- Email: [email protected]
Cloning, expression, and catalytic triad of recombinant arylformamidase
Protein Expression and PuriWcation 44 (2005) 39–44 www.elsevier.com/locate/yprep
Cloning, expression, and catalytic triad of recombinant arylformamidase Michael K. Pabarcus, John E. Casida ¤ Environmental Chemistry and Toxicology Laboratory, Department of Environmental Science, Policy and Management, University of California, Berkeley, CA 94720-3112, USA Received 25 February 2005, and in revised form 13 April 2005 Available online 13 May 2005
Abstract Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is correlated with lowered NAD levels and severe teratogenesis. The cDNA sequence previously identiWed for mouse liver AFMID (AF399717) (MW 34229) was cloned and expressed in Escherichia coli. Residues identiWed as potential catalytic triad members (S162, D247, and H279) through sequence motif and homology modeling were mutated to alanine to probe their contributions to enzyme activity. The wild-type and mutant AFMIDs were expressed as amino terminal 6£ His-tagged recombinant proteins to facilitate puriWcation. Three chromatography steps isolated highly puriWed proteins for enzyme activity comparisons. Expressed AFMID showed high activity, 42 § 1 mol/min/mg protein, for its natural substrate, N-formyl-L-kynurenine. The same Km (0.18–0.19 mM) was observed for expressed and native cytosolic AFMID. The single mutants (S162A, D247A, and H279A) lost essentially all (>99%) activity. The predicted catalytic triad of S162, D247, and H279 is therefore conWrmed by site-directed mutagenesis. 2005 Elsevier Inc. All rights reserved. Keywords: Arylformamidase; Catalytic triad; Kynurenine formamidase; Site-directed mutagenesis
Arylformamidase (AFMID)1 (EC 3.5.1.9), previously known as kynurenine formamidase, catalyzes the hydrolysis of N-formyl-L-kynurenine (NFK) to L-kynurenine, the second step in the pathway for conversion of tryptophan to nicotinic acid, NAD(H) and NADP(H) [1]. Inhibition of AFMID in developing chicken embryos by organophosphorus insecticides leads to low NAD(H) levels and severe teratogenesis [2–4]. The primary sequence of this protein is established by translation of a
*
Corresponding author. Fax: +1 510 642 6497. E-mail address: [email protected] (J.E. Casida). 1 Abbreviations used: AFMID, arylformamidase; NFK, N-formylL -kynurenine; PCR, polymerase chain reaction; Ni–NTA, nickel–nitrilotriacetic acid; SFNiNTA, superXow aYnity resin; QSFF, Q Sepharose Fast Flow; SDX200, Superdex 200; IPTG, isopropyl thiogalactopyranoside. 1046-5928/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.04.013
full-length cDNA obtained from PCR ampliWcation of a mouse liver library using gene speciWc primers [5]. An / -hydrolase fold [6] is suggested for AFMID based on its primary sequence and predicted secondary structure [5]. A three-dimensional model based on the structures of homologous proteins implicates Ser162, Asp247, and His279 as the active site triad [5]. This work describes the conWrmation of the active site residues for AFMID through cloning and expression of wild-type and site-speciWc mutants. Previously identiWed amino acids [5] are changed to alanine to remove chemically reactive side chains while substituting with a generally structure-preserving residue. The recombinant enzymes are expressed as amino terminal 6£ His-tagged recombinant proteins to facilitate puriWcation from Escherichia coli. Three puriWcation steps were used to obtain high purity proteins allowing
40
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
comparison of enzymatic activity among wild-type and mutants demonstrating the role of the active site residues.
determinations [7] used Bio-Rad Microplate Protein Assay with bovine serum albumin as the standard. SDS–PAGE
Materials and methods Chemicals and reagents Sources for chemicals and reagents were as follows: NFK as previously reported [5]; L-kynurenine, monoclonal antibody anti-polyhistidine clone his-1, and 5-bromo-4-chloro-3-indolyl phosphate–nitro blue tetrazolium liquid substrate system from Sigma (St. Louis, MO); polymerase chain reaction (PCR) and sequencing primers from Operon Technologies (Alameda, CA); mouse liver Marathon–Ready cDNA library and Advantage 2 PCR Kit from Clontech (Palo Alto, CA); HotStarTaq DNA Polymerase, HotStarTaq Master Mix Kit, QIAquick Gel Extraction Spin Kit, QIAprep Miniprep Spin Kit, and nickel– nitrilotriacetic acid (Ni–NTA) superXow aYnity resin (SFNiNTA) from Qiagen (Valencia, CA); Q Sepharose Fast Flow (QSFF) and Superdex 200 (SDX200) chromatography resins from Amersham Pharmacia Biotech (Piscataway, NJ); restriction enzymes NcoI and PstI, pProEX HT Prokaryotic Expression System and MAX EYciency DH10B Competent Cells from Life Technologies (Invitrogen, Carlsbad, CA); T4 DNA Ligase from Promega (Madison, WI); QuikChange MultiSite-Directed Mutagenesis Kit, XL10-GOLD and BL21 Gold Ultracompetent Cells from Stratagene (La Jolla, CA); molecular weight markers and silver stain plus kit from Bio-Rad (Richmond, CA). Activity assays SpeciWc activities were determined in triplicate using 0.45 mM NFK in 50 mM sodium phosphate, pH 7.4, buVer (220 l) and varying the protein level. Reactions were monitored for 90 s as the increase of absorbance at 365 nm resulting from liberation of L-kynurenine in 96well Xat-bottomed plates using Molecular Devices (Sunnyvale, CA) Versamax Kinetic Microplate Reader and linear regression with SOFTmax v. 4.0 data analysis software. Absorbance values were converted to mol using a standard curve for kynurenine in 220 l phosphate buVer. Km determinations were also in triplicate on native AFMID, i.e., mouse cytosol prepared as previously described [5], and puriWed AFMID varying substrate concentrations from 0.01 to 5 mM with constant enzyme level measuring rates over 5 min. Data analysis for Km experiments used Lineweaver–Burk transformation performed with the Michaelis–Menten Protocol (SOFTmax v. 4.0 data analysis software). Protein
