Cloning, expression and characterization of lepidopteran isopentenyl diphosphate isomerase

Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Contents lists available at SciVerse ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Cloning, expression and characterization of lepidopteran isopentenyl diphosphate isomeraseq Stephanie E. Sen a, *, Ashley Tomasello a, Michael Grasso a, Ryan Denton b, Joseph Macor a, Catherine Béliveau c, Michel Cusson c, Dring N. Crowell d a

Department of Chemistry, The College of New Jersey, 2000 Pennington Road, Ewing, NJ 08628, USA Department of Chemistry, Indiana U.-Purdue U. Indianapolis, 402 North Blackford Street, Indianapolis, IN 46202, USA Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 rue du PEPS, Quebec City, Québec, G1V 4C7 Canada d Department of Biological Sciences, Idaho State University, Pocatello, ID 83209, USA b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 April 2012 Received in revised form 30 June 2012 Accepted 3 July 2012

Isopentenyl diphosphate isomerase (IPPI) of the spruce budworm, Choristoneura fumiferana, and of the tobacco hornworm, Manduca sexta, was cloned and its catalytic properties assessed. In the presence of Mg2þ or Mn2þ, the recombinant protein from C. fumiferana (CfIPPI) efficiently isomerized IPP to dimethylallyl diphosphate (DMAPP). While C. fumiferana IPPI transcript levels were evenly distributed in a wide variety of tissues, they were highly abundant in the corpora allata. Because IPPI plays an alternate role in lepidopteran juvenile hormone (JH) biosynthesis by catalyzing the isomerization of the homologous substrate, homoisopentenyl diphosphate (HIPP), the ability of CfIPPI to convert HIPP to homodimethylallyl diphosphate (HDMAPP) was also studied. As expected, HIPP isomerization was efficient and the formation of HDMAPP occurred, but the regiospecificity of the reaction was lower than previously found in M. sexta corpora allata homogenates and with purified Bombyx mori IPPI. Differences in inhibitory potency for several alkylated ammonium diphosphates and higher homologs of DMAPP were noted between CfIPPI and a vertebrate IPPI, suggesting that the lepidopteran enzyme has a larger active site cavity. To determine the structural factors responsible for homologous substrate coupling, site directed mutagenesis of several residues identified through sequence alignment and homology modeling analysis was performed. The results suggest that unlike other IPPIs, W216 (C. fumiferana numbering) works in concert with a tyrosine residue (Y105) to allow binding of larger substrates and to stabilize the high-energy intermediate formed during substrate isomerization. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Isopentenyl diphosphate isomerase Dimethylallyl diphosphate Juvenile hormone Lepidoptera Inhibitor Homology model

1. Introduction Isoprenoids are essential for a variety of metabolic processes, including electron transport (ubiquinones), glycoprotein biosynthesis (dolichols), communication, and hydrophobic interactions (protein prenylation) (Cane, 1999). They are ubiquitous in nature and have a wide range of chemical structures. The enzyme isopentenyl diphosphate isomerase (IPP isomerase or IPPI) plays a central role in isoprenoid biosynthesis. IPPI catalyzes the isomerization of IPP (1a) to dimethylallyl diphosphate (DMAPP, 2a) by sequential antarafacial protonation-deprotonation, and therefore serves the role of producing regulated pools of C5 precursors for all

q This paper is dedicated to the memory of our coauthor Dring N. Crowell who passed away on June 30, 2012. * Corresponding author. Tel.: þ1 609 771 3287; fax: þ1 609 637 5157. E-mail address: [email protected] (S.E. Sen). 0965-1748/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ibmb.2012.07.001

subsequent isoprenoid-forming enzymes (Scheme 1) (RamosValdivia et al., 1997; Dolence and Poulter, 1999). In contrast to other organisms, the Lepidoptera and certain Hymenoptera produce homologous isoprenoids. This is achieved through the incorporation of structural homologs of IPP and DMAPP into the mevalonate pathway (MVP), requiring that IPPI catalyze the isomerization of homoisopentenyl diphosphate (HIPP, 1b) (Scheme 1). For Lepidoptera, the isomerization of HIPP is an essential step in juvenile hormone (JH) biosynthesis as this order of insects is known to produce four homologous JHs (JH 0, JH I, JH II, and 4-methyl JH I, Scheme 2) (Schooley et al., 1984). Earlier studies using corpora allata (CA) homogenates of adult female Manduca sexta and purified IPPI from Bombyx mori demonstrated that the isomerization of HIPP is highly regiospecific, producing only homodimethylallyl diphosphate (HDMAPP, 2b, Scheme 1) (Baker et al., 1981; Koyama et al., 1985). These results are in sharp contrast with those obtained for the isomerization of HIPP by porcine IPPI, where very little HDMAPP was produced and instead two other products ((E)-3 and 4) were

740

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Scheme 1. Interconversion of IPP to DMAPP as catalyzed by IPPI and possible products obtained in the isomerization of HIPP by IPPI.

formed (Koyama et al., 1973, 1983). Taken together, these results suggested that the lepidopteran enzyme is structurally distinct from other isomerases, warranting further study of its role in isoprenoid, including JH homolog, construction. In this paper, we describe the cloning, expression, and analysis of IPPI derived from two lepidopteran species. While similar to other IPPIs, its selectivity toward HIPP isomerization and its distinct inhibition by a series of substrate analogs and tight-binding transition state analogs indicate that lepidopteran IPPI is not only different from other isomerases, but plays an important role in JH homolog biosynthesis. 2. Materials and methods 2.1. Chemical Sources [14C]IPP (specific activity 59 mCi/mmol) was obtained from GE Healthcare (Piscataway, NJ). [3H]NaBH4 was obtained from American Radiolabeled Chemicals (St. Louis, MO). Terpenol diphosphates 2ae2e (Scheme 1 and Fig. 1) were prepared as previously described (Sen et al., 2006). Ammonium diphosphates 6ae6c (Fig. 1) were prepared by reacting secondary amines (i.e., N,N0 -dimethyl-, Nethyl-N’-methyl-, and N-ethyl-N’-n-propylamine) with tert-butylbromoacetate, followed by reduction with lithium aluminum hydride (LiAlH4) and diphosphorylation of the corresponding ethanolamines. All fine chemicals and reagents were purchased from SigmaeAldrich Chemical Company (St. Louis, MO). 2.2. Cloning of CfIPPI and MsIPPI Total RNA was extracted from midguts of Choristoneura fumiferana 6th instar larvae and the corpora allata of M. sexta 5th instar larvae using the RNeasy mini kit (Qiagen, Valencia, CA) with oncolumn DNase treatment. Following the procedure developed by Matz (Matz et al., 2003), 2.4 mg of total RNA was reverse-transcribed

