- Email: [email protected]
Cloning, expression and characterization of recombinant elastase from Pseudomonas aeruginosa in Picha pastoris
Available online at www.sciencedirect.com
Protein Expression and Purification 63 (2009) 69–74 www.elsevier.com/locate/yprep
Cloning, expression and characterization of recombinant elastase from Pseudomonas aeruginosa in Picha pastoris Xijin Lin a,1, Wentao Xu a,b,1, Kunlun Huang a,b,1, Xiaohong Mei a, Zhihong Liang a, Zhemin Li a, Jingxin Guo a, YunBo Luo a,* a
Laboratory of Food Safety, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China b Supervision & Testing Center of Agricultural Products Quality, Ministry of Agriculture, Beijing 100083, China Received 31 October 2007, and in revised form 20 December 2007 Available online 3 January 2008
Abstract The gene lasB from Pseudomonas aeruginosa, which encoded elastase, was cloned and firstly successfully expressed in Pichia pastoris stain KM71 under the control of AOX promoter. The effects on the recombinant elastase activities of different pH, different temperatures and different metal ions were assayed. The full-length gene (1497 bp) encodes a preproenzyme including an N-terminal signal peptide (23 aa), a propeptide (197 aa) and mature elastase (301 aa). The recombinant elastase was secreted into culture supernatants using signal sequence from lasB and showed a single band at about 34 kDa by SDS–PAGE. The recombinant elastase expression hit the highest level of approximately 450 mg/L and the specific elastolytic activity of the recombinant elastase was 130 U/ml, which was approximately 26-fold higher than that of elastase obtained from P. aeruginosa. The optimal temperature and pH of the recombinant elastase was 28 °C and 7.4, respectively. The enzyme possessed high resistance to heat, and can be activated by Ca2+. These enzyme properties suggested that it could be produced in an industrial scale and has the potential to be a commercial enzyme. Ó 2008 Elsevier Inc. All rights reserved. Keywords: Recombinant elastase; Picha pastoris; Pseudomonas aeruginosa
Elastase, catalyzing the hydrolysis of elastin, is a member of zinc metalloprotease family [1]. Elastase hydrolyzes insoluble elastin much more efficiently than other protease and has been widely applied in many aspects, such as a medicine curing hyperlipidemia and arteriosclerosis [2], producing soluble elastin which could be used in cosmetics [3] and as meat tenderizer in food industry [4,5]. Elastase is mainly produced by bacteria and animals. Among the microbial elastases, the elastase produced by Pseudomonas aeruginosa has been studied thoroughly. P. aeruginosa is an opportunistic pathogen and can produce many toxic substances during fermentation such as exotoxin A [6], so elas*
1
Corresponding author. Fax: +86 10 6273 6479. E-mail address: [email protected] (Y.B. Luo). These three authors contributed equally.
1046-5928/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2007.12.011
tase gene is highly necessary for heterologous expression in a new host of safety and efficiency. The P. aeruginosa elastase gene lasB was first cloned and sequenced by Iglewki [7] and then the elastase gene was successfully expressed in Escherichia coli [7] and Pseudomonas putida [8] as intracellular protein. But difficulties in the purification of non-secreted elastase make it uneconomical for large-scale industrial application. Pichia pastoris, a highly developed expression system for largescale expression of heterologous protein, is an ideal alternative for its high production and high secretion efficiency [9]. In this study, the elastase gene lasB from Pseudomonas aeruginosa was firstly expressed in P. pastoris. High yield of elastase was achieved in this expression system with little changes in enzyme properties.