SDS–PAGE was performed in 12% Tris–glycine gels with staining by Coomassie brilliant blue as previously stated [5]. PCR ampliWcation and vector construction A cDNA fragment containing the entire coding region for AFMID was ampliWed from the mouse liver cDNA library by end-to-end PCR using gene speciWc primer MKP4: GATCTGGCCATGGCGTTTCCTT CCCT and library speciWc primer AP1 with the Advantage 2 PCR Kit. Thermal cycler conditions were: (1) 94 °C for 30 s; (2) Wve cycles of 94 °C for 5 s, 72 °C for 3 min; (3) Wve cycles of 94 °C for 5 s, 70 °C for 3 min; (4) 25 cycles of 94 °C for 5 s, 65 °C for 30 s, 68 °C for 3 min. Subsequent ampliWcations of the fragment of interest were performed using the same primers but with the HotStarTaq DNA Polymerase and Master Mix Kit. Thermal cycler conditions were modiWed as follows: (1) 95 °C for 15 min; (2) Wve cycles of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 2 min; (3) Wve cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 2 min; (4) 25 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 10 min. AmpliWed DNA was gel puriWed and recovered with the Gel Extraction Spin Kit prior to restriction and ligation reactions. The ampliWed AFMID cDNA fragment and expression vector, pProEX HTb, were double digested with NcoI and PstI, per manufacturer protocols, to generate linear DNA with sticky ends. The digested insert and vector DNA were gel puriWed, recovered, and quantiWed prior to ligation. The Wnal vector was designed such that ligation of the NcoI restricted insert and vector fragments maintained the AFMID start codon as an internal methionine, with only the 25 amino acid residue tag added to the N-terminus. As well the vector was constructed to incorporate the native stop codon by utilizing the unique PstI site located 161 nucleotides downstream. The ligation reaction contained 2 g of the 1100 bp insert and 2.6 g of the 4700 bp vector (3:1 insert/vector ratio based on MW). Reaction products were gel puriWed on 0.75% agarose at 75 V for 1 h. DNA sequencing and analysis Sequencing of plasmids and PCR fragments was performed by the University of California Berkeley DNA sequencing facility. Data were analyzed and edited using Chromas v. 1.62 (Technelysium, Helensvale, Australia). Sequences were aligned and compared with GeneDoc
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
Multiple Sequence Alignment and Shading Utility v. 2.6.001 [8]. Expression The recombinant plasmid coding for 6£ His-tagged AFMID was used to transform DH10B competent cells per manufacturer protocol. Approximately 20 ng AFMID DNA was used while 5 ng of 6£ His-tagged chloramphenicol transferase DNA or 50 pg pUC19 DNA served as controls. Reaction mixtures were plated (100 l of 1:100 dilution) on LB/amp agar plates and incubated overnight at 37 °C. Colonies were selected and used to inoculate 2 ml cultures grown overnight at 37 °C in Luria’s broth and then stored as glycerol stocks. Plasmid DNA was prepared using the Miniprep Spin Kit from 10 ml cultures propagated from primary stocks. Plasmid DNA was sequenced using the M13/pUC reverse 23-base sequencing primer (AGCGGATAACAATTTCACA CAGG) to analyze the vector/insert junction and MKP CS2 (TCAC ACCCAACCTCCAAGG) for the complete insert sequence. The prokaryotic expression system vector also incorporated the lac promoter to increase levels of recombinant protein upon treatment with isopropyl thiogalactopyranoside (IPTG). Colonies found with correct insert were grown as IPTG-induced cultures for recovery of expressed protein at 0, 1, 2, and 3 h. Expressed 6£ His-tagged protein was recovered from cleared E. coli lysates by batch-puriWcation using Ni– NTA superXow aYnity resin. Samples were loaded in 50 mM sodium phosphate, 300 mM sodium chloride, 5 mM mercaptoethanol, 10% glycerol, and 10 mM imidazole, pH 8.0. Wash and elution buVers were the same as above with 40 and 250 mM imidazole, respectively. The recovered protein was quantitated and analyzed for purity by SDS–PAGE and AFMID activity as previously stated. Site-directed mutagenesis Site-speciWc mutants of AFMID were generated by PCR using the MultiSite-Directed Mutagenesis Kit. Mutant single stranded plasmids were obtained using the parental AFMID template with primers containing altered nucleotides. Codons of interest were changed to alanine (GCG). The 5⬘ phosphorylated [P] primers were puriWed using reversed phase HPLC on an Ultremex 4.6 mm £ 25 cm C18 column with mobile phase buVers [A] D 95% triethylamine acetate, pH 7.0, 5% acetonitrile and [B] D 50% triethylamine acetate, pH 7.0, 50% acetonitrile using a gradient of 0–100% [B] over 20 min with detection by OD 260 nm. PuriWcation fractions were pooled and dried in a Savant Speed Vac (Savant Instruments, Farmingdale, NY). Primer sequences are:
41
S162A/CS [P]TCTGCGGACACGCGGCGGGAGCT CACC D247A/CS [P]GCTGGTGCTTGTGGGTCAGCATG CGTCCCCAGAGTTCC H279A/CS [P]CTGCGTGGTGTGGATGCGTTTGA CATCATAGAGAATCTGACCCG Thermal cycler conditions for the PCR mutagenesis reactions were (1) 95 °C for 1 min and (2) 30 cycles of 95 °C for 1 min, 55 °C for 1 min, 65 °C for 12 min. The methylated parental DNA was removed from the reactions by DpnI digestion prior to transformation of E. coli. XL10-Gold Ultracompetent Cell transformations with mutant and wild-type plasmids were plated on LB/ampicillin/agar with subsequent colonies cultured in NZY+ with ampicillin at 37 °C. Expressed wild-type and mutant plasmids, recovered and analyzed as previously stated, were sub-cloned into BL21 Gold Ultracompetent cells for large-scale cultures. Protein for activity experiments was produced in 1.8 L cultures induced with 1 mM IPTG for 4 h. Crude supernatants were recovered by centrifugation from cell pellets treated with 1 mg/ml lysozyme for 1 h at 4 °C and then sonicated 3£ for 20 s with 20 s intervals between bursts. Protein puriWcation and enzyme activity assays Anion exchange, gel Wltration, and aYnity chromatography were used to generate high purity proteins in three steps. Anion exchange chromatography was performed by FPLC (APB Biotech, Piscataway, NJ) with a QSFF 1.6 £ 10.5 cm column monitoring 280 nm. Samples were loaded onto the column in 20 mM Tris–HCl, pH 8, and eluted with the same buVer containing 1 M NaCl using a gradient from 0 to 0.6 M NaCl over 120 min with a Xow rate of 2 ml/min collecting 4 ml fractions. Pooled fractions were precipitated using 80% ammonium sulfate. Pellets were resuspended in 50 mM sodium phosphate, 300 mM sodium chloride, 5 mM mercaptoethanol, 10% glycerol, and 10 mM imidazole, pH 8.0, and gel Wltered on a SDX200 2.6 £ 62.5 cm column at 1 ml/min. Gel Wltration fractions were pooled and aYnity chromatography was carried out using SFNiNTA resin as previously stated. Eluted fractions were concentrated with Amicon Ultra-10 (Millipore, Bedford, MA) and the buVer was exchanged to 50 mM sodium phosphate, pH 7.4. PuriWcation pools were identiWed by analyzing fractions for activity or for 6£ His-tag. Activity was monitored using 10 l fraction samples diluted and assayed as previously described. Detection of 6£ His-tag was performed using monoclonal antibody anti-polyhistidine clone his-1 alkaline phosphatase conjugate. Fractions (5 l) were blotted onto nitrocellulose and the membranes were blocked with 2% bovine serum albumin with washes using
42
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
0.05% Tween 20 in phosphate-buVered saline. The membrane was probed with antibody conjugate, washed, and visualized using the 5-bromo-4-chloro-3indolyl phosphate–nitro blue tetrazolium liquid substrate system. Recovered proteins were quantitated and analyzed for purity by SDS–PAGE. PuriWed proteins were stored at ¡20 °C.
