Cloning, characterization and subcellular localization of Nuclear LIM interactor interacting factor gene from Leishmania donovani

Accepted Manuscript Cloning, characterization and subcellular localization of Nuclear LIM interactor interacting factor gene from Leishmania donovani

R Ravinder, N Goyal PII: DOI: Reference:

S0378-1119(17)30089-6 doi: 10.1016/j.gene.2017.02.007 GENE 41778

To appear in:

Gene

Received date: Revised date: Accepted date:

19 October 2016 4 February 2017 6 February 2017

Please cite this article as: R Ravinder, N Goyal , Cloning, characterization and subcellular localization of Nuclear LIM interactor interacting factor gene from Leishmania donovani. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Gene(2017), doi: 10.1016/j.gene.2017.02.007

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Cloning, characterization and subcellular localization of Nuclear LIM interactor interacting factor gene from Leishmania donovani. Ravinder, R1 and Goyal, N2 * 1

Confocal Imaging , Sophisticated Instrumentation Facility, IIT Indore , Khandwa Road, Simrol,

IP

*Division of Biochemistry, CSIR-Central Drug Research Institute, Sector 10, Jankipuram

Extension, Sitapur Road, Lucknow, 226031(UP), India

US

*Correspondence should be addressed to:

CR

2

T

453552 (MP), India

Dr. Neena Goyal,

AN

Senior Principal Scientist

ED

CSIR- Central Drug Research Institute,

M

Division of Biochemistry,

Sector 10, Jankipuram Extension, Sitapur Road, Lucknow 226031(UP) India,

PT

E-mail: [email protected] Tel (O): +91-522-2772450, ext. 4639.

CE

Abstract:

LIM domains are zinc-binding motifs that mediate protein protein interactions and are found in a

AC

wide variety of cytoplasmic and nuclear proteins. The nuclear LIM domain family members have a number of different functions including transcription factors, gene regulation, cell fate determination, organization of the cytoskeleton and tumour formation exerting their function through various LIM domain interacting protein partners/cofactors. Nuclear LIM domain interacting proteins/factors have not been reported in any protozoan parasites including Leishmania. Here, we report for the first time cloning, characterization and subcellular localization of nuclear LIM interactor-interacting factor (NLI) like protein from Leishmania donovani, the causative agent of Indian Kala-azar. Primary sequence analysis of LdNLI revealed

ACCEPTED MANUSCRIPT presence of characteristic features of nuclear LIM interactor-interacting factor. However, leishmanial NLI represents a distinct kinetoplastid group, clustered in a separate branch of the phylogenic tree. The sub-cellular distribution of LdNLI revealed the discreet localization in nucleus and kinetoplast only, suggesting that the gene may have a role in parasite gene expression. nuclear LIM interactor-interacting factor, Phylogeny ,

T

Keywords:, Leishmania donovani,

IP

Expression, Transfectant, Immunofluorescence.

CR

Highlight:

1) Sequence characterization revealed absence of any transmembrane domain/ signal peptides

US

and classifies as highly unstable in nature.

AN

2)In phylogenetic analysis, LdNLI exhibited close evolutionary relationship with other kinetoplastids, forming an independent cluster.

M

3) Overexpression of LdNLI had no effect on the in vitro growth of the parasites.

ED

4) LdNLI may not have a role in susceptibility of promastigotes to trivalent antimony Sb(III).

PT

5) LdNLI predominantly localized in nucleus and kinetoplast . 1. Introduction

CE

It is estimated that over one billion people are the victims of parasitic disease worldwide, and for some diseases in certain areas, more than 80% of the population are infected. Human visceral

AC

leishmaniasis (VL) results from infection with L. donovani and L. infantum and is usually fatal if left untreated, accounting for more than 50,000 deaths per year (Rijal et al., 2010). Lack of vaccine due to the complexity of the cellular immune response to these parasites (Pace,2014) and emergence of resistance in parasites in field against first line treatment, antimonials, have aggravated the situation further (Ashutosh et al., 2005). During the last decade, several novel formulations of conventional antileishmanials, as well as new drugs, including the oral agent miltefosine, became available. However, their widespread use is limited either by high cost or toxicity with also some chances of the emergence of resistance (Maltezou,2010). The presentday requirement in the treatment of leishmaniasis is to understand parasite biology and molecular

ACCEPTED MANUSCRIPT mechanism of drug resistance in order to identify novel or combination chemotherapeutic approaches to fight Leishmaniasis. Leishmania species are dimorphic protozoan parasites with an extracellular flagellated promastigote stage that reside in the sandfly vector and an intracellular amastigote stage occurring within mammalian macrophages (Molyneux and Killick-Kendrick, 1987; Alexander

T

and Russel, 1992). The ability of the parasite to undergo differentiation from promastigote to

IP

amastigote forms is crucial for its pathogenesis. Microarray based expression profiling have been used to identify differentially expressed genes that may have a role in virulence, growth,

CR

differentiation, survival of the parasite and resistance (Saxena et al., 2003; Leprohonet al., 2009; Srividya et al., 2007; Singh et al., 2007; Mcnicoll et al., 2006; Alcolea et al., 2009). These

US

studies led to identification of several novel genes. Through transcriptome analysis using genomic DNA microarray of L. donovani containing 4224 genomic fragments, we identified one

AN

clone which was consistently up-regulated in resistant field isolates and exhibited significant homology to Nuclear LIM interactor interacting factor like protein (NLI) (unpublished data).