using an oligo-dT primer (Table 1), followed by synthesis of the second cDNA strand and ligation of adapters (adp1-upper and adp1-lower, Table 1). cDNA amplification was achieved with an adapter-specific primer (adp1-DAP, Table 1) and the oligo-dT primer. PCR amplification was performed using 0.1 mM primers, 0.3 mM of each dNTP, 1.5 U of Platinum Taq DNA Polymerase High Fidelity (Invitrogen/Life Technologies, Grand Island, NY) in 1 High Fidelity PCR buffer (Invitrogen), containing 2 mM MgSO4, using the following conditions: initial heating at 94  C for 2 min, then 20 cycles of 94  C for 30 s, 55  C for 1 min, and 68  C for 5 min. The C. fumiferana IPPI coding sequence was retrieved from an EST library (http://pestgenomics.org/searchBlast.htm) and used to design two primers containing an NdeI restriction site encompassing the ATG start codon for the forward primer (NdeI-CfIPPI, Table 1) and adding an XhoI restriction site downstream of the stop codon for the reverse primer (XhoI-CfIPPI, Table 1). To obtain the cDNA of M. sexta IPPI, three regions of high consensus for insect IPPIs obtained from the NCBI database were used to design degenerate primers (IPPI-F1, IPPI-F2, and IPPI-R1, Table 1) that were used in conjunction with the adp1-DAP and oligo-dT primers to amplify the coding region using a 50 - and 30 -RACE approach. For PCR amplification, 2 mL of the above cDNA libraries were used in a final volume of 50 mL containing 0.2 mM of each primer, 2 mM MgSO4, 0.2 mM of each dNTP, and 1 U of Platinum Taq DNA polymerase (High Fidelity in the case of CfIPPI) in 1 PCR buffer (Invitrogen). The reaction was initiated by heating at 94  C for 2 min, followed by 30 cycles of 30 s at 94  C, 30 s at 55  C (CfIPPI) or 50  C (MsIPPI), and 1 min at 68  C. The amplification products were then cloned into the pGEM-T Easy vector (Promega Corp., Madison, WI) according to the manufacturer’s instructions and subjected to sequence analysis. 2.3. qRT-PCR studies Total RNA was extracted as described above from various tissues of C. fumiferana 6th-instar larvae [fat body (FB), midgut (MG),

Scheme 2. Biosynthesis of JH homologs from DMAPP, HDMAPP, IPP, HIPP and (E)-3.

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

741

Fig. 1. DMAPP analogs and ammonium diphosphates used in structure-activity relationship and inhibitor studies.

Malpighian tubules (MT), brain (Br), epidermis (Epi), testis (T), and salivary glands (SG)], of C. fumiferana female moths [corpora allata (CA)], and of cultured cells (CF-124T C. fumiferana cell line). The quantitative reverse transcription PCR (qRT-PCR) procedure was as described (Cusson et al., 2006) except that the numbers of transcripts were normalized against those of ribosomal protein 49 (rp49). The primer sequences used for these studies are listed in Table 1.

2.4. Recombinant expression of CfIPPI C. fumiferana IPPI cDNA in pGEM-T Easy was sequentially digested with NdeI (followed by a Klenow treatment) and XhoI to retrieve the insert containing the ORF, which was cloned in phase with the N-terminal hexahistidine-tag (His-tag) of the pET28a(þ) vector (Novagen/EMD4Biosciences, Rockland, MA) previously digested with EcoRV and XhoI. After confirming the fidelity of the construction by sequence analysis, the CfIPPI-pET28a(þ) vector was transformed into Escherichia coli Rosetta competent cells (Novagen/ EMD4Biosciences, Rockland, MA). Single colonies from the transformation were used to inoculate a starter culture [2 mL of LB media that contained 1% (w/v) glucose, 30 mg/mL kanamycin, 34 mg/mL chloramphenicol], which was incubated at 37  C and 200 rpm to an OD600 of 0.5. The sample was placed into 100 mL of additional media and incubated at 37  C until the OD600 reached 0.8e1. The sample was then cooled to 4  C, centrifuged at 3000  g, and the resulting pellet was resuspended

in 100 mL of media devoid of glucose and containing 1 mM isopropyl b-D-thiogalactopyranoside (IPTG). The cells were incubated overnight (18 h) at 15  C and 100 rpm.

2.5. Purification of recombinant CfIPPI Induced sample derived from a 100 mL expression culture was centrifuged at 3000  g and the resulting pellet was resuspended in 10 mL of 50 mM sodium phosphate buffer (pH 8), containing 1 mM b-mercaptoethanol (BME). The cells were lysed by sonication (Misonix 3000, 1/8th inch microtip, 0.5 s pulses, 3 min, power level 4, and at 4  C). The solution was clarified by centrifugation at 16,000  g for 15 min and the supernatant was immediately adjusted to 150 mM NaCl and 5 mM imidazole, then incubated with 500 mL BD TALON Metal Affinity Resin (Clontech, Mountain View, CA) that had been pre-equilibrated with 50 mM sodium phosphate buffer (pH 8.0) containing 5 mM MgCl2, 2 mM BME, 150 mM NaCl, and 5 mM imidazole (Buffer A) for 30 min at rt. The resin was washed with 2 column volumes of Buffer A, followed by two washes with buffer containing 25 mM imidazole, and two washes with buffer containing 50 mM imidazole. CfIPPI (as His-tagged protein) was eluted with 2.5 mL of 50 mM sodium phosphate (pH 7.0) containing 5 mM MgCl2, 1 mM BME, and 150 mM imidazole. The eluted protein was passed through a PD-10 column that had been equilibrated with 25 mM TriseHCl (pH 7.0), containing 1 mM BME. Protein was quantified by the method of Bradford, using the

Table 1 List of primers used for cloning, site directed mutagenesis, and qRT-PCR studies. Usage cDNA synthesis

CfIPPI specific Degenerate primers

q-RT-PCR

Site directed mutagenesis

a b c

50 /30 sequence

Primer id. a

adp1-upper adp1-lowera adp1-DAP oligo-dT primer NdeI-CfIPPI-for XhoI-CfIPPI-rev IPPI-F1 IPPI-F2 IPPI-R1 CfIPPI-F1 CfIPPI-R1 Cf rp49-F1 Cf rp49-R2 Y105F-for Y105F-rev C113S-for C113S-rev C114S-for C114S-rev Y159F-for Y159F-rev E169Q-for E169Q-rev E171Q-for E171Q-rev W216F-for W216F-rev

CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT ACCTGCCCGG CTAATACGACTCACTATAGGGC TTTTGTACAAGC (T)16 TATGGACATATGCTTGCTCGCCATCTGb CAGGCCTCGAGACGGTTACTTCTCc YTICAYMGIGCITTYWSIGTITTYYTITT TAYWSIAAYDSITGYTGYWSICAYCCIHT TGIADIAMIARIAYRTRRTCDATYTCRTGYTCNCC ATCAAGCCCAACTCGGACGAGATATCAG GTTCGGTGAGTTCCTTGATGCGATGT CAGGCGTTTCAAGGGACAGTACTTGATG CAGGATTTCCAGCTCTTTGACGTTGTGG TCAAGTCAGAAGGTGACATTCCCAGACTACTATTCAAAC GTTTGAATAGTAGTCTGGGAATGTCACCTTCTGACTTGA TACTATTCAAACGCCTCCTGCAGTCATCCGTTGCTC GAGCAACGGATGACTGCAGGAGGCGTTTGAATAGTA TACTATTCAAACGCCTGCAGCAGTCATCCGTTGCTC GAGCAACGGATGACTGCTGCAGGCGTTTGAATAGTA CTGACCCGCGTGCACTTCCACGACCCGGGCGAC GTCGCCCGGGTCGTGGAAGTGCACGCGGGTCAG GACGGCGTGTGGGGCCAGCATGAGATCGACCACGTGCTC GAGCACGTGGTCGATCTCATGCTGGGCCCCACACGCCGTC GACGGCGTGTGGGGCGAGCATCAGATCGACCACGTGCTC GAGCACGTGGTCGATCTGATGCTCGCCCCACACGCCGTC GGAGGGGCCCATTACACCATTCTTCAACATGATCAAGCG CGCTTGATCATGTTGAAGAATGGTGTAATGGGCCCCTCC

Upper and lower primers were annealed to form adp1 and adp2 adapters. Underlined is an NdeI restriction site included in the primer to clone the IPPI ORF in phase with the His-tag peptide of the expression vector. Underlined is an XhoI restriction site included in the primer to clone the IPPI ORF in the expression vector.