mately 1100 bp while the same treatment of the vector produced the expected fragment of approximately 5000 bp. The ligation reaction showed several products upon gel puriWcation, with an approximately 6000 bp recombinant plasmid containing directionally cloned AFMID cDNA, which was recovered and quantitated prior to E. coli transformation. Expression
Results PCR ampliWcation and vector construction End-to-end PCR ampliWcation of AFMID cDNA from a mouse liver library resulted in one product band of approximately 1400 bp by gel analysis (data not shown). Restriction of the gel puriWed fragment with the enzymes NcoI and PstI resulted in a band of approxi-
Transformation of DH10B competent cells using control plasmids was successful with 6£ His-tagged chloramphenicol transferase and pUC19, showing eYciencies of 1.2 £ 108 and 8.2 £ 108 colony forming units/g, respectively. Despite the lower eYciency seen with the AFMID plasmid of 5 £ 105 colony forming units/g, colonies were obtained expressing the experimental plasmid. Clear induction of AFMID was evident upon treatment of cultures with 1 mM IPTG (Fig. 1). The eluted fraction from Ni–NTA aYnity puriWcation showed a strong induced band (Fig. 1) with greatly enhanced speciWc activity over the crude supernatant (data not shown). Plasmids sequenced from active cultures revealed a T to C point mutation at bp 372 altering codon 370–372 from AGT to AGC, resulting in a silent mutation causing no change to the primary amino acid sequence of AFMID. Site-directed mutagenesis and puriWcation
Fig. 1. Induction and aYnity puriWcation of AFMID. Induction (1 mM IPTG) time point pellets were resuspended to generate samples with equivalent OD/ml values at 590 nm. Samples were heated to 90 °C for 2 min in Laemmli sample buVer and run on 12% Tris–glycine SDS– PAGE. Lanes were loaded as follows: 20 l at 10 OD590/ml for time points, 100 g crude supernatant protein, 10 g AFMID protein in Ni– NTA puriWcation pool. Western blotting with anti-6£ His-tag antibody conWrmed the presence of recombinant AFMID in each case (data not shown). The pure AFMID protein band appears to migrate a little faster than the corresponding band in the other lanes perhaps because of the diVerent sample preparation procedures (see Materials and methods).
Mutant primers were puriWed to >99% by HPLC. PCR mutagenesis reactions using one, two or three primers yielded transformants producing single, double or triple mutants. Colony screening by plasmid sequence analysis identiWed all the potential mutant combinations except the S162A, H279A double mutant. Analysis of the threestep puriWed AFMID wild-type and mutant S162A by SDS–PAGE showed recovery of relatively high purity proteins (Table 1, Fig. 2); similar results were also obtained for the other mutants. Michaelis–Menten parameters for native AFMID were Km D 0.18 § 0.02 mM, r2 D 0.99, Vmax D 53 § 4 mM/min, and for expressed 0.19 § 0.01 mM, r2 D 0.99, Vmax D 60 § 1 mM/min. The expressed proteins were assayed for NFK hydrolysis with the wild-type displaying strong activity (42 § 1 mol/min/ mg, n D 3) while the mutants lost essentially all (>99%) of their activity (Table 2). Mutant and wild-type samples showed similar puriWcation proWles.
Table 1 PuriWcation of 6£ His-tagged AFMID from cleared E. coli lysate PuriWcation step
Total protein (mg)
Total activity (mol/min)
SpeciWc activity (mol/min/mg)
PuriWcation (fold)
Yield (%)
Lysate QSFF SDX200 SFNiNTA
255 22 8.9 0.28
120 103 58 12
0.47 4.7 6.5 42
1 10 14 90
100 86 48 10
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
43
nucleotide and/or protein level in Wve species; Saccharomyces cerevisiae, Polaribacter Wlamentus, Gemmata sp. Wal-1, Drosophila melanogaster, and Mus musculus with six protein and ten nucleotide sequences found for AFMID using the National Center for Biotechnology Information Entrez search engine. A search of genomes identiWed genes in S. cerevisiae, M. musculus, and Homo sapiens. The 6£ His-tag facilitated AFMID isolation while not appearing to aVect enzyme activity based on Km and Vmax comparisons of the native and expressed wild-type. Initial expression produced extracts with signiWcant AFMID activity. While a single batchpuriWcation was suitable for conWrmation of protein expression and induction, large-scale cultures required further puriWcation. A three-step procedure using anion exchange (QSFF), gel Wltration (SDX200), and aYnity chromatography (SFNiNTA) generated high purity proteins for enzyme activity comparisons. Site-directed mutagenesis of catalytic triad residues
Fig. 2. SDS–PAGE analysis and comparative activity of three-step puriWed AFMID. (A) Representative samples of wild-type and S162A illustrate the purity of recovered proteins. The other mutants produced similar results. (B) Comparative assay demonstrates the linearity of data (r2 D 0.99) for the wild-type during the time frame measured, the speciWc activity of the wild-type, and the loss of activity for the S162A mutant.