M

Many cellular functions are dependent on specific protein-protein interactions. These interactions are governed by a variety of protein binding domains one of which is the LIM domain. The name

ED

LIM is derived from the three developmentally regulated transcription factors, LIN-11 of C.elegans (Freyd et al., 1990), Isl1 of rat (Karlsson et al., 1990), and MEC-3 of C. elegans (Way

PT

et al., 1988) in which the LIM domain was initially identified. LIM domains are the cystein rich zinc-binding motifs. LIM domain-containing proteins have been identified in a wide range of

CE

eukaryotes, including protozoa (Chien et al., 2000; Khurana et al., 2002), plants (Mundel et al., 2000), and yeast (S.cerevisiae) (Muller et al., 1994), stressing the evolutionary importance of

AC

these proteins. Proteins that contain these domains have a number of different functions including transcription factors, gene regulation, cell fate determination, cell migration, organization of the cytoskeleton and tumour formation (Khurana et al., 2002; Taira et al., 1995; Zheng and Zhao, 2007). These proteins exert their function through their various protein partners/cofactors which interact via the LIM domain. One important cofactor protein that is involved in the assembly of multiprotein complexes is LIM-domain-binding protein 1 [(Ldb1, also known as carboxy LIM2 (CLIM2) and NLI (Nuclear LIM interactor interacting factor like protein)]. Ldb1 (CLIM2, NLI) and the highly related paralogue Ldb2 (CLIM1) are LIM domain binding transcription cofactors required for the function of LIM homeodomain transactivators

ACCEPTED MANUSCRIPT (Agulnick et al., 1996; Jurata et al., 1996; Bach et al., 1997). NLI has no known enzymatic or nucleic-acid-binding function. Rather, it seems to act as a specific protein-binding interface. It is very interesting to note that so far no LIM domain containing proteins or LIM domain binding/interacting proteins have been reported in any protozoan parasites including Leishmania. In this study we report for the first time cloning, expression and characterization of nuclear LIM

CR

2. Materials and methods

IP

Leishmania donovani, the causative agent of Indian Kala-azar.

T

interactor-interacting factor like protein (from here in onward called LdNLI homologue) from

US

2.1. Parasites culture

Leishmania donovani donovani (MHOM/IN/80/Dd8) originally obtained in the form of

AN

promastigotes from late Prof. P.C.C. Garnham, (Imperial College London, London, United Kingdom) was used as WHO reference strain in the present study. The strain was maintained in

M

golden hamsters at CSIR-Central Drug Research Institute. The cultures were further adapted to medium199 (Sigma, St. Louis, MO) 1% penicillin (50 U/ml), streptomycin (50μg/ml) solution

ED

(Sigma) and supplemented with 10% fetal calf serum (FCS) (Gibco/Invitrogen, Carlsbad, CA), at 26  1C temperature (Debrabant, 2004). The promastigotes were maintained by weekly sub-

PT

culture and mid log phase promastigotes cultures were used for experiments.

CE

2.2. Cloning and sequence analysis of LdNLI ORF Total genomic DNA was isolated from L. donovani strain Dd8 promastigotes as described earlier

AC

(Medina-Acosta and Cross, 1993). On the basis of L. infantum genomic database forward primers F(5’- ATG TCT TGC ACG CAC AAA CCA ACG -3’) and reverse primer R( 5’-CAG ATA GTC CCA TCC CCT CGC GTT- 3’) were designed using Oligo software to amplify complete ORF of LdNLI homologue of L. donovani. Amplified PCR product was ligated in pCRII-TOPO vector (Invitrogen) to obtain construct pCRII-LdNLI.

Three positives clones

were selected based on restriction digestion analysis of plasmid DNA and were sequenced from T7 and SP6 end. The protein sequence was deduced from nucleotide sequence by DNA manipulation suite. Protein domain analysis was done using the Simple Modular Architecture Research Tool available via European Bioinformatics Institute. Amino acid data of the gene was

ACCEPTED MANUSCRIPT analyzed using the SanProsite, Prosite, Interpro and Pfam databases to identify the sequence motifs and conserve domains. Protein multiple sequence alignments were done using the ClustalW program using BLOSUM algorithm. The JAVA file was used to edit output file on paint. The phylogenetic tree was drawn using PHYLIP file of alignment in treeview1.6.6. Signal sequence and protease cleavage sites were predicted using the SignalP link available at the world wide ExPASy (Expert Protein Analysis System) proteomics server of the Swiss Institute of

IP

T

Bioinformatics (SIB).

CR

2.3. Southern blotting for gene copy number analysis

Copy number of LdNLI per haploid genome of L. donovani was determined by Southern

US

hybridization. Total genomic DNA was isolated from promastigotes (L. donovani Dd8 strain) using protocol described earlier (Medina- Acosta and Cross, 1993).6 µg of DNAwas digested with restriction enzyme that either cut once in whole ORF or do not cut at all and separated on 50 ng of probe was

AN

0.8% agarose gel. Southern hybridization was performed with 32P labelled NLI ORF as probe. radiolabelled labeling with α32 P dCTP(10μCi/ml; specific activity

M

3000Ci/mM) using random labeling Kit (BRIT, India) (Feinberg and Vogelstein, 1984) and was used for hybridization. After hybridization membrane was washed, wrapped in cling film and

ED

exposed to Kodak X-ray film for 16-18 hrs at -800C and then developed

PT

2.4. Expression and purification of recombinant protein (rLdNLI)

CE

The LdNLI ORF was further PCR amplified using pCRII-LdNLI plasmid as template and ligated in pEXP5-NT /TOPO vector (Invitrogen) in accordance with manufacturer’s protocol.The right

AC

oriented construct pEXP5-NT-LdNLI was used to transform BL21(DE3) pLysS E.coli cells. The recombinant rLdNLI protein with N- terminal His tag was expressed and optimized at 2mM IPTG, at 37oC for 4hrs. Recombinant protein (rLdNLI) was purified using Ni-NTA agarose ionexchange column chromatography under denatured condition according to the manufacturer’s protocol (Qiagen) and analyzed on 10% SDS-PAGE (Lammili, 1970). The recombinant protein was then purified to homogeneity by electro-elution and used for antibody generation in rabbit.