742

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Bio-Rad protein assay reagent (Bio-Rad Laboratories, Hercules, CA). Purity was determined by SDS-PAGE followed by silver staining.

sodium anion of triethylphosphonoacetate, followed by reduction of the resulting (3E) ester with LiAlH4.

2.6. Site-directed mutagenesis

2.8. IPPI assays

Site-directed mutagenesis was performed using the QuikChange II Site-Directed Mutagenesis Kit from Stratagene (Agilent, Santa Clara, CA) according to the manufacturer’s instructions. Briefly, mutagenic PCR was performed in the presence of 20 ng of template DNA (CfIPPI-pET-28a(þ)), 120 ng of forward mutagenic primer (Y105F-for, C113S-for, C114S-for, Y159F-for, E169Q-for, E171Q-for, W216F-for, Table 1), 120 ng of reverse mutagenic primer (Y105Frev, C113S-rev, C114S-rev, Y159F-rev, E169Q-rev, E171Q-rev, W216F-rev, Table 1), dNTP mix, QuikChange II reaction buffer, and PfuUltra. Reactions were pre-heated at 95  C for 30 s, followed by 16 cycles of 95  C for 30 s, 55  C for 1 min, and 68  C for 6 min. Final product synthesis was performed at 68  C for 4 min. Following mutagenic PCR, reactions were incubated for 1 h at 37  C in the presence of DpnI to destroy wild type template DNA. The plasmids were transformed into supercompetent XL1-Blue cells (Invitrogen) according to standard protocols. Mutants were sequenced to confirm the presence of the desired mutation then transformed into E. coli Rosetta cells for subsequent recombinant protein production, as described in sections 2.4 and 2.5, above.

Radiochemical enzyme assays were performed in a final volume of 25 mL (1e2 mg protein), using 50 mM TriseHCl (pH 7) containing 2.5 mM MgCl2, 0.5 mM MnCl2 and 1 mM BME unless noted otherwise. With the exception of kinetic studies (see below), incubations were performed at 37  C with 5e6 mM [14C]IPP (specific activity 59 mCi/mmol) or 1-[3H]HIPP (specific activity 12.5 mCi/ mmol) for 0.5e1 h, then treated with 25 mL of 2.5 N HCl. Hydrolyzed products were extracted with 1/1 diethyl ether/pentane and the organic and aqueous layers were separated and quantified by liquid scintillation counting. Larger-scale IPPI assays were performed in siliconized 1.5 mL Eppendorf tubes and a final volume of 200 mL. 200e250 mg CfIPPI in 50 mM TriseHCl (pH 7) containing 5 mM MgCl2 and 0.5 mM MnCl2 was incubated with 800 mM IPP or HIPP for 1e16 h, at which time, the reaction was treated with 75 mL alkaline phosphatase buffer (250 mM Tris, pH 8, containing 30 mM MgCl2) and 0.5 mL of alkaline phosphatase (from bovine intestinal mucosa, 10 units, SigmaeAldrich) at 37  C for 4 h. The solution was extracted with 100 mL of 1/1 diethyl ether/pentane and a portion of the organic extract (2e6 mL) was immediately subjected to gas chromatographic analysis. The resulting products were identified by comparison to the retention times of authentic product standards. GC conditions were as follows: HP5680 gas chromatograph equipped with a flame ionization detector and a Heliflex AT-WAX 15 M  0.25 mM ID GC capillary column, flow rate 1.5 mL/min, 60  C, 3 min, 10  C/min to 240  C. Under these conditions, the following retention times were obtained: isopentenol, 3.29 min; dimethylallyl alcohol, 4.18 min; homoisopentenol, 4.61 min; homodimethylallyl alcohol, 5.22 min; (E)-3-methyl-3-penten-1-ol (corresponding alcohol of (E)-3, Scheme 1), 4.82 min; (Z)-3-methyl-3-penten-1-ol (corresponding alcohol of (Z)-3), 4.96 min; and (E)-3-methyl-2-penten-1-ol (corresponding alcohol of 4), 5.52 min.

2.7. Synthesis of HIPP and terpenol standards HIPP was prepared from 3-hydroxypropionitrile in 8 steps, as summarized in Scheme 3. Briefly, after silyl protection the nitrile was reduced with DIBALH to provide the corresponding aldehyde, which was converted to ethyl ketone 5 by addition of ethyl Grignard followed by oxidation with PCC. The ketone was subjected to Wittig methylenation and then deprotected to produce homoisopentenol (corresponding alcohol of 1b, Scheme 1). The alcohol was converted to either HIPP or 1-[3H]HIPP using the diphosphorylation procedure previously developed by Poulter’s group (Davisson et al., 1985). For the synthesis of 1-[3H]HIPP, tritium-labeled homoisopentenol was first prepared by oxidation with DesseMartin periodinane, followed by reduction with [3H]NaBH4 (specific activity 50 mCi/mmol, American Radiolabeled Chemicals, St. Louis, MO) in dioxane. Terpenol standards for HIPP isomerization studies were synthesized as follows. (E)-3-methyl-3-penten-1-ol and (Z)-3methyl-3-penten-1-ol [corresponding alcohols of (E)-3 and (Z)-3, Scheme 1] were prepared as an isomeric mixture from 4-hydroxy2-butanone, by Wittig ethylidenation of the corresponding tertbutyldiphenylsilyl ether. (E)-3-methyl-2-penten-1-ol (corresponding alcohol of 4) was prepared by reaction of 2-butanone with the

2.9. Kinetic, metal-dependence, and inhibition studies For kinetic studies, aliquots of CfIPPI (25 mL, in 25 mM TriseHCl, pH 7, containing 1 mM BME, 2.5 mM MgCl2, and 0.1 mM MnCl2) were reacted with 0.5e20 mM [14C]IPP. For metal-dependency studies, aliquots of CfIPPI (25 or 50 mL, in 25 mM TriseHCl, pH 7, containing 1 mM BME) were preincubated for 10 min with either 2.5 mM of divalent metal (MgCl2, MnCl2, ZnCl2, FeCl2 or CuCl2) or with 0e2.5 mM MgCl2 or MnCl2, then reacted with 6 mM [14C]IPP. For

Scheme 3. Synthesis of HIPP and [1-3H]HIPP.