Discussion Cloning, expression, mutation, and puriWcation The novel protein identiWed from cDNA sequence AF399717 was conWrmed as AFMID by successful cloning and expression in E. coli of enzyme with high activity for hydrolyzing NFK. This is the Wrst AFMID from any species to be cloned, sequenced, and functionally expressed. AFMID has been characterized at the
Table 2 SpeciWc activity of recombinant 6£ His-tagged AFMID and sitespeciWc mutants AFMID
SpeciWc activity (mol/min/mg)
Wild-type Mutants S162A D247A H279A D247A, H279A S162A, D247A, H279A
r
2
Loss of activity (%)
42 § 1
1.00 § 0.00
0
0.26 § 0.05 0.15 § 0.01 0.08 § 0.21 0.01 § 0.01 0.08 § 0.08
0.87 § 0.09 0.17 § 0.21 0.12 § 0.18 0.45 § 0.37 0.74 § 0.15
>99 >99 >99 >99 >99
Site-directed mutagenesis was carried out to probe the contribution of residues identiWed through homology modeling as the proposed catalytic triad, resulting in the point mutants S162A, D247A, and H279A. The active site serine in the sequence motif GXSXG [9] was conWrmed by the site-speciWc mutant S162A losing >99% enzymatic activity as an expressed protein. The remaining two residues, D247 and H279, were the least certain of the triad, being identiWed solely by the homology model. These two mutants also showed >99% loss of enzyme activity toward NFK supporting the modeled catalytic site. All other double and triple mutants tested had no enzymatic activity. Though the eVect of these point mutations on overall structure has not been adequately deWned, preliminary circular dichroism experiments show similar spectra for wildtype and triple mutant AFMIDs containing signiWcant secondary structural characteristics (data not shown). While supportive of minimal structural change, these preliminary results are not deWnitive and a complete set of CD data is not available at this time. The loss of catalytic activity upon substituting alanine for Ser162, Asp247, and His279, therefore, supports their assignment as active site residues and the catalytic triad of AFMID. Physiological and toxicological relevance There are six serine hydrolases of current interest in considering organophosphate toxicology, i.e., acetylcholinesterase, butyrylcholinesterase, neuropathy target esterase-lysophospholipase, fatty acid amide hydrolase, acylpeptide hydrolase, and AFMID [10]. Afmid gene
44
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
inactivation in mice [11,12] results in a profound imbalance of metabolites of the kynurenine pathway of tryptophan degradation, which may explain the kidney deterioration and abnormal immune system [13]. The present Wndings on AFMID expression and veriWcation of the catalytic triad are important steps in deWning the key role of this serine hydrolase in tryptophan and kynurenine metabolism.
Acknowledgments The project described was supported by Grant ES08762 from the National Institute of Environmental Health Sciences (NIEHS), NIH. Its contents are solely the responsibility of the authors and do not represent the oYcial views of NIEHS, NIH.
References [1] D. Voet, J.G. Voet, in: Amino Acid Metabolism, Biochemistry, 2nd ed., Wiley, New York, 1995, pp. 744–746 (Chapter 24). [2] N.H. Proctor, A.D. Moscioni, J.E. Casida, Chicken embryo NAD levels lowered by teratogenic organophosphorus and methylcarbamate insecticides, Biochem. Pharmacol. 25 (1976) 757–762. [3] A.D. Moscioni, J.L. Engel, J.E. Casida, Kynurenine formamidase inhibition as a possible mechanism for certain teratogenic eVects of organophosphorus and methylcarbamate insecticides in chicken embryos, Biochem. Pharmacol. 26 (1977) 2251–2258.
[4] J. Seifert, J.E. Casida, Mechanisms of teratogenesis induced by organophosphorus and methylcarbamate insecticides, in: D.H. Huston, T.R. Roberts (Eds.), Progress in Pesticide Biochemistry, vol. 1, Wiley, New York, 1981, pp. 219–246. [5] M.K. Pabarcus, J.E. Casida, Kynurenine formamidase: determination of primary structure and modeling-based prediction of tertiary structure and catalytic triad, Biochim. Biophys. Acta 1596 (2002) 201–211. [6] D.L. Ollis, E. Cheah, M. Cygler, B. Dijkstra, F. Frolow, S.M. Franken, M. Harel, S.J. Remington, I. Silman, J. Schrag, J.L. Sussman, K.H.G. Verschueren, A. Goldman, The / hydrolase fold, Protein Engineering 5 (1992) 197–211. [7] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [8] K.B. Nicholas, H.B.J. Nicholas, D.W. DeerWeld II, GeneDoc: analysis and visualization of genetic variation, Distributed by the author at www.psc.edu/biomed/genedoc, 1997. [9] S. Brenner, The molecular evolution of genes and proteins: a tale of two serines, Nature 334 (1988) 528–530. [10] J.E. Casida, G.B. Quistad, Organophosphate toxicology: safety aspects of nonacetylcholinesterase secondary targets, Chem. Res. Toxicol. 17 (2004) 983–998. [11] V.N. Dobrovolsky, T. Bucci, R.H. HeXich, J. Desjardins, F.C. Richardson, Mice deWcient for cytosolic thymidine kinase gene develop fatal kidney disease, Mol. Genet. Metab. 78 (2003) 1–10. [12] B. Schuettengruber, A. Doetzlhofer, K. Kroboth, E. Wintersberger, C. Seiser, Alternate activation of two divergently transcribed mouse genes from a bidirectional promoter is linked to changes in histone modiWcation, J. Biol. Chem. 278 (2003) 1784–1793. [13] V.N. Dobrovolsky, J.F. Bowyer, M.K. Pabarcus, R.H. HeXich, L.D. Williams, D.R. Doerge, B. Arvidsson, J. Bergquist, J.E. Casida, EVect of arylformamidase (kynurenine formamidase) gene inactivation in mice on enzymatic activity, kynurenine pathway metabolites and phenotype, Biochim. Biophys. Acta (2005), in press.