ACCEPTED MANUSCRIPT 2.5 Overexpression LdNLI in Leishmania

The LdNLI ORF was PCR amplified from construct pEXP5-NT-LdNLI using primers with SpeI restriction sites (underlined) (F 5'GGCCACTAGTATGTCTTGCACGCACAAAC3', R 5’GGCCACTAGTTCACAGGTAGTCCCATC3’) and cloned into Leishmania shuttle vector pKS-Neo. Right oriented pKS-LdNLI construct was transfected into promastigotes by

T

electroporation using a Gene Pulser (Bio-Rad) under conditions described earlier (Ashutosh et

CR

IP

al., 2005). Transfectants were selected and maintained in the presence of G418 (40μg/ml). 2.6. Western blotting

US

To demonstrate endogenous expression of LdNLI in parasite, mid log phase cultures of promastigotes (both wild type and overexpressing) were harvested and proteins from equivalent

AN

number of cells were analyzed by SDS-PAGE, transferred onto nitrocellulose membrane, and processed for western blot analysis with anti-rLdNLI antibody as described previously (Towbin

M

et al., 1979). Blots were developed using ECL reagent (GE Healthcare) and visualized on X-Ray

2.7. Drug sensitivity assay.

ED

film.

PT

Trivalent antimony (SbIII) compound was chosen as it is considered as active form of antimonial drug (Roberts et al., 1995) Mid-log-phase promastigotes of the wild type and overexpressing

CE

mutants were seeded in 96-well culture plates to a final concentration of 0.5X106 cells/ml in medium M199 alone or in the presence of increasing concentrations of trivalent antimony

AC

[Sb(III)] in triplicate.and allowed to grow for 48 hrs at 26 ± 1°C. Microscopic counting was done to see the inhibitory effect of SbIII on promastigote multiplication and IC 50 value was calculated by probit analysis (Finney, 1971). 2.8. Immunofluorscence microscopy

Log phase L. donovani promastigotes (both wild type and over expressing) were harvested by centrifugation, washed twice with phosphate-buffered saline (PBS), and allowed to adhere on poly-L-lysine coated glass cover slips for 15 min at 250C. Adhered cells were fixed using

ACCEPTED MANUSCRIPT paraformaldehyde solution (4%) for 30 min and washed thrice with PBS containing 0.5% glycine (w/v). The washed cells were permeabilized using 0.5% (v/v) Triton X-100 and blocked with 0.5% bovine serum albumin (BSA) in PBS for 1hrs. The blocked cells were first incubated with primary antibodies (purified anti-LdNLI rabbit sera (1:200) at 40C for 4hrs.The cells were then washed in blocking buffer to remove non-specifically bound antibodies and then incubated with FITC conjugated antirabbit IgG (1:10000) for 4hrs at 40C. Nuclear staining was carried out with

T

4’,6-diamidino-2-phenylindole (DAPI) for 20 min. The cell were mounted on glass slide in

IP

glycerol containing pinch of 1, 4-phenylene diamine (antifade) agent, and images were acquired

CR

by Leica TCS SPE , Germany, with 63x/1.30 oil objective. Separate image at 358nm and 488nm were taken and presented as merged image.

US

2.9. Statistical analysis

AN

All experimental data were statistically analyzed and were presented as means ± standarderror

M

(SE) of at least three replicate of two independent experiments.

ED

3. Results

PT

3.1. Cloning of LdNLI gene and primary structural comparison with other NLI homologues An open reading frame of 870 bp for LdNLI (Nuclear Lim interactor interacting –factor like

CE

protein) that encodes a polypeptide of 290 amino acids was observed. The predicted molecular weight of the protein was 33.31 kD with theoretical pI of 8.37.The (G+C) % of the LdNLI was

AC

55.63 while number of negatively charged residue (Asp+Glu) was 33 and positively charged residue (Arg+Lys) was 36. The instability index (II) of the protein was computed to be 49.92, which classifies the protein as highly unstable. Grand average of hydropathicity by KyteDoolittle comes to be -0.322, since it has negative gravy the predicted protein was hydrophilic in nature. The protein did not have any trans-membrane domain and signal peptide sequence. Complete nucleotide sequence of LdNLI was submiited to Genebank accession number BankIt1924043 SeqLdNLI KX355325. BLASTx analysis revealed that LdNLI ORF has good homology with two different group of protein i.e. Nuclear lim interactor–interacting factor like protein and carboxy-terminal domain

ACCEPTED MANUSCRIPT RNA polymerase II polypeptide A small phosphatase (CTD phosphatase). Clustal W sequence alignment of LdNLI with NLI homologue of other organisms namely T. cruzi(XP_813595.1), Brugia

malai(XP_001901033.1),

(NP_005721.3),

Mus.

muscullus(NP_001106941.1),

Arabdiopsis.

thaliana(NP_196747.1),

Homo.

sapiens

Xanthomonas.

tropicalis(NP_001006793.1),Cannis. familiaris (XP_851188.1) and Phytopthera. infestans (AAV63937.1) (Fig.1) revealed various conserved domains that can be grouped into three main

T

groups namely non-specific hits (HIF-SF-euk, NIF, CPDc and FCP1-euk) super families,

IP

Halocid dehalogenase-hydrolase (HAD-like) super family and Multi-domains (FCP1). All the

CR

three groups have one main conserved domain or signature motif DXDXT/S/T. HAD like superfamily comprises of three conserved motifs, of which first two are present in the

US

LdNLI sequence. The first conserved motif HAD superfamily has signature sequence of DXDX(T/V), of which D (Aspertate) corresponding to 129 position of LdNLI, is highly

AN

conserved across the species. The conserved Serine/Threonine of motif II was also present at position 176 in LdNLI as (T). Conserved Lysine (K) residue along with conserved acidic residue

M

of motif III that are commonly found in several arrangement: DD, DXXD, DXXXXD was missing in LdNLI homologue. contain The conserved motif DXDX(T/V) of FCP-1 phosphatase

signature sequence,

ED

was also present in LdNLI sequence (Fig. 1). LdNLI homologue also contained conserved DLDET, which corresponds to another group of protein called NLI

PT

interacting factor (NIF) (Claussen et al., 2004). A phylogenetic tree, (Fig.2.A) was constructed to examine the evolutionary distance of LdNLI