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

inhibition studies, aliquots of CfIPPI (25 mL, in 25 mM TriseHCl, pH 7, with 1 mM BME, 2.5 mM MgCl2, and 0.1 mM MnCl2) were preincubated with allylic diphosphate (80e200 mM 2ae2e), HIPP (1e100 mM 1b), or ammonium diphosphate (1e100 mM, 6aec), then reacted with 6 mM [14C]IPP. All samples were subsequently incubated at 37  C for 30 min then subjected to the work-up described in Section 2.8, above. Experiments were performed at least twice, in duplicate. 2.10. Porcine IPPI assays Porcine IPPI was purified using a modified procedure of Satterwhite (Satterwhite, 1985). Fresh liver (50 g) was homogenized in 200 mL 5 mM TriseHCl pH 7.4, containing 1 mM EDTA, 250 mM sucrose, and 0.1% ethanol. The light mitochondrial pellet, obtained by sequential centrifugation at 3000 and 17,000  g, was resuspended in 10 mL of 5 mM TriseHCl pH 7.4, containing 1 mM EDTA and 5 mM BME, and subjected to sonication. The mixture was acidified to pH 5.5 to remove undesired proteins and then dialyzed against 5 mM TriseHCl, pH 7 buffer, containing 1 mM BME. After clarification, the resulting solution was subjected to isoelectric focusing using a Rotofor apparatus (BioRad) using 2% pH 5/8 Biolytes and 8 W constant power. Under these conditions, IPPI was located in fractions 8 and 9. Aliquots (5 mL) obtained from pooled Rotofor fractions were diluted with 20 mL assay buffer (100 mM TriseHCl pH 7, containing 2.5 mM MgCl2), preincubated with ammonium diphosphates (10e200 mM 6ae6c) for 10 min, then incubated with 6 mM [14C]IPP for 30 min. Samples were subjected to the same work-up as described in Section 2.7, above. Experiments were performed twice, in duplicate. 2.11. Homology modeling The structure of C. fumiferana IPPI was developed using the homology modeling module of Molecular Operating Environment (MOE, Chemical Computing Group Inc., Montreal, Quebec, Canada), with C. fumiferana IPPI as model sequence and PDB entries 2ICK and 2DHO (human IPPI) (Zheng et al., 2007) as templates. Homology modeling was performed to generate 10 energy minimized intermediate models, of which the best intermediate structure was subjected to “fine” energy minimization with an RMS gradient of 0.005. The model was verified by overlay with the original PDB structures and by review of the 4 versus j angles of amino acid residues. Using 2ICK as template, waters within 4.5 Å of the ligand’s C1 oxygen were added to the homology model, along with the active site metal (Mn2þ) and the ligand. The imidazole rings surrounding the metal were modified so that they were of the proper protonation state for metal binding. After protonating the structure (excluding the NE2 nitrogens of H41, H52, and H89, and the OE1 oxygen of E149, 2ICK numbering) using the Protonate3D process in MOE, the model was minimized using Amber99 all-atom force field (Wang et al., 2000). Calculations were carried out for 20 iterations of simplex minimization followed by 1500 steps of conjugate gradient minimization. 2.12. Docking Docking studies were performed using the Dock module of MOE. Ligands 6ae6c were prepared in MOE’s Molecular Editor module using the ligand of 1NFS (E. coli IPPI bound with 6a) (Wouters et al., 2003) as template, then minimized using the MMFF94 force field (Halgren, 1996). The active site identified by MOE for the C. fumiferana homology model, which correlated well with that of 2ICK and 1NFS, was used for all subsequent docking simulations. The default nonstochastic Triangle Matcher placement method was used, followed by molecular mechanics refinement and GBVI scoring, with 10 unique structures being retained.

743

3. Results 3.1. CfIPPI: sequence and comparative analysis An RT-PCR approach was employed to clone IPPI from C. fumiferana and M. sexta. A comparison of the deduced amino acid sequences of CfIPPI and MsIPPI with other IPPIs, including predicted insect IPPIs derived from a tBLASTn search of NCBI and SPODOBASE (Negre et al., 2006), is presented in Fig. 2. CfIPPI cDNA encodes a protein of 250 (29.2 kDa) amino acids, with a calculated isoelectric point of 6.35. MsIPPI, which has 77% identity and 94% similarity to CfIPPI, also encodes a protein of 250 (29.4 kDa) amino acids, with a calculated isoelectric point of 6.00. Both proteins possess an N-terminal mitochondrial targeting sequence (determined by MITOPROT, cleavage site is indicated by Y, Fig. 2) (Claros and Vincens, 1996), suggesting that the IPPIs are localized in the mitochondria, as is the case for some other insect proteins involved in the biosynthesis of isoprenoids (Martin et al., 2007). Sequence alignment shows that lepidopteran IPPI possesses a gap at þ10 from C114 (C. fumiferana numbering), the putative catalytic base required for IPP to DMAPP isomerization. In addition, the lepidopteran IPPIs are characterized by 4 unique amino acid substitutions that are proximal to the active site: Y and Q, at 6 and 13 to C114, respectively, and H at both 9 and þ5 to E169, which is involved in protonation of IPP to generate a carbocationic intermediate during catalysis. Aside from these differences, the structure of the lepidopteran IPPIs appears to be highly conserved relative to insect and non-insect species. A phylogenetic analysis of insect IPPIs generated a tree whose topology differs from that expected for the insect families from which the sequences were derived. For example, the lepidopteran clade would normally cluster with the Diptera and not the Coleoptera, as seen here (Fig. 3). This discrepancy may be due to the fact that lepidopteran IPPIs, unlike many other proteins from this taxon, form a much more derived clade, which may relate to their distinct catalytic features. Within lepidopteran IPPIs, however, the branching pattern is that expected for the sampled families, with the more primitive C. fumiferana (a tortricid) being basal to the group. The low support (0.23) for the BmIPPI and MsIPPI branches may be due to the fact that Bombyx and Manduca belong to the same superfamily (Bombycoidea). 3.2. RT-PCR quantification of CfIPPI transcripts Using specific primers designed against CfIPPI, qRT-PCR was performed on various tissues of larval C. fumiferana, the corpora allata of adult female C. fumiferana moths, and the C. fumiferana cell line, CF-124T. CfIPPI transcript was present in each sample, but was most abundant in the corpora allata, followed by larval Malpighian tubules and midgut (Fig. 4). 3.3. Expression and purification of CfIPPI CfIPPI was expressed under control of the T7 promoter as an Nterminal His-tagged protein, to allow for purification by immobilized metal affinity chromatography (IMAC). Because CfIPPI transcript possesses a high number of rare E. coli codons that could impede efficient protein expression, expression was performed in Rosetta cells (Novagen/EMD4Biosciences, Rockland, MA). The protein was efficiently purified using the cobalt-based TALON resin and a stepwise imidazole gradient in phosphate buffer (Fig. 5). CfIPPI catalyzed the isomerization of [14C]IPP to acid-labile product, which was confirmed to be DMAPP by subsequent preparative scale assay with IPP and GCeMS analysis of the corresponding terpenols, obtained by enzymatic hydrolysis with alkaline phosphatase (data not shown). The enzyme required divalent metal for activity,

744

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Fig. 2. Alignment of the deduced amino acid sequence of CfIPPI and MsIPPI with other IPPIs from B. mori (BmIPPI, accession number NP_001040323.2), Spodoptera frugiperda (SfIPPI, SPODOBASE number Sf2H00422-5-1), Tribolium castaneum (TcIPPI, accession number XP_971524.1), Dendroctonus jeffreyi (DjIPPI, accession number AAX78437.1), Apis mellifera (AmIPPI, accession number XP_001121223.1), Drosophila melanogaster (DmIPPI, accession number AAM49838.1), Acyrthosiphon pisum (ApIPPI, accession number ACO37157.1), Gallus gallus (GgIPPI, accession number XP_418561.3) and H. sapiens (HsIPPI, accession number AAP36609.1). The alignment was performed using ClustalW using the standard settings. Output was drawn using Boxshade. Underlined sequences represent regions used for primer design. Asterisks show positions of C114, Y159, E169, E171, and W216 (C. fumiferana numbering). Arrows identify mitochondrial cleavage site (Y), and N-terminus of homology models (/).

displaying a preference for Mn2þ over Mg2þ, and was not activated by Zn2þ, Fe2þ, or Cu2þ (Figs. 6 and 7). The isomerization of IPP to DMAPP displayed typical MichaeliseMenten kinetics, yielding a Km of 3 mM, which is in the range of other known IPPIs. 3.4. Homology modeling Homology models of CfIPPI were prepared using crystal structures of human IPPI as templates (Zheng et al., 2007). The structures obtained (CfIPPI-W-in and CfIPPI-W-out, Fig. 8) showed good

correlation with original template structures and with themselves (RMSD’s within 2 Å, note that the N-termini of CfIPPI-W-in and CfIPPI-W-out, which contain putative mitochondrial targeting sequences have been truncated by 34 and 39 amino acids, respectively). Both CfIPPI-W-in and CfIPPI-W-out showed similar features to other IPPIs, including a distorted octahedral metal coordination sphere with three histidines (H68, H79, and H116, C. fumiferana numbering), one bidentate glutamic acid (E169), and one monodentate glutamic acid (E171) as ligands, as well as an active site tyrosine (Y159) that is hydrogen-bonded to E169, and an active site