Cloning, expression, and catalytic triad of recombinant arylformamidase Michael K. Pabarcus, John E. Casida ¤ Environmental Chemistry and Toxicology Laboratory, Department of Environmental Science, Policy and Management, University of California, Berkeley, CA 94720-3112, USA Received 25 February 2005, and in revised form 13 April 2005 Available online 13 May 2005
Abstract Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is correlated with lowered NAD levels and severe teratogenesis. The cDNA sequence previously identiWed for mouse liver AFMID (AF399717) (MW 34229) was cloned and expressed in Escherichia coli. Residues identiWed as potential catalytic triad members (S162, D247, and H279) through sequence motif and homology modeling were mutated to alanine to probe their contributions to enzyme activity. The wild-type and mutant AFMIDs were expressed as amino terminal 6£ His-tagged recombinant proteins to facilitate puriWcation. Three chromatography steps isolated highly puriWed proteins for enzyme activity comparisons. Expressed AFMID showed high activity, 42 § 1 mol/min/mg protein, for its natural substrate, N-formyl-L-kynurenine. The same Km (0.18–0.19 mM) was observed for expressed and native cytosolic AFMID. The single mutants (S162A, D247A, and H279A) lost essentially all (>99%) activity. The predicted catalytic triad of S162, D247, and H279 is therefore conWrmed by site-directed mutagenesis. 2005 Elsevier Inc. All rights reserved. Keywords: Arylformamidase; Catalytic triad; Kynurenine formamidase; Site-directed mutagenesis
Arylformamidase (AFMID)1 (EC 3.5.1.9), previously known as kynurenine formamidase, catalyzes the hydrolysis of N-formyl-L-kynurenine (NFK) to L-kynurenine, the second step in the pathway for conversion of tryptophan to nicotinic acid, NAD(H) and NADP(H) [1]. Inhibition of AFMID in developing chicken embryos by organophosphorus insecticides leads to low NAD(H) levels and severe teratogenesis [2–4]. The primary sequence of this protein is established by translation of a
*
Corresponding author. Fax: +1 510 642 6497. E-mail address: [email protected] (J.E. Casida). 1 Abbreviations used: AFMID, arylformamidase; NFK, N-formylL -kynurenine; PCR, polymerase chain reaction; Ni–NTA, nickel–nitrilotriacetic acid; SFNiNTA, superXow aYnity resin; QSFF, Q Sepharose Fast Flow; SDX200, Superdex 200; IPTG, isopropyl thiogalactopyranoside. 1046-5928/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.04.013
full-length cDNA obtained from PCR ampliWcation of a mouse liver library using gene speciWc primers [5]. An / -hydrolase fold [6] is suggested for AFMID based on its primary sequence and predicted secondary structure [5]. A three-dimensional model based on the structures of homologous proteins implicates Ser162, Asp247, and His279 as the active site triad [5]. This work describes the conWrmation of the active site residues for AFMID through cloning and expression of wild-type and site-speciWc mutants. Previously identiWed amino acids [5] are changed to alanine to remove chemically reactive side chains while substituting with a generally structure-preserving residue. The recombinant enzymes are expressed as amino terminal 6£ His-tagged recombinant proteins to facilitate puriWcation from Escherichia coli. Three puriWcation steps were used to obtain high purity proteins allowing
40
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
comparison of enzymatic activity among wild-type and mutants demonstrating the role of the active site residues.
determinations [7] used Bio-Rad Microplate Protein Assay with bovine serum albumin as the standard. SDS–PAGE
Materials and methods Chemicals and reagents Sources for chemicals and reagents were as follows: NFK as previously reported [5]; L-kynurenine, monoclonal antibody anti-polyhistidine clone his-1, and 5-bromo-4-chloro-3-indolyl phosphate–nitro blue tetrazolium liquid substrate system from Sigma (St. Louis, MO); polymerase chain reaction (PCR) and sequencing primers from Operon Technologies (Alameda, CA); mouse liver Marathon–Ready cDNA library and Advantage 2 PCR Kit from Clontech (Palo Alto, CA); HotStarTaq DNA Polymerase, HotStarTaq Master Mix Kit, QIAquick Gel Extraction Spin Kit, QIAprep Miniprep Spin Kit, and nickel– nitrilotriacetic acid (Ni–NTA) superXow aYnity resin (SFNiNTA) from Qiagen (Valencia, CA); Q Sepharose Fast Flow (QSFF) and Superdex 200 (SDX200) chromatography resins from Amersham Pharmacia Biotech (Piscataway, NJ); restriction enzymes NcoI and PstI, pProEX HT Prokaryotic Expression System and MAX EYciency DH10B Competent Cells from Life Technologies (Invitrogen, Carlsbad, CA); T4 DNA Ligase from Promega (Madison, WI); QuikChange MultiSite-Directed Mutagenesis Kit, XL10-GOLD and BL21 Gold Ultracompetent Cells from Stratagene (La Jolla, CA); molecular weight markers and silver stain plus kit from Bio-Rad (Richmond, CA). Activity assays SpeciWc activities were determined in triplicate using 0.45 mM NFK in 50 mM sodium phosphate, pH 7.4, buVer (220 l) and varying the protein level. Reactions were monitored for 90 s as the increase of absorbance at 365 nm resulting from liberation of L-kynurenine in 96well Xat-bottomed plates using Molecular Devices (Sunnyvale, CA) Versamax Kinetic Microplate Reader and linear regression with SOFTmax v. 4.0 data analysis software. Absorbance values were converted to mol using a standard curve for kynurenine in 220 l phosphate buVer. Km determinations were also in triplicate on native AFMID, i.e., mouse cytosol prepared as previously described [5], and puriWed AFMID varying substrate concentrations from 0.01 to 5 mM with constant enzyme level measuring rates over 5 min. Data analysis for Km experiments used Lineweaver–Burk transformation performed with the Michaelis–Menten Protocol (SOFTmax v. 4.0 data analysis software). Protein
