TG~GCCMGACGAGTACMGTACGCTGAGAGACCTC
LR
IMREKYSKC*
D
L
120 418
TTGGAAAGGCTAAAGACTATTATGAGGGAGAAATACTCAMGTG'FTGAAGCTGAATATTT
135 478
TAATTTATGACTTTTTAATAGCCTTATTTTTATTCATATTTATATATTTATAACTCAT
535
Fig. 1. Nucleotide sequence of ovlL4 cDNA and deduced aa sequence. RNA was extracted from 4 h PMA(7.5 &ml)and calcium ionophore A23187(0.5 ug/ml)-stimulated mesenteric lymph node cells by guanidium thiocyanate lysis and CsCl-gradient purification (Maniatis et al., 1982). First-strand synthesis was performed with 250 ng total RNA and 18 units of avian myeloblastosis virus reverse transcriptase (Pharmacia, Sweden). The primers used in the PCR were: 5’-T AGC TTC TCC TGA TAA ACT AAT TGC CTC and 5’-ATG AGT TAT AAA TAT ATA AAT A. The primers were chosen from the conserved sequences of the 5’ and 3’ untranslated region of hum and mm IL4. The PCR conditions were 35 cycles at 94°C for 1 min, 50°C for 2 min and 72°C for 2 min. The amplified fragment was subcloned into pUCll9 and dideoxy sequencing was performed using the T7 polymerase sequencing kit (Pharmacia). Four different clones originating from the same PCR reaction were sequenced. Asterisk marks the stop codon. Accession number M96845 has been assigned by GenBank.
___
40
--_-_
Murine Rat
KN.H-R---GIL-EV-GEGTP-T-MD DS.P-R---N-L-QV-EKGTP-T-MF
ovine Bovine
Murine Rat
Ovine Bovine Human
Murine Rat
50
__A--_--L----T_____-_--
Human
HUma”
LERLKT
__~_p_~~__A_AGN-___C_
_-
Rat
Q_____L-S__EP_TL-T__T
60 + 70 "ADVFAAPKNATEKETFCRAG~~~~~ _T________"_-__-_ --______-T-I-_-S-_T________-AT"_-Q -PN-LT-T--T--S-I,"---SK"--1 -P--LT-TR-T--N-LI---SR"--K 80 IY.................RSHMCLN
- - . . . . . . . .
.
.
. . - - -
ovine
+ 90 KFLGGLDRNLSSLAS.KTCSVNEAKT
Bovine
_
HUIan
R__KR____ -WG--GLNS-P-K--N. ME-QR-F-AFRC-D-SIS-TM--S-. GE-RK-C-GV-G-N-LRE-TV--ST.
Murine Rat
Ovine Bovine Human Mu-he Rat
T
-
_
_
-
-
F-SHHEKDTRCLGATAQQF~R-KQ-I F-LKHGK.TPCL.......KKNSS"L F-FPRD".PPCL.......KNKSG"L Y
_
_
_
_
_
_
_
_
_
N
100 _
_
120 STSTLRDLLERLKTlMREKYSKC - - - - _K_____----_K___-__ ~Q-__~~~___-----__-_--_~~
_
110 _
.
_
_
_
_
_
_
_
_
130
.-K-F-_S__S--*MD__ - - L-.--K-F--S--S-L-G--LQ-TSMS
Fig. 2. Alignment of ov, bov, hum, mur and rat IL4 aa sequences as deduced from their cDNA sequences. Numbering is based on the ov sequence. The predicted start of the mature protein is marked with an asterisk. Those aa residues that are identical to the ov sequence are indicated by dashes. Where the aa is absent (to improve alignment), it is denoted by a dot. The Cys residues are typed in bold. The potential N-glycosylation sites are marked by (+) and also typed in bold. First digits of numerals are aligned with corresponding aa. Symbol # refers to disulfide bond (see section b).