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

745

Fig. 3. Maximum-likelihood phylogenetic tree estimated for selected insect IPPIs. For this analysis, we used a web-based pipeline (http://www.phylogeny.fr/version2_cgi/simple_ phylogeny.cgi) that carries out an amino acid alignment using MUSCLE, curates the alignment using Gblocks, constructs a tree using PhyML and renders the tree using TreeDyn. The statistical test for branch support is the Approximate Likelihood Ratio Test (aLRT). Species abbreviation: Ag: Anopheles gambiae; Am: Apis mellifera; Ap: Acyrthosiphon pisum; Bm: Bombyx mori; Cf: Choristoneura fumiferana; Dj: Dendroctonus jeffreyi; Dm: Drosophila melanogaster; Ms: Manduca sexta; Nv: Nasonia vitripennis; Pu: Pseudaletia (Mythimna) unipuncta; Sf: Spodoptera frugiperda; Tc: Tribolium castaneum.

cysteine (C114, Fig. 9). IPP occupies a similar position in both homology models. The diphosphate moiety, which is close to the entry of the active site cavity, forms electrostatic interactions with several positively charged residues (K64, R98, and K102), as is seen in other IPPIs, although for CfIPPI-W-out, additional interactions with H116 and R134 were observed (Fig. 10). The isoprene tail of the ligand is sequestered within the active site cavity and is proximal to W216, Y159, E169, and C114, with the latter two being positioned antarafacially relative to the double bond of IPP. Rotation of W216 in CfIPPI-W-out causes an increase in the active site cavity volume of CfIPPI-W-out and as a result, the diphosphate moiety of the ligand is shifted slightly, creating additional electrostatic interactions with R134 and H116 (Fig. 10b). An additional tyrosine residue (Y105), which is proximal to W216 and Y159 in both homology models, is rotated into the active site cavity of CfIPPI-W-out, partially replacing the position of W216 (Fig. 9). While found in Coleoptera, this particular amino acid substitution (F/Y) is not present in any other IPPI known to date.

3.5. Site directed mutagenesis studies

Fig. 4. CfIPPI transcript distribution in various tissues, as assessed by qRT-PCR. CF124T ¼ C. fumiferana cell line, FB ¼ fat body, SG ¼ salivary glands, MT ¼ Malpighian tubules, T ¼ testis, Epi ¼ epidermis, MG ¼ midgut, Br ¼ brain, CA ¼ corpora allata. Data represent the average of four technical replicates. Insect RNA was obtained by combining samples from multiple individuals.

Fig. 5. Purification of CfIPPI. The protein was purified by Co-IMAC using the procedure described in the materials and methods sections. Lane 1: molecular weight markers, Lane 2: r-CfIPPI obtained from combined elute fractions that were subjected to desalting through PD-10 column. Gel conditions: 4e15% SDS-PAGE, visualized by silver staining.

Site directed mutagenesis was undertaken to establish the structural similarities and differences between moth and other IPPIs. Single and double point mutations were performed using the QuickChange SDM kit and confirmed by sequencing. The residues that were subjected to SDM included C114 (C. fumiferana numbering), Y159, E169, E171, and W216, which are conserved residues and have been implicated in IPPI catalysis. In addition, mutation of C113 and Y105 was performed.

746

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Fig. 6. Effect of increasing metal on CfIPPI coupling. Assay conditions: 1 mg protein, ¼ MnCl2. Data shown represent the 30 min incubation, 6 mM [14C]IPP. - [ MgCl2, average of a single experiment performed in duplicate.

C113, C114, E169, and E171 were found to be essential catalytic residues, with each mutation (C113S, C114S, E169Q, E171Q, C113S/ 114S, E169/171Q) abolishing the enzyme’s ability to isomerize IPP to DMAPP (Table 2, data for C113S/114S, E169/171Q not shown). Mutation of Y159 and W216 led to diminished, but not loss of activity. In contrast to these results, an increase in Vmax and kcat was observed for the Y105F mutant.

3.6. HIPP isomerization studies Incubations of 1-[3H]HIPP with CfIPPI led to the formation of acid labile product, which did not occur in the absence of divalent metal co-factor. The reaction displayed saturation behavior and for IPP, a 65/35 equilibrium of DMAPP and IPP, consistent with other IPPIs, was achieved within 6 h (Fig. 11). In comparison to IPP, HIPP was 3e4 times less reactive and only 20% product was produced. Because the use of radiolabelled HIPP precluded the structural identification of any isomerization product(s) produced, we performed larger-scale incubations of CfIPPI with non-radioactive HIPP. The reaction mixture was then subjected to enzymatic hydrolysis with commercial alkaline phosphatase, and the resulting

Fig. 7. Effect of different metals on CfIPPI isomerization. Assay conditions: 1 mg protein, 30 min incubation, 6 mM [14C]IPP, 2.5 mM divalent metal (Mg ¼ MgCl2, Mn ¼ MnCl2, Zn ¼ ZnCl2, Fe ¼ FeCl2, Cu ¼ CuCl2, Mg/Mn ¼ MgCl2 and MnCl2. Data shown represent the average of a single experiment performed in duplicate.

Fig. 8. Overlay of homologous models developed from 2ICK (CfIPPI-W-in, in orange) and 2DHO (CfIPPI-W-out). The “in” and “out” rotamers are displayed. Overall structures are presented as ribbon representations of secondary structure elements.

organic extract was subjected to GCeMS analysis, by comparison with synthesized product standards. Several products were formed (Table 3) of which 26% was HDMAPP and 55% was (E)-3. This product distribution was unaffected by incubation time, divalent cation used, or by removal of the N-terminal His-tag by thrombin treatment (data not shown). We also evaluated the ability of CfIPPI mutants Y105F and W216F to catalyze the isomerization of HIPP. The Y105F mutant was slightly more reactive and produced a cleaner product profile, with

Fig. 9. Detailed view of the active site of CfIPPI IPP. Only one model (CfIPPI-W-out) is presented for clarity of the picture. Active site residues are labeled.

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

747

Fig. 10. Ligand interaction diagrams for CfIPPI-W-in (A) and CfIPPI-W-out (B). The plots depict the flattened spatial arrangement of ligand (IPP) and CfIPPI with respect to key interactions. Proximity contour (dashed lines) and solvent exposed areas (light purple spheres) of the ligand atoms are shown, as well as are the polar (pink), hydrophobic (green), and solvent-exposed (light blue shadow) active site residues. Acidic and basic residues are highlighted with red and blue halos, respectively. Hydrogen bonds between ligand and protein are denoted as purple dashed lines, while electrostatic interactions are indicated by green dashed arrows.