70
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
Materials and methods Microorganisms, vectors and materials The strain of P. aeruginosa (No. l0647) was obtained from Agricultural Culture Collection of China (Beijing, China). E. coli DH5a (Laboratory of Food Safety, CAU, Beijing, China) was used as the host for genetic cloning. P. pastoris KM71 (arg4 aox1::ARG4) and vector pPIC3.5K (Invitrogen, San Diego, USA) were used for protein expression. Pyrobest Taq DNA polymerase and endonucleases were obtained from Takara (Dalian, China). Elastin and Elastin-Congo Red were purchased from Sigma (St. Louis, USA). All other chemicals were of analytical grade and obtained from the local commercial resources. Cloning of full-length CDS of lasB and sequence analysis The genomic DNA was extracted from P. aeruginosa which was cultured for 24 h at 37 °C in LB liquid medium using a CTAB method [10]. The cloning primer sequences were designed according to GenBank (Accession No. M19472) as follows: 50 >CGGGATCCATGAAGAAGG TTTCTACGCTT<30 (sense primer containing ATG start codon) and 50 >GCGAATTCTTACAACGCGCTCGG<30 (anti-sense primer). The BamHI and EcoRI restriction sites were designed into the sense primer and anti-sense primer, respectively. After initial denaturation at 94 °C for 5 min, the PCR reaction was carried out using Pyrobest Taq polymerase. The conditions for each cycle were as follows: denaturation at 94 °C for 30 s, annealing at 63 °C for 30 s, and extension at 72 °C for 1.5 min. A final extension step for 10 min at 72 °C was added at the end of the 35 cycles. Amplified PCR products were ligated into pGEM-T Easy vector (Promega, USA) and the resultant recombinant plasmids were sequenced. Then the correct plasmid was digested with BamHI and EcoRI and ligated into pPIC3.5K with the same enzymic sites, generating pPIC3.5K/PAE. The insertion was identified by restriction analysis and sequencing. Transformation of P. pastoris with pPIC3.5K/PAE An amount of 10 lg recombinant plasmid (pPIC3.5K/ PAE) was linearized with SacI, and electroporated into P. pastoris KM71 under the following conditions: 1.5 kV, 25 lF, and 200 X, using a GenePulser (Bio-Rad, USA). The transformants were selected at 28 °C on the MD agar plates (1.34% YNB, 2% glucose, 4 105% biotin) for 2–4 days. The integration of the lasB into the genome of P. pastoris was confirmed by PCR using 5’AOX1 primer: 50 >TACTATTGCCAGCAT TGCTGC<30 and 30 AOX1 primer: 50 >GACTGGTTCCAAGACAAGC<30 . Screening of high expression transformants According to Mei et al. ,[11], the His+ transformants were grown in microtiter plates until all clones were at
the same density. Then, the His+ transformants were spotted on YPD plates containing G418 at a final concentration of 0, 1.0, 2.0, 4.0 mg/ml. The plates were incubated at 28 °C for 4 days. Expression of recombinant P. pastrois KM71 strains in shaking flask The colonies were inoculated into 10 mL BMGY medium (100 mM potassium phosphate (pH 6.0), 1.34% YNB, 4 105% biotin, 2% peptone, 1% yeast extract and 1% glycerol) and shaken (250 rpm) at 30 °C. The cells were collected by centrifugation (4000 rpm, 10 min) until OD600 reached 2–6 and then resuspended in 10 mL BMMY medium (BMGY with 0.5% methanol instead of 1% glycerol) and transferred into a 100 mL culture flask. The culture was shaken for 5 d at 30 °C. To maintain induction, 100% methanol was supplemented every 24 h to a final concentration of 1% throughout the induction phase. The concentration of protein in supernatant was measured by the method of Brandford [12]. SDS–polyacrylamide gel electrophoresis (SDS–PAGE) The molecular mass of the recombinant enzyme was determined by using SDS–PAGE (12% polyacrylamide) [13]. A volume of 16 lL of the supernatant was added into each lane of the gel. After electrophoresis, the gel was stained with Coomassie Brilliant Blue R-250, and destained by washing with a mixture of acetic acid–methanol–water (10:25:65, v/v/v). Elastase activity assay Agar plate containing 1.5% skim milk powder and 50 mM Tris–HCl buffer (pH 7.0) was used to identify elastase proteolytical activity. Clearing zone due to proteolysis appeared within 1–2 h at room temperature,. The elastolytic activity was quantitatively determined by a modified method described by Morihara [14]. The reaction mixture contained 1 mL of appropriately diluted enzyme and 2 mL of 0.2 M boric acid buffer containing 10 mg Elastin-Congo Red. Digestion was carried out at proper temperature for 2 h, and terminated by 2 mL 0.7 M phosphate buffer (pH 6.0), followed by centrifugation at 3000g for 10 min. Supernatant was measured by spectrophotometer at 495 nm. One unit of elastase activity was defined as the digestion of 1 mg Elastin-Congo Red at 28 °C in 2 h at pH 7.4. Recombinant enzyme characterization Estimations of the recombinant elastase activities at different pH and temperatures were conducted using the crude enzyme. To determine the optimal pH, buffers over the range from pH 5.5–9.0 were used for diluting the enzyme and the substrate. The buffers used included
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
0.05 M MES buffer (pH 5.5–6.5), 0.02 M phosphate buffer (pH 6.5–7.5), 0.2 M boric acid buffer (pH 7.4–9.0). The reactions were run in the different buffers for 2 h at 28 °C. To estimate pH stability, the enzyme was pre-incubated in the different pH buffers for 4 h at 4 °C, and later, the substrate was added and the standard assay as described in the section of elastase activity assay. The optimal temperature was determined by the standard activity assay at various temperatures from 4 to 65 °C in 0.2 M boric acid buffer (pH 7.4). To estimate thermal stability, the enzyme was pre-incubated for 15–120 min at the different temperatures. The standard assay as described in Section 2.7 was performed after pre-incubation. To investigate the effects of different metal ions and EDTA on the recombinant elastase activities, 10 mM CuSO4, 10 mM ZnSO4, 10 mM CaCl2, 10 mM FeSO4, 10 mM MgSO4, 10 mM MnSO4, 10 mM CoCl2, 10 mM EDTA, were added separately to the reaction solution, and elastolytic activities were then measured under the standard assay as described in the section of elastase activity assay.