CE

with other species homologs. The figure clearly depicts three distinct group of clad, which includes lower eukaryotes (L. donovani and T. cruzi), plant (A. thaliana) and third group of

AC

higher eukaryotes (M. muscullus, H. sapiens, C. familiaris, X. tropicallis and B. malayi) and prokaryotes (P. infestans). The most distant group in the phylogeny involved higher animals namely cat and human. Interestingly, LdNLI protein exhibited strong homology with nuclear LIM interactor interacting protein from other Leishmania species. The alignment of amino acid sequence from Leishmania species namely L. infantum (LinJ26-V3.0140), L. major (LmjF26.0160) and L. braziliensis (LbrM26-V2.0150) showed 98%, 97% and 87% identities respectively. Using a maximum likelihood model, a robust phylogeny was generated with bootstrap values of greater than 98% at all nodes. The phylogenetic tree (Fig.2.B) show two

ACCEPTED MANUSCRIPT major group, one of non visceral species (L. major and L. braziliensis) while the other included species causing visceral leishmaniasis (L. infantum and L. donovani). 3.2. Genomic organization of LdNLI. To define the complexity of the NLI gene in the Leishmania genome, L. donovani genomic

T

DNA was subjected to Southern blot analysis at high stringency with a LdNLI gene probe (Fig.

IP

3). Restriction enzymes were selected on the basis of sites present or absent in the probes. The enzymes BglII, HindIII, NcoI and SacII are the non-cutter to the gene and resulted in only

CR

single band. However, SphI that cuts the gene once at 537/533 bp position, gave two bands

3.3. Expression and purification of rLdNLI

US

confirming that LdNLI ORF is present as single copy in L. donovani genome.

AN

The recombinant protein, rLdNLI, was expressed as a histidine tagged protein in E. coli and purified under denaturating conditions using Ni–NTA agarose (Fig.4 ). Analysis of the purified

M

rLdNLI protein by SDS–PAGE exhibited a major band of about 35kDa protein that corresponded to the molecular weight predicted by the open reading frame plus the size of the

ED

epitope tag (six histidines) (Fig 4A). The recombinant protein was then purified to homogeneity

PT

by electro-elution (Fig 4B) and used for antibody generation in rabbit. 3.4. Endogenous expression of LdNLI in promastigotes

CE

Western analysis was tried to demonstrate the endogenous expression of LdNLI in promastigotes. Interestingly, no band was observed in Leishmania lysate (data not shown)

AC

confirming its highly unstable nature.

3.5. Over expression of LdNLI in Leishmania parasite and its resistant phenotype The gene was over expressed in L. donovani promastigotes and presence of LdNLI gene in transfectants was confirmed by RT-PCR. Very intense bands in the parasites transfected with the pKS-LdNLI construct compared to wild type cells suggest that the LdNLI transcript was present in the transfectants at high copy numbers (Fig.5.A). The band intensity of the LdNLI amplicon was 1.54 fold higher (calculated by densitometric analysis using Gel-Doc software) in transfectants (maintained at 40 g/ml G418) than in wild type cells (Fig.5.A). They do not show

ACCEPTED MANUSCRIPT any morphological difference in terms of size, shape and flagellar length. Figure 5 B depicts growth curves of both transfectants and wild type cells. Rate of multiplication of transfected promastigotes was comparable to that of wild type, indicating that overexpression of LdNLI had no effect on the in vitro growth of the parasites. Figure 5 C compares the Sb(III) susceptibilities of the promastigotes of transfectants (overexpressing LdNLI) and wild type cells. The drug inhibited the parasite multiplication in a dose dependent manner. However, no significant

T

difference was observed between IC50 values of wild type (38.7µg/ml) and transfectants

IP

(36.5µg/ml).The data clearly indicates that the overexpression of LdNLI may not have a role in

CR

susceptibility of promastigotes to Sb(III).

US

3.6. Subcellular localization of LdNLI in L. donovani promastigotes In order to confirm its intracellular distribution, wild type and transfected parasites (construct

AN

pKS-Neo -LdNLI) were labeled with anti-LdNLI followed by labeling with FITC (green) tagged secondary antibody. Immunofluorescence image of the cells were taken after staining with DAPI, the nuclear specific staining. Localization of LdNLI with nucleus and kinetedoplast was

M

observed in both wild type promastigotes and transfected promastigote (Fig 6d & h).Almost

ED

negligible fluorescence of protein was observed in wild type (Dd8) promastigotes (Fig. 6c). However, subcellular localization was much clearer in overexpressing parasites. Interestingly the

PT

protein exhibited predominant accumulation in nucleus and kinetoplast.

CE

4. Discussion

LIM domains are zinc-binding motifs that mediate protein protein interactions (Wu and Gill,

AC

1994; Schmeichel and Beckerle, 1994; Valge-Archer et al., 1994; Durick et al., 1996) and are found in a wide variety of cytoplasmic and nuclear proteins. The nuclear LIM domain family members are more closely related to each other than to the cytoplasmic LIM domain-containing proteins (Dawid et al., 1995). These proteins have a number of different functions including transcription factors, gene regulation, cell fate determination, cell migration, organization of the cytoskeleton and tumour formation (Khurana et al., 2002; Taira et al., 1995; Zheng and Zhao, 2007). These proteins exert their function through their various protein partners/cofactors which interact via the LIM domain. They can be classified as LIM-only proteins, which contain little more than two LIM domains, or as LIM homeodomain proteins, containing a DNA binding

ACCEPTED MANUSCRIPT homeodomain in addition to the two N-terminal LIM domains. One of interacting proteins is nuclear LIM interactor-interacting factor (NLI-IF), a nuclear protein whose function is just beginning to be understood. It is a member of a broad family of molecules, found in species ranging from yeast to human that contain a common domain of approximately 100 amino acids (Kiefer et al., 2008). Recently, a murine homolog of human NLI-IF is identified as golgi interacting protein (Fernandes et al., 2004). However, no such protein is so far reported and

T

characterizes in prokaryotes including leishmania. While exploring the novel resistance related

IP

proteins in Leishmania through transcriptome analysis, we identified one clone which was

CR

consistently up-regulated in resistant field isolates (unpublished data). Sequencing and annotation of this clones revealed significant homology to Nuclear LIM interactor interacting

US

factor like protein (NLI-IF). As the gene has not been cloned or characterized in any Leishmania spp. we initiated the studies on cloning and characterization of NLI-IF gene of L. donovani, as a

AN

first step to explore its function in parasite, if any.