more HDMAPP being formed (42%, Table 3). The relative reactivity of W216F mutant was 10% that of wild type enzyme, but surprisingly, the W216F mutant formed only HDMAPP. 3.7. SAR and inhibition studies To further identify the structural features of the lepidopteran IPPI in relation to other homologous proteins, we performed competitive inhibition studies using CfIPPI and [14C]IPP as substrate. First, we compared the ability of DMAPP and HDMAPP, the products of IPP and HDMAPP isomerization, respectively, and the homologous substrate, HIPP, to inhibit the conversion of [14C] IPP to [14C]DMAPP. We found that HDMAPP was a better inhibitor of IPP isomerization than DMAPP (IC50 ¼ 92 mM versus 131 mM), and that of the three, HIPP was the most effective (Table 4). To test the steric capacity of CfIPPI, larger homologs of DMAPP were tested. We found that substitution of the (Z)-C-3 methyl of DMAPP by n-Pr and n-Bu groups (i.e., 2c and 2d) caused a small decrease in inhibitory potency compared to DMAPP and that the corresponding i-Pr derivative (2e) was poorly inhibitory. Based on the above SAR studies, we prepared three ammonium diphosphates and tested their ability to inhibit CfIPPI. To compare the specificity of these compounds for lepidopteran IPPI, we tested the ability of 6ae6c to inhibit IPP isomerization of both recombinant CfIPPI and IPPI that was purified from pig liver. In comparing

the potency of 6a (analog of IPP) and 6b (analog of HIPP), we noted that 6b was the more potent inhibitor of the lepidopteran protein whereas 6a was the more potent inhibitor of vertebrate IPPI (Table 5). The larger ammonium diphosphate analog, 6c (R1 ¼ n-Pr, R2 ¼ n-Bu) was highly selective for the lepidopteran protein (IC50 ¼ 7 mM), having no effect on the isomerization of IPP by pig liver IPPI at concentrations as high as 200 mM. Docking studies were performed to determine the binding energies of 6ae6c with IPPI. We used 2ICK as the receptor analog for the pig liver enzyme and evaluated both CfIPPI-W-in and W-out homology models for C. fumiferana IPPI. As shown in Table 5, good correlation was seen between the IC50 values obtained and the computationally derived binding affinities of 6ae6c when 2ICK and CfIPPI-W-out were used as ligand receptors.

Table 2 Kinetic parameters of wild-type and mutant C. fumiferana IPPI. CfIPPI type

Km (mM)

Vmax (pmol/min)

kcat (pmol/min*mg protein)

WT Y105F Y159F W216F E169Q E171Q C113S C114S

3.3 6 12.8 11.6 6 e e e

2.5 6.7 0.8 0.29 0.03 0.008 0.041 0.011

5 14 1.2 0.35 0.06 0.01 0.14 0.02

Assay conditions: 1 mg protein, 6 mM or 12 mM (E169Q, E171Q, C113S, and C114) [14C]IPP, 20 min (WT, Y105F), 1 h (Y159F, W216F), and 4 h (E169Q, E171Q, C113S, and C114) incubation. Data for WT, Y104F, Y159F, W216F, and E169Q represent the average of at least two experiments, performed in duplicate (error within 5%).

Fig. 11. HIPP versus IPP isomerization by CfIPPI. Assay conditions: 1 mg protein, 6 mM [14C]IPP or [1-3H]HIPP. - ¼ IPP, ¼ HIPP. Data shown represent the average of a single experiment performed in duplicate.

748

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Table 3 Product distribution for HIPP isomeration.

Table 5 Results of inhibition studies with ammonium diphosphates 6ae6c and calculated binding affinities.

Product (%)

a

CfIPPI-WT CfIPPI-Y105Fa CfIPPI-W216F Pig liver IPPIb

HDMAPP (2b)

4

(E)-3

(Z)-3

Relative activity

26 42 Only product detected 3

11 6 e

55 52 e

8 0 e

100 115 10

14

83

0

Assay conditions: 100 mg protein, 400 mM HIPP, 3e4 h incubation. Products were identified by GCeMS analysis of the corresponding alcohols obtained by alkaline phosphatase treatment. Terpenols were quantified by GC analysis with flame ionization detection. a Data represent the average of three independent experiments (error within 10%). b Data from Koyama et al. (1983).

4. Discussion IPPI plays a central role in isoprenoid metabolism, catalyzing the isomerization of IPP to DMAPP and thus creating regulated pools of the latter for higher isoprenoid construction. Certain insects are known to produce homologous structures, which are derived from the isomerization of HIPP, the homolog IPP. In Lepidoptera, this is accomplished by the incorporation of propionyl-CoA into the mevalonate pathway (MVP) (Schooley et al., 1973). As an extension of our work involving the structural analysis of another isoprenoid forming enzyme, farnesyl diphosphate synthase (FPPS) that is involved in lepidopteran isoprenoid metabolism, we undertook the characterization of lepidopteran IPPI. The sequence of IPPI from B. mori has been recently published (Kinjoh et al., 2007) and the corresponding protein was partially purified from the same organism (Koyama et al., 1985). Because lepidopteran insects produce homologous JHs, there has been significant interest in identifying the proteins involved in the construction of these molecules. Using the corpora allata (the exclusive site of JH biosynthesis) as tissue source, differences in substrate specificity for several enzymes of the MVP have been noted, including IPPI. Corpora allata homogenates of adult female M. sexta, which produce a mixture of JH III and JH II, were found to cleanly convert HIPP to HDMAPP, as determined by HPLC analysis of the corresponding diphenylcarbamate derivatives (Baker et al., 1981). Similarly, incubation of partially purified IPPI from whole body B. mori with HIPP, followed by GCeMS analysis of the corresponding terpenols derived from hydrolysis by alkaline phosphatase, yielded HDMAPP as the exclusive product (Koyama et al., 1985). In contrast to these results, vertebrate IPPI displays rather poor regiospecificity for the isomerization of HIPP. Using pig liver IPPI, the isomerization of HIPP was shown to produce a complex mixture of products, including homoallylic diphosphate (E)-3, the trans isomer of HDMAPP (4), and HDMAPP (2b), in an 83/14/3

Table 4 Results of structure-activity relationship studies. Compound

IC50 (mM)

HIPP (1b) DMAPP (2a) HDMAPP (2b) n-PrMAPP (2c) n-BuMAPP (2d) i-PrMAPP (2e)

66 131 92 156 158 234

     

2 12 3 5 16 70

Assay conditions: 1 mg protein, 10 min preincubation with 10e200 mM diphosphate, 6 mM [14C]IPP, 30 min incubation. Data represent the average of 2 independent experiments, performed in duplicate.

Ammonium diphosphate 6a 6b 6c

IC50 (mM)a Pig liver 0.8  0.2 5.5  1.5 ni

Binding affinity (kcal/mol) with C. fumiferana 10  0.7 3  0.8 7  0.5

2ICK 44 33 12

CfIPPI-W-in 50 45 37

CfIPPI-W-out 23 29 34

a Data represent the average of two independent experiments, performed in duplicate.

product ratio (Koyama et al., 1983). The fact that only 3% of the isomerization products catalyzed by a vertebrate IPPI corresponds to HDMAPP suggests that there are likely to be structural differences in IPPI structure between animal species. In an attempt to understand the differences between lepidopteran and other IPPIs, we cloned two lepidopteran proteins and performed additional studies on one of these. Sequence alignments showed similar primary structure between animal species, with conserved metal binding and catalytic domains. To probe the structure of lepidopteran IPPI, we performed a combination of in silico and in vitro studies. Homology models of C. fumiferana IPPI were prepared, using two crystal structures of human IPPI as templates: 2ICK, which is bound to IPP/DMAPP, and 2DHO, which is an unligated form of the protein (Zheng et al., 2007). The only significant difference between the two structures is the position W196 (Homo sapiens numbering), which is rotated so that the indole ring is either pointing into (2ICK, W-in) or out of (2DHO, W-out) the active site cavity. Prior studies have shown that this tryptophan plays an important role in catalysis by stabilizing the carbocationic intermediate formed by protonation of IPP and that it adopts several rotameric forms (Durbecq et al., 2001; Wouters et al., 2003). As p-cation stabilization can only occur when the tryptophan is pointing into the active site cavity, 2ICK is generally considered to represent the “active” form of IPPI. However, a cursory review of the active sites of 2ICK and 2DHO suggested that 2DHO would be better suited to bind homologous substrates and that the C-3 ethyl group of HIPP would be proximal to the region occupied by W196 of 2ICK. Indeed, calculations using Hotspot wizard (Pavelka et al., 2009) indicated that rotation of the tryptophan creates an increase in active site volume of 13 Å3, in the range needed for IPP to HIPP substrate substitution. The differences noted in the primary IPPI sequence of lepidopteran IPPI were correlated with the two homology models to determine whether sequence variations might be functionally important. The gap that occurs just after C114 is contained within a loop connecting two beta sheets and is far enough away from the active site that it is not likely to cause changes in IPPI function. The unique amino acid substitutions seen in lepidopteran IPPIs (Q101, Y108, H160, and H174, C. fumiferana numbering) are also distal from the active site cavity. The only obvious difference seen between CfIPPI and human IPPI was the presence of an additional tyrosine residue (Y105) within the active site. Y105 is proximal to Y159 and to W216 in both homology models but is rotated into the active site cavity of CfIPPI-W-out (Fig. 9), partially replacing the position of W216, suggesting that it might have a role in p-cation stabilization in place of the indole ring. Based on the above observations we prepared several single and double point mutations and tested them for their ability to catalyze the isomerization of IPP to DMAPP. Replacement of Y104 or W161 with phenylalanine caused >99% loss of activity for E. coli IPPI (Durbecq et al., 2001; Wouters et al., 2004; de Ruyck et al., 2006); however, similar substitutions in CfIPPI (i.e., Y159F and W216F) did not inactivate the protein and caused a modest increase in Km, indicating that these residues are important but not essential for