71
Fig. 1. Analysis of elastase activity from supernatant of a transformed P. pastoris expressing elastase on skim milk agar plate. The round filter papers were loaded with 10 ll the supernatant after induced for 1–5 days, CK1 and CK2 refers to the supernatant from P. pastoris KM71 containing pPIC3.5K and KM71, respectively.
Results Cloning and sequence analysis of elastase gene (lasB) from P. aeruginosa The lasB gene encoding elastase was amplified from the genomic DNA of P. aeruginosa using the primers designed on the basis of the nucleotide sequences of elastase from P. aeruginosa reported in GenBank and a 1497 bp PCR product was obtained. Compared with other elastase gene sequences reported in GenBank, the nucleotide sequence of the cloned DNA shared 99% homology with lasB from P. aeruginosa PA01 (GenBank Accession No. M19472). Only three bases changed (1039 C?T, 1110 T?A, 1122 T?C) (Fig. 1), but there was no difference between the deduced amino acid sequence and native elastase from P. aeruginosa (GI:151210). The obtained 1497 bp nucleotide sequence has been submitted to GenBank and the obtained GenBank Accession No. is EU265777. Comparison of the gene sequences suggests that the difference of nucleotide sequence may be attributed to strain diversity.
mately 34 kDa by SDS–PAGE analysis (Fig. 2), similar to that of the native elastase from P. aeruginosa. The optimal induction time was also determined and the highest level of the recombinant enzyme occurred after 4 days of induction (Fig. 2). Elastolytic activity did not increase after 4 days of induction (Fig. 1). The recombinant elastase was secreted into culture supernatants using signal sequence from lasB and showed a single band at about 34 kDa by SDS–PAGE (Fig. 2). As the recombinant enzyme accounts for above 93% of the total protein in supernatant (detected by densitometer),
Expression of elastase in P. pastoris The constructed vector denoted as pPIC3.5K/PAE was SacI-linearized and electroporated into P. pastoris KM71. Transformants were selected by Geneticin 418 (4.0 mg/ mL) and confirmed by the genomic PCR assay and DNA sequencing. The elastase activity of supernatant was monitored after 1, 2, 3, 4 and 5 days of methanol induction by agar plate containing skim milk powder. Hydrolysis areas, appearing as transparent zones, were measured semi-quantitatively. No elastase activity was detected in the supernatant of yeast transformant containing only pPIC3.5K (Fig. 1). The size of recombinant elastase was approxi-
Fig. 2. Analysis of supernatant expression product by SDS–PAGE. Lane 1: wild P. pastoris KM71; lane 2: protein molecular weight marker (Takara); lane 3: transformed P. pastoris without methanol induction. lanes 4–8: transformed P. pastoris after methanol induction from 1–5 days.
72
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
the purity of the recombinant elastase can meet further enzyme analysis. Characterization of the recombinant elastase One P. pastoris clone expressing the highest elastase activity was selected for characterization. The optimal pH and temperature of the recombinant elastase were 7.4 in boric acid buffer (Fig. 3) and 28 °C (Fig. 4), respectively. The pH optimum changed because of different buffers we used. We found it is obvious that the recombinant enzyme in boric acid buffer at pH 7.4 performed much better than in other buffers, so boric acid buffer (pH7.4) was chosen as the buffer for the later experiments (data not shown). The assays of enzyme resistance to different pH indicated that the recombinant elastase can preserve its activity in acidic solution (pH 3–7) at about 4 °C (Fig. 5). This was different with the native elastase from P. aeruginosa which was stable in pH 6–10 [15]. The hydronium in the reaction solution might play a role in the recombinant elastase activity, but the mechanism is still unknown. The elastolytic activity of recombinant enzyme was significantly affected by many metal ions (Zn2+, Mn2+, Fe2+,
Fig. 5. pH stability of the recombinant enzyme.
Fig. 6. Effect of metal ions and ETDA on the activities of the recombinant enzyme.
Fig. 3. Effects of pH on the activity of recombinant enzyme. pH range from 3 to 10 was used with the following buffers: 0.02 M MES buffer (pH 5.5–6.5), 0.02 M phosphate buffer (pH 6.5–7.5) and 0.2 M boric acid buffer (pH 7.4–9.0).