An open reading frame of 870 bp for LdNLI (Nuclear Lim interacting –factor like protein) that

M

encodes a polypeptide of 290 amino acids with predicted molecular mass of 33.1kDa was observed as NLI-IF gene of L. donovani. Protein domain/signature sequence search by various

ED

tools revealed that gene sequence has 100 amino acid conserved domain, a characteristic features of NLI-IF gene suggesting that cloned ORF is a NLI-IF gene of Leishmania donovani. In

PT

addition, it also had good homology with carboxy-terminal domain RNA polymerase II polypeptide a small phosphatase (CTD phosphatase).

CE

BLASTx analysis reveals that it is widely distributed ranging from lower fungi (P. infestans) to higher group human (H. sapiens) (Fig.1). The C-terminal region of LdNLI exhibited highest

AC

level of sequence homology with conserved domains of several proteins which are in involved in various vital cellular functions. The first conserved domain contained DXDXT motif (Fig. 1), initially designated as nuclear LIM interacting factor (NIF) in the genome entry (Marquet et al., 2000). It is also present in HIF-SF-euk domain, found in FCP-1 like phosphates (TIGR02250), and domain present in halocid dehalogenase- like (HAD) super family and FCP-1(Cog5190). FCP phosphatase, is identified recently in trypanosomes (Szoor et al., 2010) in substrate trapping experiment. It is involved in hydrolysis of phosphoester bonds. In yeast and multicellular organisms, it dephosphorylates the carboxy terminal domain (CTD) of RNA polymerase II, induces interaction with transcription factor II F (TFIIF) and promotes recycling of RNAPII after

ACCEPTED MANUSCRIPT transcription (Kobor et al., 1999). The canonical CTD is essential for gene expression in metazoan and yeast and characterized by heptapeptide (YSPTSPS) repeats. But many organisms including trypanosomes lack canonical CTD and in these species CTD is called non-canonical CTD or pseudo-CTD (Das and Bellofatto, 2009). Presence of this domain indicates the possible involvement of LdNLI in process of dephosphorylation and regulation of the gene expression.

T

The presence of conserved Aspartate residue at position 129 and 131 and threonine and serine at

IP

position 176 and 178 in LdNLI (Fig. 1) make it an important member of HAD superfamily

CR

which makes up one of the largest known super families of enzyme. The number of HADSF members has been steadily increasing from mere 50 proteins (Koonin and Tatusov, 1994) to more than 14000 proteins today, either as single domain protein or as a part of multidomain

US

protein. Members are widely distributed in archaea, bacteria and eukarya (Burroughs et al., 2006). LdNLI lacks the conserved motif III of HADSF which is involved in coordination of the

AN

divalent metal ion (mostly Mg2+) in the active site. The amino acid residue at the D+2 position of the first conserved motif has special significance as it can be, in part predictor of the activity for

M

uncharacterized HAD. The amino acid residue at D+2 position changes depending upon functional class of HAD hydrolase. Since LdNLI has Aspartate at this position, it may be

ED

phosphatase in nature. Claussen et al by RT-PCR analysis revealed constant mRNA levels of XNIF throughout embryogenesis and the RNA could also be detected in all adult tissue

PT

(Claussen et al., 2004). Presence of these conserved domains in LdNLI homologue suggests its possible role in development of parasites. When gene was aligned with NLI homologue within

CE

genus leishmania, the data show high degree of conservation from 87%-98% (Fig.2B). LdNLI

blot.

AC

gene is present in single copy per haploid genome (Fig. 3) when analyzed with help of southern

LdNLI was overexpressd in prokaryotic host E.coli and L. donovani parasite. Despite of several attempts, employing various conditions, LdNLI protein could not be expressed in its native form in E.coli. It may be due to difference in the translation machinery between prokaryotes and eukaryotes. One of the major drawbacks of E. coli is the reducing nature of its cytoplasm, which inhibits the formation of disulfide bridges. This may also result in incorrect folding of complex proteins or the formation of protein aggregates. Several protein from leishmania have been reported to express in insoluble form by various investigators, few of which are Leishmania

ACCEPTED MANUSCRIPT donovani actin (LdACT), (Sahasrabuddhe et al., 2004) adenylate kinase 2, and methionine adenosyltransferase (MAT2) (Perez-Peatejoy et al., 2003) from L. donovani, glucose regulating protein 94 (GRP 94) (Larreta et al., 2002) from L. infantum. The denatured overexpressd recombinant LdNLI protein was, purified from inclusion bodies under denatured condition (Fig.4.B) for generation of antibodies in rabbit against LdNLI. However, the anti-LdNLI antibodies failed to detect the protein in parasite lysate. It has been found that moderately

T

expressed genes during the cell cycle were expressed in spikes for only short time periods while

IP

highly expressed genes are transcribed for longer time periods.(Chubb etal.,2010: Suter et al.,

CR

2011). This may result result invery low levels of expression of NLI protein or its high turnover. Very low endogenous levels of NLI were also suggested by confocal analysis. Very faint signals

US

were observed in wild type parasites (Fig. 6.c) while in LdNLI overexpressing cells strong signals were obtained (Fig. 6.g). Protein was mostly localized in nuclear and kinetoplast region

AN

(Fig.6. h). Interestingly, murine homolog of human nuclear LIM interactor interacting factor was found to be localized predominantly in nuclei. The data further supports that identified LdNLI is

M

also the member of nuclear LIM interactor interacting factor. Further, nuclear proteins are found to be more unstable and differences in degradation rates of cytosolic and nuclear proteins may be

ED

due to inherent differences in rates of degradation pathways in the organelles or cytosol (Hellmann H., Estelle M. 2002: Sinvany-Villalobo et al., 2004).