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

catalysis and may play a structural role. Y105 corresponds to phenylalanine in all other organisms, with the exception of Coleoptera. The CfIPP-Y105F displayed an almost 3-fold increase in kcat, with only a slight increase in Km. To probe the size of the active site cavity we prepared and tested several compounds as competitive inhibitors of CfIPPI. First, we ascertained the effect of DMAPP and HDMAPP, products of IPP and HIPP isomerization, and of HIPP, the natural homolog of IPP in Lepidoptera, on the formation of [14C]DMAPP from [14C]IPP. Each of the compounds inhibited the isomerization of IPP by CfIPPI, yielding IC50’s of 131, 92, and 66 mM for DMAPP, HDMAPP, and HIPP, respectively (Table 4). The lower inhibitory potency of the allylic diphosphates to HIPP and the higher inhibitory effect of HDMAPP relative to DMAPP is consistent with both the mechanism of IPPI (i.e., product binds less tightly than substrate) and the known ability of lepidopteran IPPI to accept homologous substrates. The fact that the n-propyl and n-butyl analogs (2c and 2d, respectively) had IC50s that are similar to that of DMAPP suggested that the active site of CfIPPI could accommodate larger groups on the isoprenoid chain, prompting us to further explore the steric capacity of the lepidopteran protein. We prepared and tested three ammonium diphosphates for their ability to inhibit a lepidopteran (C. fumiferana) and a non-lepidopteran (pig liver) IPPI. Dimethylammonium diphosphate 6a is a well-known tight binding inhibitor of yeast, E. coli, and mint IPPI, functioning as an intermediate analog of the C-4 carbocation that forms during catalysis (Reardon and Abeles, 1986; Wouters et al., 2003; McCaskill and Croteau, 1999). As expected, 6a was a potent inhibitor of pig liver IPPI and was also an inhibitor of CfIPPI, although less so (IC50 ¼ 0.8 mM and 10 mM for pig liver and C. fumiferana IPPI, respectively, Table 5). As the size of the alkyl substituents on 6 was increased, a progressive decrease in activity was seen for the pig liver protein, with the largest compound (6c) being completely inactive. This trend was not seen for CfIPPI. Instead, compound 6b, which represents the ammonium analog of HDMAPP, was 3 more inhibitory than 6a for CfIPPI and compound 6c, which is a hydrid of n-propyl (2c) and nbutyl (2d) analogs of DMAPP, was as active as 6a. These results are strongly suggestive that the active site volumes of vertebrate and lepidopteran IPPIs are different. As qRT-PCR results indicated that CfIPPI transcripts are highly abundant in the corpora allata (Fig. 4), the site of JH synthesis, these results also reinforce the notion that the lepidopteran IPPI, which must turnover endogenous HIPP for JH homolog production, has evolved to have a larger isoprenoid binding region within its active site. HDMAPP (2b) is required for the construction of each of the JH homologs produced in Lepidoptera (Scheme 2) and the HIPP isomer (E)-3 is needed for the biosynthesis of methyl JH I and faranal, a trail pheromone produced by the Pharaoh ant, Monomorium pharaonis (Hymenoptera) (Koyama et al., 1987; Kobayashi et al., 1980). To determine the specificity of HIPP isomerization by CfIPPI, in vitro assays with both radioactive and non-radioactively labeled HIPP were performed. HIPP isomerization was less efficient than IPP isomerization (Fig. 11) but like the latter, required divalent metal for activity and had a preference for Mn2þ (data not shown). Compared to that of pig liver IPPI, the regiospecificity of HIPP isomerization by CfIPPI was higher and a greater proportion of HDMAPP was produced, but CfIPPI was less selective than IPPIs derived from M. sexta corpora allata and B. mori whole body homogenates, in that (E)-3 was also produced (Table 3). It seems that there are three possible explanations for these differences in lepidopteran IPPI activity: 1) the structure of recombinant IPPI is not the same as the native protein (e.g., misfolding has occurred or posttranslational modification is necessary), 2) the conditions of the assay with CfIPPI are not optimal (i.e., cofactors are missing), or 3) the IPPI from C. fumiferana does not have the same specificity as those of B. mori

749

or M. sexta. With regards to the first two possibilities, it should be noted that the methodologies chosen for the expression of CfIPPI have been standardly used to prepare active IPPIs of other (albeit non-insect) systems. In addition, we found that the product distribution seen for HIPP isomerization by CfIPPI was insensitive to changes in metal cofactor (Mg2þ versus Mn2þ), buffer (phosphate versus Tris), pH (7 versus 8), incubation time (1 h to overnight), or removal of the His-tag by thrombin treatment. While the lepidopteran proteins are highly similar to one another (CfIPPI shows 78% and 77% identify to B. mori and M. sexta IPPI), phylogenetic analysis (Fig. 3) clustered the C. fumiferana protein apart from the other lepidopteran IPPIs, suggesting that there may be structural differences between the proteins. Clearly further study of HIPP isomerization by lepidopteran IPPIs, including the expression and characterization of M. sexta IPPI, may shed light on the results observed by us and others. Based on the results of SAR and inhibitor studies, and the product distribution obtained from HIPP isomerization, we conclude that the active site cavity of CfIPPI is larger than that of the corresponding vertebrate protein. In reviewing the two homology models that were prepared, CfIPPI-W-out, which has a larger active site volume due to changes in the position of the indole moiety of W216, an alternate stabilizing residue (Y104), and higher binding affinity for larger diphosphates would appear to better represent the active form of the C. fumiferana protein. In conclusion, the first detailed structural study of a lepidopteran IPPI has been presented. The enzyme from C. fumiferana displays unique properties that are consistent with its ability to catalyze the isomerization of homologous substrates for homologous juvenile hormone production. Using a combination of experimental and computation methods, we conclude that the enzyme has evolved from conventional IPPIs of the MVP and that the enzyme’s capacity to isomerize the homologous substrate HIPP is due to an increase in active site cavity volume and subtle differences in protein structure. Although its catalytic mechanism is similar to other IPPIs, the results suggest that Y105 and W216 (C. fumiferana numbering) work in concert to allow binding of larger substrates and to stabilize the high-energy intermediate formed during substrate isomerization. Acknowledgments This work was supported by NSF grant MCB-9977889 (SES and DNC) and grants from the Natural Science and Engineering Research Council of Canada and Natural Resources Canada (MC). We thank Thomas Cantinelli for the preparation of the CfIPPI-pET28 vector and Lyndsay Wood for assistance with preparative scale IPPI assays. References Baker, F.C., Lee, E., Bergot, B.J., Schooley, D.A., 1981. Isomerization of isopentenyl pyrophosphate and homoisopentenyl pyrophosphate by Manduca sexta corpora cardiaca-corpora allata homogenates. Dev. Endocrinol. 15, 67e80. Cane, D.E. (Ed.), 1999. Comprehensive Natural Products Chemistry. Isoprenoids Including Carotenoids and Steroids, vol. 2. Pergamon Press, Oxford. Claros, M.G., Vincens, P., 1996. Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur. J. Biochem. 241, 779e786. Cusson, M., Beliveau, C., Sen, S.E., Vandermoten, S., Rutledge, R.G., Stewart, D., Francis, F., Haubruge, E., Rehse, P., Huggins, D., Grant, G.H., 2006. Characterization and tissue-specific expression of two lepidopteran farnesyl diphosphate synthase homologs: implications for the biosynthesis of ethyl-substituted juvenile hormones. Proteins 65, 742e758. Davisson, V.J., Woodside, A.B., Poulter, C.D., 1985. Synthesis of allylic and homoallylic isoprenoid pyrophosphates. Meth. Enzymol. 110, 130e144. de Ruyck, J., Durisotti, V., Oudjama, Y., Wouters, J., 2006. Structural role for Tyr-104 in Escherichia coli isopentenyl-diphosphate isomerase: site-directed mutagenesis, enzymology, and protein crystallography. J. Biol. Chem. 281, 17864e17869.