SDS–PAGE was performed in 12% Tris–glycine gels with staining by Coomassie brilliant blue as previously stated [5]. PCR ampliWcation and vector construction A cDNA fragment containing the entire coding region for AFMID was ampliWed from the mouse liver cDNA library by end-to-end PCR using gene speciWc primer MKP4: GATCTGGCCATGGCGTTTCCTT CCCT and library speciWc primer AP1 with the Advantage 2 PCR Kit. Thermal cycler conditions were: (1) 94 °C for 30 s; (2) Wve cycles of 94 °C for 5 s, 72 °C for 3 min; (3) Wve cycles of 94 °C for 5 s, 70 °C for 3 min; (4) 25 cycles of 94 °C for 5 s, 65 °C for 30 s, 68 °C for 3 min. Subsequent ampliWcations of the fragment of interest were performed using the same primers but with the HotStarTaq DNA Polymerase and Master Mix Kit. Thermal cycler conditions were modiWed as follows: (1) 95 °C for 15 min; (2) Wve cycles of 94 °C for 30 s, 65 °C for 30 s, 72 °C for 2 min; (3) Wve cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 2 min; (4) 25 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 10 min. AmpliWed DNA was gel puriWed and recovered with the Gel Extraction Spin Kit prior to restriction and ligation reactions. The ampliWed AFMID cDNA fragment and expression vector, pProEX HTb, were double digested with NcoI and PstI, per manufacturer protocols, to generate linear DNA with sticky ends. The digested insert and vector DNA were gel puriWed, recovered, and quantiWed prior to ligation. The Wnal vector was designed such that ligation of the NcoI restricted insert and vector fragments maintained the AFMID start codon as an internal methionine, with only the 25 amino acid residue tag added to the N-terminus. As well the vector was constructed to incorporate the native stop codon by utilizing the unique PstI site located 161 nucleotides downstream. The ligation reaction contained 2 g of the 1100 bp insert and 2.6 g of the 4700 bp vector (3:1 insert/vector ratio based on MW). Reaction products were gel puriWed on 0.75% agarose at 75 V for 1 h. DNA sequencing and analysis Sequencing of plasmids and PCR fragments was performed by the University of California Berkeley DNA sequencing facility. Data were analyzed and edited using Chromas v. 1.62 (Technelysium, Helensvale, Australia). Sequences were aligned and compared with GeneDoc
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
Multiple Sequence Alignment and Shading Utility v. 2.6.001 [8]. Expression The recombinant plasmid coding for 6£ His-tagged AFMID was used to transform DH10B competent cells per manufacturer protocol. Approximately 20 ng AFMID DNA was used while 5 ng of 6£ His-tagged chloramphenicol transferase DNA or 50 pg pUC19 DNA served as controls. Reaction mixtures were plated (100 l of 1:100 dilution) on LB/amp agar plates and incubated overnight at 37 °C. Colonies were selected and used to inoculate 2 ml cultures grown overnight at 37 °C in Luria’s broth and then stored as glycerol stocks. Plasmid DNA was prepared using the Miniprep Spin Kit from 10 ml cultures propagated from primary stocks. Plasmid DNA was sequenced using the M13/pUC reverse 23-base sequencing primer (AGCGGATAACAATTTCACA CAGG) to analyze the vector/insert junction and MKP CS2 (TCAC ACCCAACCTCCAAGG) for the complete insert sequence. The prokaryotic expression system vector also incorporated the lac promoter to increase levels of recombinant protein upon treatment with isopropyl thiogalactopyranoside (IPTG). Colonies found with correct insert were grown as IPTG-induced cultures for recovery of expressed protein at 0, 1, 2, and 3 h. Expressed 6£ His-tagged protein was recovered from cleared E. coli lysates by batch-puriWcation using Ni– NTA superXow aYnity resin. Samples were loaded in 50 mM sodium phosphate, 300 mM sodium chloride, 5 mM mercaptoethanol, 10% glycerol, and 10 mM imidazole, pH 8.0. Wash and elution buVers were the same as above with 40 and 250 mM imidazole, respectively. The recovered protein was quantitated and analyzed for purity by SDS–PAGE and AFMID activity as previously stated. Site-directed mutagenesis Site-speciWc mutants of AFMID were generated by PCR using the MultiSite-Directed Mutagenesis Kit. Mutant single stranded plasmids were obtained using the parental AFMID template with primers containing altered nucleotides. Codons of interest were changed to alanine (GCG). The 5⬘ phosphorylated [P] primers were puriWed using reversed phase HPLC on an Ultremex 4.6 mm £ 25 cm C18 column with mobile phase buVers [A] D 95% triethylamine acetate, pH 7.0, 5% acetonitrile and [B] D 50% triethylamine acetate, pH 7.0, 50% acetonitrile using a gradient of 0–100% [B] over 20 min with detection by OD 260 nm. PuriWcation fractions were pooled and dried in a Savant Speed Vac (Savant Instruments, Farmingdale, NY). Primer sequences are:
41
S162A/CS [P]TCTGCGGACACGCGGCGGGAGCT CACC D247A/CS [P]GCTGGTGCTTGTGGGTCAGCATG CGTCCCCAGAGTTCC H279A/CS [P]CTGCGTGGTGTGGATGCGTTTGA CATCATAGAGAATCTGACCCG Thermal cycler conditions for the PCR mutagenesis reactions were (1) 95 °C for 1 min and (2) 30 cycles of 95 °C for 1 min, 55 °C for 1 min, 65 °C for 12 min. The methylated parental DNA was removed from the reactions by DpnI digestion prior to transformation of E. coli. XL10-Gold Ultracompetent Cell transformations with mutant and wild-type plasmids were plated on LB/ampicillin/agar with subsequent colonies cultured in NZY+ with ampicillin at 37 °C. Expressed wild-type and mutant plasmids, recovered and analyzed as previously stated, were sub-cloned into BL21 Gold Ultracompetent cells for large-scale cultures. Protein for activity experiments was produced in 1.8 L cultures induced with 1 mM IPTG for 4 h. Crude supernatants were recovered by centrifugation from cell pellets treated with 1 mg/ml lysozyme for 1 h at 4 °C and then sonicated 3£ for 20 s with 20 s intervals between bursts. Protein puriWcation and enzyme activity assays Anion exchange, gel Wltration, and aYnity chromatography were used to generate high purity proteins in three steps. Anion exchange chromatography was performed by FPLC (APB Biotech, Piscataway, NJ) with a QSFF 1.6 £ 10.5 cm column monitoring 280 nm. Samples were loaded onto the column in 20 mM Tris–HCl, pH 8, and eluted with the same buVer containing 1 M NaCl using a gradient from 0 to 0.6 M NaCl over 120 min with a Xow rate of 2 ml/min collecting 4 ml fractions. Pooled fractions were precipitated using 80% ammonium sulfate. Pellets were resuspended in 50 mM sodium phosphate, 300 mM sodium chloride, 5 mM mercaptoethanol, 10% glycerol, and 10 mM imidazole, pH 8.0, and gel Wltered on a SDX200 2.6 £ 62.5 cm column at 1 ml/min. Gel Wltration fractions were pooled and aYnity chromatography was carried out using SFNiNTA resin as previously stated. Eluted fractions were concentrated with Amicon Ultra-10 (Millipore, Bedford, MA) and the buVer was exchanged to 50 mM sodium phosphate, pH 7.4. PuriWcation pools were identiWed by analyzing fractions for activity or for 6£ His-tag. Activity was monitored using 10 l fraction samples diluted and assayed as previously described. Detection of 6£ His-tag was performed using monoclonal antibody anti-polyhistidine clone his-1 alkaline phosphatase conjugate. Fractions (5 l) were blotted onto nitrocellulose and the membranes were blocked with 2% bovine serum albumin with washes using
42
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
0.05% Tween 20 in phosphate-buVered saline. The membrane was probed with antibody conjugate, washed, and visualized using the 5-bromo-4-chloro-3indolyl phosphate–nitro blue tetrazolium liquid substrate system. Recovered proteins were quantitated and analyzed for purity by SDS–PAGE. PuriWed proteins were stored at ¡20 °C.