PT

Though the NLI gene was identified by microarray analysis as up regulated gene in antimony resistant field isolates, but overexpression of the gene did not modulate sensitivity of parasite to

AC

resistance.

CE

SbIII. The observation suggests that the LdNLI itself may not have a role in parasite drug

Taken together, we have for the first time reported gene cloning, characterization, and subcellular localization of NLI-IF from L. donovani. Presence of phosphatase domain indicates its possible involvement in dephosphorylation of CTD of RNAPII which is supported by predominant localization in nucleus and kinetoplast. This report is the first demonstration of NLI-IF in any kinetoplastid parasite. Exploration of the interacting proteins of LdNLI may give an insight of its role in parasite survival. Acknowledgments

ACCEPTED MANUSCRIPT This manuscript carries CDRI communication number (XXXX). The work is supported by institutional project .We are grateful to Dr Amogh A Sahasrabuddhe and Dr.Kalyan Mitra for their help in confocal microscopy. Financial support from Council of Scientific and Industrial Reaserch, New Delhi to Ravinder is gratefully acknowledged. References:

IP

T

Agulnick AD, Taira M, Breen JJ, Tanaka T, Dawid IB, Westphal H. (1996). Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins. Nature 384: 270-272.

US

CR

Alcolea PJ, Alonso A, Sanchez-Gorostiaga A, Moreno-Paz M, Gomez MJ, Ramos I, Parro V, Larraga V. (2009). Genome-wide analysis reveals increased levels of transcripts related with infectivity in peanut lectin non-agglutinated promastigotes of Leishmania infantum. Genomics 93:551-564. Alexander J, Russell DG. (1992). The interaction of Leishmania species with macrophages. Advan.Parasitol. 31: 175-254.

M

AN

Ashutosh, Gupta S, Ramesh, Sundar S, Goyal N. (2005). Use of Leishmania donovani field isolates expressing the luciferase reporter gene in in vitro drug screening. Antimicrob. Agents. Chemother. 49: 3776-3783.

ED

Bach I, Carriere C, Ostendorff HP, Andersen B, Rosenfeld MG. (1997). A family of LIM domain-associated cofactors confers transcriptional synergism between LIM and Otx homeodomain proteins. Genes. Dev. 11:1370-1380.

PT

Burroughs AM, Allen KN, Debra-DunawayM, Aravind L. (2006). Evolutionary Genomics of the HAD Superfamily: Understanding the Structural Adaptations and Catalytic Diversity in a Superfamily of Phosphoesterases and Allied Enzymes. J. Mol. Bio. 361(5):1003-1034.

AC

CE

Chien S, Chung CY, Sukumaran S, Osborne N, Lee S, Ellsworth C, McNally JG, Firtel RA. (2000). The Dictyostelium LIM domain-containing protein LIM2 is essential for proper chemotaxis and morphogenesis. Mol. Biol. Cell. 11:1275–1291. Chubb JR, Liverpool TB. Bursts and pulses: Insights from single cell studies into transcriptional mechanisms. Curr Opin Genet Dev. 2010;20:478–484. Claussen M, Horvay K, Pieler T. (2004). Evidence for overlapping but not identical, protein machineries operating in vegetal RNA localization along early and late pathways in Xenopus oocytes. Development 131:4263-4673. Das A. Bellofatto V. (2009). The non-canonical CTD of RNAP-II is essential for productive RNA synthesis in Trypanosoma brucei. PLoS One 4:e6959. Dawid IB, Toyama R, Taira M. (1995). LIM domain proteins.C. R. Acad.Sci. III. 318(3):295306.

ACCEPTED MANUSCRIPT Debrabant A, Joshi MB, Pimenta PF, Dwyer DM. (2004). Generation of Leishmania donovani axenic amastigotes: their growth and biological characteristics. Int. J.Parasitol. 34: 205-217. Durick K, Wu RY, Gill GN, Taylor SS. (1996).Mitogenic signaling by Ret/ptc2 requires association with enigma via a LIM domain. J. Biol. Chem. 271:12691-12694. Feinberg AP, Vogelstein B. (1984).A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Addendum. Anal. Biochem. 137:266-267.

CR

IP

T

Fernandes AO, Campagnoni CW, Kampf K, Feng JM, Handley VW, Schonmann V, Bongarzone ER, Reyes S, Campagnoni AT. (2004). Identification of a protein that interacts with the gollimyelin basic protein and with nuclear LIM interactor in the nervous system. J. Neurosci.Res.75(4):461-471.

US

Finney DJ. (1971). Probit analysis, 3rd ed. Cambridge University Press,Cambridge, United Kingdom. 333.

AN

Freyd G, Kim SK, Horvitz HR. (1990). Novel cysteine-rich motif and homeo domain in the product of the Caenorhabditis elegans cell lineage gene lin-11. Nature 344: 876-879. development:

Regulation

by

protein

M

Hellmann H., Estelle M. (2002) Plant degradation. Science 297, 793–797.

ED

Jurata LW, Kenny DA, Gill GN. (1996). Nuclear LIM interactor, a rhombotin and LIM homeodomain interacting protein, is expressed early in neuronal development. Proc. Natl. Acad. Sci. USA. 93: 11693-11698.

PT

Karlsson O, Thor S, Njorberg T, Ohlsson H, Edlund T. (1990). Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeoand a Cys-His domain. Nature 344:879-882.

CE

Khurana B, Khurana T, Khaire N, Noegel AA. (2002). Functions of LIM proteins in cell polarity and chemotactic motility. Embo. J. 21:5331–5342.