at Hisz3 (as marked with an asterisk in Fig. 2) and hence the predicted size of the mature protein is 13.2 kDa. The mature ov, bov, hum, mur and rat IL4 are glycoproteins of 113, 113, 129, 120 and 123 aa, respectively. One potential N-glycosylation site at aa62 is conserved in all the five species (marked by +). The ovIL4 has an additional N-glycosylation site at aa 96-98 which is not found in the bov protein. Hum IL4 has an additional Nglycosylation site at aa 11 l-l 13. In the case of mur and rat IL4, there are two and three additional N-glycosylation sites, respectively. They are located at positions 83-85 and 108-110 in mur IL4 and positions 26-28, 82-84 and 108-l 10 in rat IL4. Cys at positions 13, 17, 27, 48, 70, 85, 105 and 135 (aa numbering based on the ov sequence) are well conserved in ov and bov proteins. In the signal peptide region, there are two Cys: at position 17 (conserved in all five species) and at position 13 (which are found only in the ov, bov and rat aa sequence). In the mature protein, Cys at positions 48, 70, and 105 are conserved in all five species. Secondary structure and topology studies of hum IL4 by NMR spectroscopy revealed that the molecule consists of four major cl-helical regions and one short section of double-stranded antiparallel P-sheet (Redfield et al., 1991). This four-helix bundle is a structural motif found in a range of globular proteins (Presnell and Cohen, 1989) and IL2 (Brandhuber et al., 1987). The NMR studies show that three disulfide bridges in hum IL4 link one end of helices A and D together (25-135), the CD loop to helix B (70-105) and the AB loop to the BC loop (48C#). The numbering is based on the ov sequence. Alignment of the aa sequences of the five species indicate that disulfide bond 25-135 in hum IL4 is replaced by 27-135 in ov and bov, 25-99 in mur and 25-135 in the rat sequence. The second disulfide bond 70-105 is conserved in all five species. The third disulfide bond 48-C# is conserved in hum, mur and rat IL4 and this is replaced by 48-85 in ov and bov IL4. The deletion of 17 aa from the ov and bov aa sequence, which is in the BC loop (according to NMR studies of hum IL4), would result in a shorter BC loop which could presumably be shortened without major disruption to the overall packing of the helices. is
combinant proteins to raise monoclonal antibodies. Both the ovZL4 cDNA and the antibodies would be useful tools for examining the different T cell subsets involved in the immune responses to infectious agents.
REFERENCES Brandhuber, B.J., Boone, T., Kenney, W.C. and McKay, dimensional structure of interleukin-2. Science
D.B.: Three238 (1987)
1707-1709. Coffman, R.L., Seymour, B.W.P., Lebman, D.A., Hiraki, D.D., Christiansen, J.A., Shrader, B., Cherwinski, H.M., Savelkoul, H.F.J., Finkelman, F.D., Bond, M.W. and Mosmann, T.R.: The role of helper T cell products in mouse B cell differentiation and isotype regulation. Immunol. Rev. 102 (1988) 5-28. Heussler, V.T., Eichhorn, M. and Dobbelaere, D.A.E.: Cloning of a fulllength
cDNA
encoding
bovine
interleukin-4
by the polymerase
chain reaction. Gene 114 (1992) 273-278. Howard, M., Farrar, J., Hilfiker, M., Johnson, B., Takatsu, K., Hamaoka, T. and Paul, W.E.: Identification of a T cell-derived B cell growth factor 914-923.
distinct
from interleukin
2. J. Exp. Med. 155 (1982)
Lee, F., Yokota, T., Otsuka, T., Meyerson, P., Villaret, D., Coffman, R., Mosmann, T., Rennick, D., Roehmn, N., Smith, C., Zlotnik, A. and Arai, K.: Isolation and characterization of a mouse interleukin cDNA clone that expresses B-cell stimulatory factor 1 activities and T-cell- and mast-cell-stimulating activities. Proc. Nat]. Acad. Sci. USA 83 (1986) 2061-2065. Maniatis, T., Fritsch, E.F. and Sambrook, Laboratory Manual. Harbor, NY, 1982.
Cold Spring
J.: Molecular
Harbor
Laboratory,
Cloning.