750

S.E. Sen et al. / Insect Biochemistry and Molecular Biology 42 (2012) 739e750

Dolence, J.M., Poulter, C.D., 1999. Electrophilic alkylations, isomerizations, and rearrangements. Comp. Nat. Prod. Chem. 5, 315e341. Durbecq, V., Sainz, G., Oudjama, Y., Clantin, B., Bompard-Gilles, C., Tricot, C., Caillet, J., Stalon, V., Droogmans, L., Villeret, V., 2001. Crystal structure of isopentenyl diphosphate: dimethylallyl diphosphate isomerase. MBO J. 20, 1530e1537. Halgren, T.A., 1996. Merck molecular force field. I. Basis, form, scope, parameterization, and performance of MMFF94. J. Comput. Chem. 17, 490e519. Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochem. Mol. Biol. 37, 808e818. Koyama, T., Ogura, K., Seto, S., 1973. Isopentenyl pyrophosphate isomerase with artificial substrates. J. Biol. Chem. 248 (23), 8043e8051. Koyama, T., Katsuki, Y., Ogura, K., 1983. Studies on isopentenyl pyrophosphate isomerase with artificial substrates: Z-E isomerization of Z-3-methyl-3pentenyl pyrophosphate. Bioorg. Chem. 12, 58e70. Koyama, T., Matsubara, M., Ogura, K., 1985. Isoprenoid enzyme systems of silkworm. I. Partial purification of isopentenyl pyrophosphate isomerase, farnesyl pyrophosphate synthetase, and geranylgeranyl pyrophosphate synthetase. J. Biochem. 98, 449e456. Kobayashi, M., Koyama, T., Ogura, K., Seto, S., Ritter, F.J., BrueggemannRotgans, I.E.M., 1980. Bioorganic synthesis and absolute configuration of faranal. J. Am. Chem. Soc. 102, 6602e6604. Koyama, T., Ogura, K., Baker, F.C., Jamieson, G.C., Schooley, D.A., 1987. Synthesis and absolute configuration of 4-methyl juvenile hormone I (4-MeJH I) by a biogenetic approach: a combination of enzymic synthesis and biotransformation. J. Am. Chem. Soc. 109, 2853e2854. Martin, D., Piulachs, M.D., Cunillera, N., Ferrer, A., Belles, X., 2007. Mitochondrial targeting of farnesyl diphosphate synthase is a widespread phenomenon in eukaryotes. Biochim. Biophys. Acta 1773, 419e426. Matz, M.V., Alieva, N.O., Chenchik, A., Lukyanov, S., 2003. Amplification of cDNA ends using PCR suppression effect and step-out PCR. Methods Mol. Biol. 221, 41e49. McCaskill, D., Croteau, R., 1999. Isopentenyl diphosphate is the terminal product of the deoxyxylulose-5-phosphate pathway for terpenoid biosynthesis in plants. Tetrahedron Lett. 40, 653e656.

Negre, N., Hotelier, T., Volkoff, A.N., Gimenez, S., Cousserans, F., Mita, K., Sabau, X., Rocher, J., Lopez-Ferber, M., d’Alencon, E., Audant, P., Sabourault, C., Bidegainberry, V., Hilliou, F., Fournier, P., 2006. Spodobase: an EST database for the lepidopteran crop pest Spodoptera. BMC Bioinformatics. 7, 1471e2210. Pavelka, A., Chovancova, E., Damborsky, J., 2009. HotSpot wizard: a web server for identification of hot spots in protein engineering. Nucleic. Acids. Res. 37, W376eW383. Ramos-Valdivia, A.C., Van Der Heijden, R., Verpoorte, R., 1997. Isopentenyl diphosphate isomerase: a core enzyme in isoprenoid biosynthesis. A review of its biochemistry and function. Nat. Prod. Rep. 14, 591e603. Reardon, J.E., Abeles, R.H., 1986. Mechanism of action of isopentenyl pyrophosphate isomerase: evidence for a carbonium ion intermediate. Biochemistry 25, 5609e5616. Satterwhite, D.M., 1985. Isopentenyldiphosphate D-isomerase. Meth. Enzymol. 110, 92e99. Schooley, D.A., Judy, K.J., Bergot, B.J., Hall, M.S., Siddall, J.B., 1973. Biosynthesis of the juvenile hormones of Manduca sexta. Labeling pattern from mevalonate, propionate. Proc. Natl. Acad. Sci. U S A 70, 2921e2925. Schooley, D.A., Baker, F.C., Tsai, L.W., Miller, C.A., Jamieson, G.C., 1984. Juvenile hormones 0, I, and II exist only in Lepidoptera. Biosynth., Metab. Mode Action Invertebr. Horm., 373e383. Sen, S.E., Hitchcock, J.R., Jordan, J.L., Richard, T., 2006. Juvenile hormone biosynthesis in M. sexta: substrate specificity of insect prenyltransferase utilizing homologous diphosphate analogs. Insect Biochem. Mol. Biol. 36, 827e834. Wouters, J., Oudjama, Y., Barkley, S.J., Tricot, C., Stalon, V., Droogmans, L., Poulter, C.D., 2003. Catalytic mechanism of Escherichia coli isopentenyl diphosphate isomerase involves Cys-67, Glu-116, and Tyr-104 as suggested by crystal structures of complexes with transition state analogues and irreversible inhibitors. J. Biol. Chem. 278, 11903e11908. Wouters, J., Oudjama, Y., Stalon, V., Droogmans, L., Poulter, C.D., 2004. Crystal structure of the C67A mutant of isopentenyl diphosphate isomerase complexed with a mechanism-based irreversible inhibitor. Proteins 54, 216e221. Wang, J., Cieplak, P., Kollman, P.A., 2000. How well does a restrained electrostatic potential (RESP) model perform in calculating conformational energies of organic and biological molecules? J. Comput. Chem. 21, 1049e1074. Zheng, W., Sun, F., Bartlam, M., Li, X., Li, R., Rao, Z., 2007. The crystal structure of human isopentenyl diphosphate isomerase at 1.7A resolution reveals its catalytic mechanism in isoprenoid biosynthesis. J. Mol. Biol. 366, 1447e1458.