AC

Khurana T, Khurana B, Noegel AA. (2002). LIM proteins: association with the actin cytoskeleton. Protoplasma 219: 1–12. Kiefer CM, Hou C, Little JA, Dean A. (2008).Epigenetics of β-globin gene regulation. Mutat. Res. 647:68–76. Kobor MS, Archambault J, Lester W, Holstege FC, Gileadi O, Jansma DB, Jennings EG, Kouyoumdjian F, Davidson AR, Young RA, Greenblatt J. (1999). An unusual eukaryotic protein phosphatase required for transcription by RNA polymerase II and CTD dephosphorylation in S. cerevisiae. Mol. Cell. 4:55-62. Koonin EV, Tatusov RL. (1994). Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity. Application of an iterative approach to database search. J. Mol.Biol. 244:125-32.

ACCEPTED MANUSCRIPT Laemmli UK. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. Larreta R, Guzman F, Patarroyo ME, Alonso C, Requena JM. (2002). Antigenic properties of the Leishmania infantum GRP94 and mapping of linear B-cell epitopes. Immunol. Lett. 80:199-205.

T

Leprohon P, Legare D, Raymond F, Madore E, Hardiman G, Corbeil J, Ouellette M. (2009). Gene expression modulation is associated with gene amplification, supernumerary chromosomes and chromosome loss in antimony-resistant Leishmania infantum. Nucleic.Acids. Res. 37:13871399.

IP

Maltezou HC. (2010). Drug Resistance in Visceral Leishmaniasis. Biomed. Biotech. 2010:1-8.

CR

Marquet S, Lepage P, Hudson TJ, Musser JM, Schurr E. (2000). Complete nucleotide sequence and genomic structure of the human NRAMP1 gene region on chromosome region 2q35. Mamm. Genome. 11:755-762.

AN

US

McNicoll F, Drummelsmith J, Muller M, Madore E, Boilard N, Ouellette M, Papadopoulou B. (2006). A combined proteomic and transcriptomic approach to the study of stage differentiation in Leishmania infantum. Proteom. 6:3567-3581. Medina-Acosta E, Cross GA. (1993). Rapid isolation of DNA from trypanosomatid protozoa using a simple ‘mini-prep’ procedure. Mol. Biochem. Parasitol. 59:327–329.

M

Molyneux DH, Killick-Kendrick R. (1987). Morphology, ultra structure and life cycles. The Leishmaniases Bio and Med. 1:121–176.

PT

ED

Müller L, Xu G, Wells R, Hollenberg CP, Piepersberg W. (1994). LRG1 is expressed during sporulation in Saccharomyces cerevisiae and contains motifs similar to LIM and rho/rac GAP domains. Nucleic.Acids. Res.22:3151–3154.

CE

Mundel C, Baltz R, Eliasson A, Bronner R, Grass N, Kräuter R, Evrard JL, Steinmetz A. (2000). A LIM-domain protein from sunflower is localized to the cytoplasm and/or nucleus in a wide variety of tissues and is associated with the phragmoplast in dividing cells. Plant. Mol. Biol. 42:291–302.

AC

Pace D. (2014). Leishmaniasis. J. Infect. 69:10-18. Pérez-Pertejo Y, Reguera RM, Villa H, García-Estrada C, Balaña-Fouce R, Pajares MA, Ordóñez D. (2003). Leishmania donovani methionine adenosyl transferase role of cysteine residues in the recombinant enzyme. Eur. J. Biochem. 270(1):28-35. Rijal S, Uranw S, Chappuis F, Picado A, Khanal B, Paudel IS, Andersen EW, Meheus F, Ostyn B, Das ML, Davies C, Boelaert M. (2010). Epidemiology of Leishmania donovani infection in high-transmission foci in Nepal. Trop. Med. Int. Health. 2:21-28. Roberts WL, Berman JD, Rainey PM. (1995). In vitro antileishmanial properties of tri- and pentavalent antimonial preparations. Antimicrob. Agents. Chemother.39: 1234–1239.)

ACCEPTED MANUSCRIPT Sahasrabuddhe AA, Bajpai VK, Gupta CM. (2004). A novel form of actin in Leishmania: molecular characterisation, subcellular localisation and association with sub pellicular microtubules. Mol. Biochem. Parasitol. 134:105-114. Saxena A, Worthey EA, Yan S, Leland A, Stuart KD, Myler PJ.(2003). Evaluation of differential gene expression in Leishmania major Friedlin procyclics and metacyclics using DNA microarray analysis. Mol. Biochem. Parasitol. 129:103-114.

T

Schmeichel KL, Beckerle MC. (1994). The LIM domain is a modular protein-binding interface. Cell 79(2):211-219.

CR

IP

Singh N, Almeida R, Kothari H, Kumar P, Mandal G, Chatterjee M, Venkatachalam S, Govind MK, Mandal SK, Sundar S.(2007). Differential gene expression analysis in antimonyunresponsive Indian kalaazar (visceral leishmaniasis) clinical isolates by DNA microarray. Parasitology 134:777–787.

US

Sinvany-Villalobo G., Davydov O., Ben-Ari G., Zaltsman A., Raskind A., Adam Z. (2004) Expression in multigene families: Analysis of chloroplast and mitochondrial proteases. Plant Physiol. 135, 1336–1345.

M

AN

Srividya G, Duncan R, Sharma P, Raju BV, Nakhasi HL, Salotra P. (2007). Transcriptome analysis during the process of in vitro differentiation of Leishmaniadonovani using genomic microarrays.Parasitology 134:1527-1539.

ED

Suter DM, Molina N, Gatfield D, Schneider K, Schibler U, Naef F. Mammalian genes are transcribed with widely different bursting kinetics. Science. 2011;332:472–474.

PT

Szoor B, Ruberto I, Burchmore R. Matthews KR. (2010). A novel phosphatase cascade regulates differentiation in Trypanosoma brucei via a glycosomal signaling pathway. Genes. Dev. 24:1306-1316.

CE

Taira M, Evrard JL, Steinmetz A, Dawid IB. (1995). Classification of LIM proteins. Trends. Genet.11:431–432.