A
Cold Spring
McKnight, A.J., Barclay, A.N. and Mason, D.W.: Molecular cloning of rat interleukin 4 cDNA and analysis of the cytokine repertoire of subsets of CD4’ T cells. Eur. J. Immunol. 21 (1991) 1187-l 194. Mosmann, T.R., Cherwinski, H., Bond, M.W., Giedlin, M.A. and CotIman, R.L.: Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136 (1986) 2348-2357. Mosmann, T.R., Yokota, T., Kastelein, R., Zurawski, S.M., Arai, N. and Takebe, Y.: Species-specificity of T cell stimulating activities of IL2 and BSF-I (IL4): comparison of normal and recombinant mouse and human 1813-1816.
IL2
and
BSF-1
(IL4).
J.
Immunol.
138 (1987)
Paul, W.E. and Ohara, J.: B-cell stimulatory factor-l/interleukin 4. Ann. Rev. Immunol. 5 (1987) 429-459. Presnell, S.R. and Cohen, F.E.: Topological distribution of four-a-helix bundles. Proc. Natl. Acad. Sci. USA 86 (1989) 6592-6596.
(c) Conclusions
Redfield, C., Smith, L.J., Boyd, J., Lawrence, M.P., Edwards, R.G., Smith, R.A.G. and Dobson, C.M.: Secondary structure and topology of human interleukin 4 in solution. Biochemistry 30 (1991) 11029-l 1035.
It has been reported that hum and mur IL4 receptors do not cross-react (Mosmann et al., 1987). With the availability of ovlL4, we can now engineer hybrid ov-hum and ov-mur IL4 molecules to find the species-specific residues. In addition, ovlL4 can be expressed to obtain re-
Yokota, T., Otsuka, Balanchard, D., characterization to mouse B-cell cell-stimulating 5894-5898.
T., Mosmann, T., Banchereau, J., De France, T., De Vries, J.E., Lee, F. and Arai, K.: Isolation and of a human interleukin cDNA clone, homologous stimulatory factor 1, that expresses B-cell-and Tactivities, Proc. Nat]. Acad. Sci. USA 83 (1986)
GENE
B.V. All rights reserved.
291
0378-I 119/93/$06.00
0691.5
Cloning and sequencing an ovine interleukin-4-encoding
cDNA
(Lymphokine; PCR; B-cell stimulatory factor; B-cell growth factor; amplification; ruminant)
Heng-Fong
Seow, James S. Rothel and Paul R. Wood
CSIRO Division ofAnimal Health, Animal Health Research Laboratory, Parkuille, Victoria 3052, Australia Received by J.R. Kinghorn:
24 July 1992; Revised/Accepted:
1 September/l6
September
1992; Received at publishers:
2 November
1992
SUMMARY
We have cloned a cDNA containing the complete coding sequence of ovine (ov) interleukin 4 (IL4) by the polymerase chain reaction using primers based on the 5’ and 3’ untranslated regions of the human IL4 gene. RNA was isolated from phorbol myristate acetate- and calcium ionophore A23187-stimulated mesenteric lymph node cells. The ovlL4 cDNA is 535 bp in length and contains an open reading frame of 408 nucleotides (nt) coding for a 15.1-kDa IL4 precursor of 135 amino acids (aa). Cleavage of the putative signal peptide of 22 aa yields the mature form of 13.2 kDa. Analysis of the mature aa sequence shows two potential N-linked glycosylation sites and six Cys residues. Ovine and bovine IL4 are shorter than human, mouse and rat ZL4, because of a 51-nt deletion in the coding region. Comparison of the predicted aa sequence shows that ovIL4 shares 92, 57, 37 and 42% identity with the bovine, human, mouse and rat IL4s, respectively.