mately 1100 bp while the same treatment of the vector produced the expected fragment of approximately 5000 bp. The ligation reaction showed several products upon gel puriWcation, with an approximately 6000 bp recombinant plasmid containing directionally cloned AFMID cDNA, which was recovered and quantitated prior to E. coli transformation. Expression
Results PCR ampliWcation and vector construction End-to-end PCR ampliWcation of AFMID cDNA from a mouse liver library resulted in one product band of approximately 1400 bp by gel analysis (data not shown). Restriction of the gel puriWed fragment with the enzymes NcoI and PstI resulted in a band of approxi-
Transformation of DH10B competent cells using control plasmids was successful with 6£ His-tagged chloramphenicol transferase and pUC19, showing eYciencies of 1.2 £ 108 and 8.2 £ 108 colony forming units/g, respectively. Despite the lower eYciency seen with the AFMID plasmid of 5 £ 105 colony forming units/g, colonies were obtained expressing the experimental plasmid. Clear induction of AFMID was evident upon treatment of cultures with 1 mM IPTG (Fig. 1). The eluted fraction from Ni–NTA aYnity puriWcation showed a strong induced band (Fig. 1) with greatly enhanced speciWc activity over the crude supernatant (data not shown). Plasmids sequenced from active cultures revealed a T to C point mutation at bp 372 altering codon 370–372 from AGT to AGC, resulting in a silent mutation causing no change to the primary amino acid sequence of AFMID. Site-directed mutagenesis and puriWcation
Fig. 1. Induction and aYnity puriWcation of AFMID. Induction (1 mM IPTG) time point pellets were resuspended to generate samples with equivalent OD/ml values at 590 nm. Samples were heated to 90 °C for 2 min in Laemmli sample buVer and run on 12% Tris–glycine SDS– PAGE. Lanes were loaded as follows: 20 l at 10 OD590/ml for time points, 100 g crude supernatant protein, 10 g AFMID protein in Ni– NTA puriWcation pool. Western blotting with anti-6£ His-tag antibody conWrmed the presence of recombinant AFMID in each case (data not shown). The pure AFMID protein band appears to migrate a little faster than the corresponding band in the other lanes perhaps because of the diVerent sample preparation procedures (see Materials and methods).
Mutant primers were puriWed to >99% by HPLC. PCR mutagenesis reactions using one, two or three primers yielded transformants producing single, double or triple mutants. Colony screening by plasmid sequence analysis identiWed all the potential mutant combinations except the S162A, H279A double mutant. Analysis of the threestep puriWed AFMID wild-type and mutant S162A by SDS–PAGE showed recovery of relatively high purity proteins (Table 1, Fig. 2); similar results were also obtained for the other mutants. Michaelis–Menten parameters for native AFMID were Km D 0.18 § 0.02 mM, r2 D 0.99, Vmax D 53 § 4 mM/min, and for expressed 0.19 § 0.01 mM, r2 D 0.99, Vmax D 60 § 1 mM/min. The expressed proteins were assayed for NFK hydrolysis with the wild-type displaying strong activity (42 § 1 mol/min/ mg, n D 3) while the mutants lost essentially all (>99%) of their activity (Table 2). Mutant and wild-type samples showed similar puriWcation proWles.
Table 1 PuriWcation of 6£ His-tagged AFMID from cleared E. coli lysate PuriWcation step
Total protein (mg)
Total activity (mol/min)
SpeciWc activity (mol/min/mg)
PuriWcation (fold)
Yield (%)
Lysate QSFF SDX200 SFNiNTA
255 22 8.9 0.28
120 103 58 12
0.47 4.7 6.5 42
1 10 14 90
100 86 48 10
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
43
nucleotide and/or protein level in Wve species; Saccharomyces cerevisiae, Polaribacter Wlamentus, Gemmata sp. Wal-1, Drosophila melanogaster, and Mus musculus with six protein and ten nucleotide sequences found for AFMID using the National Center for Biotechnology Information Entrez search engine. A search of genomes identiWed genes in S. cerevisiae, M. musculus, and Homo sapiens. The 6£ His-tag facilitated AFMID isolation while not appearing to aVect enzyme activity based on Km and Vmax comparisons of the native and expressed wild-type. Initial expression produced extracts with signiWcant AFMID activity. While a single batchpuriWcation was suitable for conWrmation of protein expression and induction, large-scale cultures required further puriWcation. A three-step procedure using anion exchange (QSFF), gel Wltration (SDX200), and aYnity chromatography (SFNiNTA) generated high purity proteins for enzyme activity comparisons. Site-directed mutagenesis of catalytic triad residues
Fig. 2. SDS–PAGE analysis and comparative activity of three-step puriWed AFMID. (A) Representative samples of wild-type and S162A illustrate the purity of recovered proteins. The other mutants produced similar results. (B) Comparative assay demonstrates the linearity of data (r2 D 0.99) for the wild-type during the time frame measured, the speciWc activity of the wild-type, and the loss of activity for the S162A mutant.