AC

Towbin H, Staehelin T, Falgout B. (1979). Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets: procedure andsome application. Proc. Natl. Acad. Sci. USA. 76:4350–4354. Valge-Archer VE, Osada H, Warren AJ, Forster A, Li J, Baer R, Rabbitts TH. (1994). The LIM protein RBTN2 and the basic helix-loop-helix protein TALl are present in a complex in erythroid cells. Proc. Natl. Acad. Sci. USA. 91:8617-8621. Way JC, Chalfie M. (1988). mec-3, a homeobox-containing gene that specifies differentiation of the touch receptor neurons in C. elegans. Cell 54:5-16. Wu RY, Gill GN. (1994). The LIM domain recognition of a tyrosine-containing tight turn. J. Bio. Chem. 269:25085-25090. Zheng Q, Zhao Y. (2007). The diverse biofunctions of LIM domain proteins: determined by subcellular localization and protein-protein interaction. Biol. Cell.99(9):489-502.

ACCEPTED MANUSCRIPT Figure legend:

CR

IP

T

Fig.1.Multiple Sequence alignment of LdNLI C-terminal region with NLI homologue from various organisms. Trypanosoma cruzi (XP_813595.1), Xenopus tropicalis (NP_001006793.1), Brugia malayi (XP_001901033.1 ), Cannis familiaris (XP_851188.1), Musmus culus (NP_001106941.1 ), Arabidopsis thaliana (NP_196747.1 ) Homo sapiens ( NP_005721.3 ) and Phytopthora infestans (AAV63937.1). The conserved motif of HAD superfamily is marked as Motif I (DX(D/T/Y)X(T/V)(L/V), the first Asp is most conserved across the family which is marked in rectangular box . Motif II,(S/T)XXis marked with broken arrow. Fcp1 contains an Nterminal catalytic domain which include DXDX(T/V) signature motif. Nuclear lim interacting factor (NIF-marked with blue colure line) also contain conserved phosphatase motif (DLDET).

M

AN

US

Fig.2.Phylogenetic tree showing the divergence of LdNLI homologueprotein (A) From diffrent organism with their accession number Trypanosoma cruzi (XP_813595.1), Xenopus tropicalis (NP_001006793.1), Brugia malayi (XP_001901033.1 ), Cannis familiaris (XP_851188.1), Musmus culus (NP_001106941.1 ), Arabidopsis thaliana (NP_196747.1 ) Homo sapiens ( NP_005721.3 ) and Phytopthora infestans (AAV63937.1). (B) From L. donovani, L. infantum, L. major and L. brazilliensis. The tree was produced using phylip and a pair wise alignment by bootstrap method.

CE

PT

ED

Fig.3. Depicts the Southern blot analysis of LdNLI gene. L. donovani genomic DNA (6 g) was digested with the restriction enzymes and separated on 0.8% agarose gel, and probed with 32P dCTP labeled C-terminal LdNLI DNA fragment. The enzymes BglII, HindIII, NcoI and SacII are non-cutter to the gene and SphI in fourth lane cuts the gene once at 537/533 bp position, gave two bands (app. 3Kb and 1.5Kb) which is marked with arrow. Lane 1 is molecular weight standard (in Kb) are indicated on the left.

AC

Fig. 4. Heterologous expression of LdNLI and purification. (A) Recombinant poly-histidine tagged LdNLI expressed in E. coli was evaluated for purity on a coomassie blue stained 10% SDS-polyacrylamide gel after Ni-agarose affinity purification. Lane 1:Protein marker, Lane 2; Uninduced bacterial lysate (UI), Lane 3: Induced bacterial lysate (I) Lane 4: Recombinant purified protein (rLdNLI). (B) Purification of over expressed rLDNLI under denatured condition with Ni-NTA affinity column. Lane M: Protein marker, Lane WL: Whole bacterial lysate, Lane E1-E3: Eluted fraction Fig. 5. Characterization of L. donovani overexpressing LdNLI transfectants (OT). (A) RT-PCR analysis of overexpression of LdNLI in transfectants compared to that in wild type (WT) parasites. (B) Growth curves of wild type promastigotes and overexpressing transfectant(C) Effect of SbIII drug on multiplication of wild type and transfectant promastgotes.The values are calculated from mean ±SE of percent inhibition values from three experiments.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Fig.6. Immunofluorescence image showing the intracellular distribution of NLI in wild and overexpressing LdNLI promastigotes. Promastigotes labeled with anti-LdNLI antibodies(green), nucleus and kinetoplastid with DAPI (blue). Panel (d) and (h) show the merge image of differential contrast (DIC), DAPI and FITC. Overexpressing transfectant in panel (h) show colocalizationof NLI in nucleus and kinetoplastid. The image in panel (a) to (d) was optically zoomed 2.5 times, Bar 5µm.

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT Abbreviations: VL: Visceral Leishmaniasis, NLI: Nuclear LIM interacting-interactor like protein Ldb: LIM domain binding protein

T

LdNLI: Leishmania donovani Nuclear LIM interacting-interactor like protein

IP

CSIR: Central Drug Research Institute

CR

ORF: Open reading frame PCR: Polymerase chain reaction

cpm: Count per minute

AN

IPTG: Isopropyl β-D-1-thiogalactopyranoside

US

Ci: Curie

M

Ni-NTA: Nickel Nitrilotriacetic acid

SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis

ED

G418: Geneticin

PT

ECL: Enhanced chemilumescent PBS: Phosphate buffer saline

CE

BSA: Bovine serum albumin

FITC: Fluorescein isothiocyanate

AC

DAPI: 4',6-diamidino-2-phenylindole SEs: Standard error

IC50: Half maximal inhibitory concentration pI: Isoelectric point NIF: Nuclear LIM interacting factor RT-PCR: Reverse transcription polymerase chain reaction CTD: Carboxy terminal domain

ACCEPTED MANUSCRIPT HAD: Halocid dehalogenase

AC

CE

PT

ED

M

AN

US

CR

IP

T

RNAPII: RNA polymeraseII