INTRODUCTION
IL4 was originally characterised by its ability to costimulate the in vitro proliferation of activated B cells (Howard et al., 1982). The cDNAs for bovine, human, mouse and rat IL4 have been cloned (Heussler et al., 1992; Yokota et al., 1986; Lee et al., 1986; M&night et al., 1991). Human IL4 shares 50% aa homology with the mur-IL4 and the biological activities are species-specific (Mosmann et al., 1987). In addition to its proliferative effect on B cells, IL4 can induce expression of class-II major histocompatibility Correspondence to: Dr. H.-F. Seow, CSIRO Division of Animal Health, Animal Health Research Laboratory, Private Bag No. 1, Parkville, Victoria 3052, Australia. Tel. (61-3) 342 9700; Fax (61-3) 347 4042; e-mail: [email protected]. Abbreviations: aa, amino acid(s); bov, bovine; bp, base pair(s); cDNA, DNA complementary to mRNA; Fc, Fc region of immunoglobulin; hum, human; Ig, immunoglobulin; IL4, interleukin-4; 1L4, gene (DNA) encoding IL4; kb, kilobase or 1000 bp; mur, mouse (murine); NMR, nuclear magnetic resonance; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame; ov, ovine; PCR, polymerase chain reaction;
PMA, phorbol
myristate
acetate.
complex antigens on resting B cells and the low-affinity receptors for the Fc portion of IgE. IL4 enhances the secretion and cell surface expression of IgE and IgGl. It appears to be required to generate and sustain in vivo IgE responses and acts by causing heavy chain switching to IgE (see Paul and O’Hara, 1987, for a review). IL4 has also been shown to stimulate proliferation of T lymphocytes and thymocytes in the presence of phorbol esters. IL4 acts on connective tissue-type mast cells, haematopoietic cells and enhances the antigen presenting ability of macrophages (see Paul and O’Hara, 1987, for a review). The main source of IL4 is a subset of helper T cells (Th2) which are clearly defined in murine T cell clones (Mosmann et al., 1986). The Th2 subset contains the most effective helper activity for B cells, a large part of which can be attributed to IL4. It is predicted that Th2 cells play a central role in modulating humoral responses to different antigenic stimuli. Studies on immunity against parasites have suggested that in many cases, the humoral antibody response plays a protective role. IgE is involved in antiparasite immunity, and it appears that IL4 may be
292 the only cytokine that can induce high IgE levels (Coffman et al., 1988). In view of species specificity and the importance of IL4 in the control of the immune response, the ovZL4 cDNA was cloned and sequenced.
(Glu+Ala), C171-+T (Pro+Leu), Gz4’-+A (Ala-+Thr), C273-+T (Met+Thr), G3’l +A (Ser+Asn), and GU +A (Arg+Lys). Eight of conserved aa changes.
T18’-+A (Ser+Thr), (Ala+Val), T309+C G411-+A (Arg+Lys) these alterations were
(b) Cross-species comparison of IL4 EXPERIMENTAL
AND DISCUSSION
(a) Nucleotide and aa sequence of ovZL4 cDNA
Fig. 1 shows the nt sequence of ovZL4 cDNA and inferred aa sequence. Four clones were sequenced and identical sequence was obtained. The cDNA insert is 535 bp long. There is a single ORF, with the first ATG codon beginning at nt 59 and ending with the stop TAG codon at nt 466-468. Comparison of the nt sequences of ovZL4 with bov, hum, mur and rat IL4 cDNA showed that the level of homology was 97, 66, 51 and 56%, respectively. Interestingly, a single nt change, C467+A in the hum sequence, resulted in a stop codon. Thus, ov and bov IL4 do not have the last two Ser residues in contrast to the hum homolog. The nt sequence of ovZL4 encodes an ORF of 135 aa equal to the number of aa in bov IL4. A comparison of the ov and bov nt sequences revealed ten differences in the coding region which resulted in changes in the aa residue. These are C87+T (Ala+Val), Als3-+C