Discussion Cloning, expression, mutation, and puriWcation The novel protein identiWed from cDNA sequence AF399717 was conWrmed as AFMID by successful cloning and expression in E. coli of enzyme with high activity for hydrolyzing NFK. This is the Wrst AFMID from any species to be cloned, sequenced, and functionally expressed. AFMID has been characterized at the
Table 2 SpeciWc activity of recombinant 6£ His-tagged AFMID and sitespeciWc mutants AFMID
SpeciWc activity (mol/min/mg)
Wild-type Mutants S162A D247A H279A D247A, H279A S162A, D247A, H279A
r
2
Loss of activity (%)
42 § 1
1.00 § 0.00
0
0.26 § 0.05 0.15 § 0.01 0.08 § 0.21 0.01 § 0.01 0.08 § 0.08
0.87 § 0.09 0.17 § 0.21 0.12 § 0.18 0.45 § 0.37 0.74 § 0.15
>99 >99 >99 >99 >99
Site-directed mutagenesis was carried out to probe the contribution of residues identiWed through homology modeling as the proposed catalytic triad, resulting in the point mutants S162A, D247A, and H279A. The active site serine in the sequence motif GXSXG [9] was conWrmed by the site-speciWc mutant S162A losing >99% enzymatic activity as an expressed protein. The remaining two residues, D247 and H279, were the least certain of the triad, being identiWed solely by the homology model. These two mutants also showed >99% loss of enzyme activity toward NFK supporting the modeled catalytic site. All other double and triple mutants tested had no enzymatic activity. Though the eVect of these point mutations on overall structure has not been adequately deWned, preliminary circular dichroism experiments show similar spectra for wildtype and triple mutant AFMIDs containing signiWcant secondary structural characteristics (data not shown). While supportive of minimal structural change, these preliminary results are not deWnitive and a complete set of CD data is not available at this time. The loss of catalytic activity upon substituting alanine for Ser162, Asp247, and His279, therefore, supports their assignment as active site residues and the catalytic triad of AFMID. Physiological and toxicological relevance There are six serine hydrolases of current interest in considering organophosphate toxicology, i.e., acetylcholinesterase, butyrylcholinesterase, neuropathy target esterase-lysophospholipase, fatty acid amide hydrolase, acylpeptide hydrolase, and AFMID [10]. Afmid gene
44
M.K. Pabarcus, J.E. Casida / Protein Expression and PuriWcation 44 (2005) 39–44
inactivation in mice [11,12] results in a profound imbalance of metabolites of the kynurenine pathway of tryptophan degradation, which may explain the kidney deterioration and abnormal immune system [13]. The present Wndings on AFMID expression and veriWcation of the catalytic triad are important steps in deWning the key role of this serine hydrolase in tryptophan and kynurenine metabolism.
Acknowledgments The project described was supported by Grant ES08762 from the National Institute of Environmental Health Sciences (NIEHS), NIH. Its contents are solely the responsibility of the authors and do not represent the oYcial views of NIEHS, NIH.
References [1] D. Voet, J.G. Voet, in: Amino Acid Metabolism, Biochemistry, 2nd ed., Wiley, New York, 1995, pp. 744–746 (Chapter 24). [2] N.H. Proctor, A.D. Moscioni, J.E. Casida, Chicken embryo NAD levels lowered by teratogenic organophosphorus and methylcarbamate insecticides, Biochem. Pharmacol. 25 (1976) 757–762. [3] A.D. Moscioni, J.L. Engel, J.E. Casida, Kynurenine formamidase inhibition as a possible mechanism for certain teratogenic eVects of organophosphorus and methylcarbamate insecticides in chicken embryos, Biochem. Pharmacol. 26 (1977) 2251–2258.
[4] J. Seifert, J.E. Casida, Mechanisms of teratogenesis induced by organophosphorus and methylcarbamate insecticides, in: D.H. Huston, T.R. Roberts (Eds.), Progress in Pesticide Biochemistry, vol. 1, Wiley, New York, 1981, pp. 219–246. [5] M.K. Pabarcus, J.E. Casida, Kynurenine formamidase: determination of primary structure and modeling-based prediction of tertiary structure and catalytic triad, Biochim. Biophys. Acta 1596 (2002) 201–211. [6] D.L. Ollis, E. Cheah, M. Cygler, B. Dijkstra, F. Frolow, S.M. Franken, M. Harel, S.J. Remington, I. Silman, J. Schrag, J.L. Sussman, K.H.G. Verschueren, A. Goldman, The / hydrolase fold, Protein Engineering 5 (1992) 197–211. [7] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [8] K.B. Nicholas, H.B.J. Nicholas, D.W. DeerWeld II, GeneDoc: analysis and visualization of genetic variation, Distributed by the author at www.psc.edu/biomed/genedoc, 1997. [9] S. Brenner, The molecular evolution of genes and proteins: a tale of two serines, Nature 334 (1988) 528–530. [10] J.E. Casida, G.B. Quistad, Organophosphate toxicology: safety aspects of nonacetylcholinesterase secondary targets, Chem. Res. Toxicol. 17 (2004) 983–998. [11] V.N. Dobrovolsky, T. Bucci, R.H. HeXich, J. Desjardins, F.C. Richardson, Mice deWcient for cytosolic thymidine kinase gene develop fatal kidney disease, Mol. Genet. Metab. 78 (2003) 1–10. [12] B. Schuettengruber, A. Doetzlhofer, K. Kroboth, E. Wintersberger, C. Seiser, Alternate activation of two divergently transcribed mouse genes from a bidirectional promoter is linked to changes in histone modiWcation, J. Biol. Chem. 278 (2003) 1784–1793. [13] V.N. Dobrovolsky, J.F. Bowyer, M.K. Pabarcus, R.H. HeXich, L.D. Williams, D.R. Doerge, B. Arvidsson, J. Bergquist, J.E. Casida, EVect of arylformamidase (kynurenine formamidase) gene inactivation in mice on enzymatic activity, kynurenine pathway metabolites and phenotype, Biochim. Biophys. Acta (2005), in press.