Fig. 2 shows the alignment of the aa sequences of IL4 of the various species as deduced from their nt sequence. The deletion of a continuous stretch of 51 nt resulted in the absence of 17 aa present in the hum sequence. This absence of 17 aa is also found in the bov IL4 sequence (Heussler et al., 1992). From the same region in the mur IL4 (Lee et al., 1986) and rat IL4 (M&night et al., 1991) 7 aa are not present. In this region, a Cys residue (marked #) is conserved in the hum, mur and rat protein. At the aa level, ovIL4 shares 92, 57, 37 and 42% identity with bov, hum, mur and rat IL4, respectively. The start of the mature protein for hum and mur IL4 is at His23 and His*’ (respectively) based on the N-terminal aa sequence of the secreted protein (Paul and Ohara, 1987). In the case of rat IL4, the predicted start of the mature protein is at His 23 based on the consensus sequences for signal peptides (McKnight et al., 199 1). Based on homology, we predict that the start of the ov protein 1
10
20
*
MGLTSQLlPALVCLLVCTSHFVHGHK --v_-_--___________ -__-_-___-_
TAGCTTCTCCTGATAAliCTMTTGCCTCAGTGAGATACTATTA
58
MGLTSQLIPALVCLLYCTSH
Murine
-NP--““I-LFF-E--RSHI--CD -SPH-AVT-F-F-I--GNGI--CN
_
_
ovine Bovine
CDITLEEIIKTPN~LTSRKNSCMELP
20
ATGGGTCTCACCTCCCAGCTGATCCCAGCGCTGCTTGTACCAGCCAC
118
FVHGHKCDITLEEIIKTPNI TTCGTCCATGGACACAAGTGTGATA~ACCTTAGMGAGATCATC-CGCCGMCATC
40 178
LTSRKNSCMELPVADVPAAP
CTCACATCGAGAAAGMTTCATGCATGGAGCTGCCTGCTGCCCCA
60 238
KNATEKETFCRAGIELRRIY AAGAACGCAACTGAGAAGGAAACCTTCTGCAGGGCPGGAAC
80 298
RSHMCLNKFLGGLDRNLSSL AGGAGCCACATGTGCTTGMCIVLATTCCTGGGCGGA~GA~GGMTCTCAGCAGC~G
100 358
30
ASK T C S” N EAK T S T S T GCMGCAAGACCTGTTCTGTG~TG~GCCMGACGAGTACMGTACGCTGAGAGACCTC
LR
IMREKYSKC*
D
L
120 418
TTGGAAAGGCTAAAGACTATTATGAGGGAGAAATACTCAMGTG'FTGAAGCTGAATATTT
135 478
TAATTTATGACTTTTTAATAGCCTTATTTTTATTCATATTTATATATTTATAACTCAT
535
Fig. 1. Nucleotide sequence of ovlL4 cDNA and deduced aa sequence. RNA was extracted from 4 h PMA(7.5 &ml)and calcium ionophore A23187(0.5 ug/ml)-stimulated mesenteric lymph node cells by guanidium thiocyanate lysis and CsCl-gradient purification (Maniatis et al., 1982). First-strand synthesis was performed with 250 ng total RNA and 18 units of avian myeloblastosis virus reverse transcriptase (Pharmacia, Sweden). The primers used in the PCR were: 5’-T AGC TTC TCC TGA TAA ACT AAT TGC CTC and 5’-ATG AGT TAT AAA TAT ATA AAT A. The primers were chosen from the conserved sequences of the 5’ and 3’ untranslated region of hum and mm IL4. The PCR conditions were 35 cycles at 94°C for 1 min, 50°C for 2 min and 72°C for 2 min. The amplified fragment was subcloned into pUCll9 and dideoxy sequencing was performed using the T7 polymerase sequencing kit (Pharmacia). Four different clones originating from the same PCR reaction were sequenced. Asterisk marks the stop codon. Accession number M96845 has been assigned by GenBank.
___
40
--_-_
Murine Rat
KN.H-R---GIL-EV-GEGTP-T-MD DS.P-R---N-L-QV-EKGTP-T-MF
ovine Bovine
Murine Rat
Ovine Bovine Human
Murine Rat
50
__A--_--L----T_____-_--
Human
HUma”
LERLKT
__~_p_~~__A_AGN-___C_
_-
Rat
Q_____L-S__EP_TL-T__T
60 + 70 "ADVFAAPKNATEKETFCRAG~~~~~ _T________"_-__-_ --______-T-I-_-S-_T________-AT"_-Q -PN-LT-T--T--S-I,"---SK"--1 -P--LT-TR-T--N-LI---SR"--K 80 IY.................RSHMCLN
- - . . . . . . . .
.
.
. . - - -
ovine
+ 90 KFLGGLDRNLSSLAS.KTCSVNEAKT
Bovine
_
HUIan
R__KR____ -WG--GLNS-P-K--N. ME-QR-F-AFRC-D-SIS-TM--S-. GE-RK-C-GV-G-N-LRE-TV--ST.
Murine Rat
Ovine Bovine Human Mu-he Rat
T
-
_
_
-
-
F-SHHEKDTRCLGATAQQF~R-KQ-I F-LKHGK.TPCL.......KKNSS"L F-FPRD".PPCL.......KNKSG"L Y
_
_
_
_
_
_
_
_
_
N
100 _
_
120 STSTLRDLLERLKTlMREKYSKC - - - - _K_____----_K___-__ ~Q-__~~~___-----__-_--_~~
_
110 _
.
_
_
_
_
_
_
_
_
130
.-K-F-_S__S--*MD__ - - L-.--K-F--S--S-L-G--LQ-TSMS
Fig. 2. Alignment of ov, bov, hum, mur and rat IL4 aa sequences as deduced from their cDNA sequences. Numbering is based on the ov sequence. The predicted start of the mature protein is marked with an asterisk. Those aa residues that are identical to the ov sequence are indicated by dashes. Where the aa is absent (to improve alignment), it is denoted by a dot. The Cys residues are typed in bold. The potential N-glycosylation sites are marked by (+) and also typed in bold. First digits of numerals are aligned with corresponding aa. Symbol # refers to disulfide bond (see section b).
at Hisz3 (as marked with an asterisk in Fig. 2) and hence the predicted size of the mature protein is 13.2 kDa. The mature ov, bov, hum, mur and rat IL4 are glycoproteins of 113, 113, 129, 120 and 123 aa, respectively. One potential N-glycosylation site at aa62 is conserved in all the five species (marked by +). The ovIL4 has an additional N-glycosylation site at aa 96-98 which is not found in the bov protein. Hum IL4 has an additional Nglycosylation site at aa 11 l-l 13. In the case of mur and rat IL4, there are two and three additional N-glycosylation sites, respectively. They are located at positions 83-85 and 108-110 in mur IL4 and positions 26-28, 82-84 and 108-l 10 in rat IL4. Cys at positions 13, 17, 27, 48, 70, 85, 105 and 135 (aa numbering based on the ov sequence) are well conserved in ov and bov proteins. In the signal peptide region, there are two Cys: at position 17 (conserved in all five species) and at position 13 (which are found only in the ov, bov and rat aa sequence). In the mature protein, Cys at positions 48, 70, and 105 are conserved in all five species. Secondary structure and topology studies of hum IL4 by NMR spectroscopy revealed that the molecule consists of four major cl-helical regions and one short section of double-stranded antiparallel P-sheet (Redfield et al., 1991). This four-helix bundle is a structural motif found in a range of globular proteins (Presnell and Cohen, 1989) and IL2 (Brandhuber et al., 1987). The NMR studies show that three disulfide bridges in hum IL4 link one end of helices A and D together (25-135), the CD loop to helix B (70-105) and the AB loop to the BC loop (48C#). The numbering is based on the ov sequence. Alignment of the aa sequences of the five species indicate that disulfide bond 25-135 in hum IL4 is replaced by 27-135 in ov and bov, 25-99 in mur and 25-135 in the rat sequence. The second disulfide bond 70-105 is conserved in all five species. The third disulfide bond 48-C# is conserved in hum, mur and rat IL4 and this is replaced by 48-85 in ov and bov IL4. The deletion of 17 aa from the ov and bov aa sequence, which is in the BC loop (according to NMR studies of hum IL4), would result in a shorter BC loop which could presumably be shortened without major disruption to the overall packing of the helices. is
combinant proteins to raise monoclonal antibodies. Both the ovZL4 cDNA and the antibodies would be useful tools for examining the different T cell subsets involved in the immune responses to infectious agents.
REFERENCES Brandhuber, B.J., Boone, T., Kenney, W.C. and McKay, dimensional structure of interleukin-2. Science
D.B.: Three238 (1987)
1707-1709. Coffman, R.L., Seymour, B.W.P., Lebman, D.A., Hiraki, D.D., Christiansen, J.A., Shrader, B., Cherwinski, H.M., Savelkoul, H.F.J., Finkelman, F.D., Bond, M.W. and Mosmann, T.R.: The role of helper T cell products in mouse B cell differentiation and isotype regulation. Immunol. Rev. 102 (1988) 5-28. Heussler, V.T., Eichhorn, M. and Dobbelaere, D.A.E.: Cloning of a fulllength
cDNA
encoding
bovine
interleukin-4
by the polymerase
chain reaction. Gene 114 (1992) 273-278. Howard, M., Farrar, J., Hilfiker, M., Johnson, B., Takatsu, K., Hamaoka, T. and Paul, W.E.: Identification of a T cell-derived B cell growth factor 914-923.
distinct
from interleukin
2. J. Exp. Med. 155 (1982)
Lee, F., Yokota, T., Otsuka, T., Meyerson, P., Villaret, D., Coffman, R., Mosmann, T., Rennick, D., Roehmn, N., Smith, C., Zlotnik, A. and Arai, K.: Isolation and characterization of a mouse interleukin cDNA clone that expresses B-cell stimulatory factor 1 activities and T-cell- and mast-cell-stimulating activities. Proc. Nat]. Acad. Sci. USA 83 (1986) 2061-2065. Maniatis, T., Fritsch, E.F. and Sambrook, Laboratory Manual. Harbor, NY, 1982.
Cold Spring
J.: Molecular
Harbor
Laboratory,
Cloning.
A
Cold Spring
McKnight, A.J., Barclay, A.N. and Mason, D.W.: Molecular cloning of rat interleukin 4 cDNA and analysis of the cytokine repertoire of subsets of CD4’ T cells. Eur. J. Immunol. 21 (1991) 1187-l 194. Mosmann, T.R., Cherwinski, H., Bond, M.W., Giedlin, M.A. and CotIman, R.L.: Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136 (1986) 2348-2357. Mosmann, T.R., Yokota, T., Kastelein, R., Zurawski, S.M., Arai, N. and Takebe, Y.: Species-specificity of T cell stimulating activities of IL2 and BSF-I (IL4): comparison of normal and recombinant mouse and human 1813-1816.
IL2
and
BSF-1
(IL4).
J.
Immunol.
138 (1987)
Paul, W.E. and Ohara, J.: B-cell stimulatory factor-l/interleukin 4. Ann. Rev. Immunol. 5 (1987) 429-459. Presnell, S.R. and Cohen, F.E.: Topological distribution of four-a-helix bundles. Proc. Natl. Acad. Sci. USA 86 (1989) 6592-6596.
(c) Conclusions
Redfield, C., Smith, L.J., Boyd, J., Lawrence, M.P., Edwards, R.G., Smith, R.A.G. and Dobson, C.M.: Secondary structure and topology of human interleukin 4 in solution. Biochemistry 30 (1991) 11029-l 1035.
It has been reported that hum and mur IL4 receptors do not cross-react (Mosmann et al., 1987). With the availability of ovlL4, we can now engineer hybrid ov-hum and ov-mur IL4 molecules to find the species-specific residues. In addition, ovlL4 can be expressed to obtain re-
Yokota, T., Otsuka, Balanchard, D., characterization to mouse B-cell cell-stimulating 5894-5898.
T., Mosmann, T., Banchereau, J., De France, T., De Vries, J.E., Lee, F. and Arai, K.: Isolation and of a human interleukin cDNA clone, homologous stimulatory factor 1, that expresses B-cell-and Tactivities, Proc. Nat]. Acad. Sci. USA 83 (1986)