Co2+, Cu2+ and Cd2+) especially by Zn2+ and Cd2+, and chelating agent EDTA inhibits half of its activity (Fig. 6). However, Mg2+ has little effect on its activity, while Ca2+, which is required for elastase activity [16], could slightly increase its activity. These results were quite the same as that of the native elastase from P. aeruginosa, which also performed in the same conditions [15], except for EDTA inhibited nearly 95% of native P. aeruginosa elastase activity. The recombinant enzyme was stable against heat. Above 50% of the original activity remained after heat treatment at 46 °C for 2 h, and 90% of its activities can be preserved in room temperature for 2 h (Fig. 7). We chose the temperature range between 28 °C and 55 °C because it is the common reaction temperature range in practice, while in pervious article [14], the author chose 50–75 °C. The thermostabililty of our recombinant enzyme at 55 °C within 15 min was quite the same with the native enzyme [14]. Discussion
Fig. 4. Effects of temperature on the activity of recombinant enzyme from 4 to 65 °C.
In this study, the full-length CDS 1497 bp of lasB gene coding elastase from P. aeruginosa was cloned and expressed in P. pastoris. Elastase is initially synthesized as a precursor with a pre-pro-mature domain structure consisting of a signal peptide (23 residues), a propeptide (174 residues) and a carboxy-terminal catalytic domain (301 res-
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
73
and be stable in acidic and neutral conditions. These enzyme properties suggested that it could be produced in an industrial scale and has the potential as a commercial enzyme. Acknowledgments This work was supported by the Ministry of Agriculture and Ministry of Science and Technology of China. References
Fig. 7. Thermal stability of the recombinant enzyme.
idues) [17]. Elastase requires its propeptide for both proper folding and secretion in P. aeruginosa [18]. But whether its propeptide is still necessary or not when expressed in P. pastoris is still unknown. In our previous study, the 903 bp sequence encoding the mature protein had been expressed solely in P. pastoris, but no target protein was detected in the culture medium (unpublished data). This might indicated that PAE propeptide was still necessary for proper folding and transportation in eukaryotic expression system, but the details still need to be investigated. Pichia pastoris expressing vector pPIC3.5K lacks a-factor signal sequence for an efficient secretion. But our target protein elastase was still secreted into the medium under the control of signal sequence from lasB. The secretion signal sequence from Saccharomyces cerevisiae a-factor has been used with the most success. However, the native signal sequences from different organisms have also been used successfully for heterologous protein expression in P. pastoris [19–22]. In this paper, it is proved that signal sequence from lasB can function properly in the secretion of target protein in P. pastoris. Currently, heterologous expression is the main tool for the production of industrial enzymes. P. pastoris was one of the favorite expression hosts because of many advantages over other hosts. In this report, P. pastoris was firstly employed to express the active recombinant elastase using the signal sequence from lasB. The elastase was secreted into the medium as a major protein with 93% purity and apparent molecular mass of 34 kDa. The produced protein was easy to be purified since P. pastoris secreted a very low level of its own proteins in the medium. The recombinant elastase expression hit the highest level of approximately 450 mg/L and the specific elastolytic activity of the recombinant elastase was 130 U/mL, which was approximately 26-fold higher than that of native elastase extracted from P. aeruginosa. The optimal pH of the recombinant elastase was around 7 and the optimal temperature range of the recombinant elastase was 25–40 °C, which were basically the same with that of the native elastase. The recombinant enzyme can preserve 90% of its activities in room temperature for 2 h
[1] K. Morihara, Elastolytic properties of various proteases from microbial origin, Arch. Biochem. Biophys. 120 (1967) 68–78. [2] L. Robert, A.M. Robert, B. Jacotot, Elastin elastase atherosclerosis revisited, Atherosclerosis 140 (2) (1998) 281–295. [3] Y. Xu, G.Q. He, J.J. Li, Effective extraction of elastase from Bacillus sp. fermentation broth using aqueous two-phase system, J. Zhejiang Univ. Sci. 6B (11) (2005) 1087–1094. [4] H. Takaj, M. Kondou, T. Hisatsuka, Alkaline elastase from an alkalophilic Bacillus strain on the tenderization of beef meat, J. Agric. Food Chem. 40 (12) (1992) 2364–2368. [5] T. Considine, A. Healy, Proteolytic specificity of elastase on bovine beta-casein, Food Chem. 66 (1999) 463–470. [6] P.V. Liu, Exotoxins of Pseudomonas aeruginosa. I. Factors that influence the production of exotoxin A, J. Infect. Dis. 128 (1973) 506– 513. [7] R.A. Bever, B.H. Iglewski, Molecular characterization and nucleotide sequence of the Pseudomonas aeruginosa elastase structural gene, J. Bacteriol. 170 (1988) 4309–4314. [8] P. Braun, W. Bitter, J. Tommassen, Activation of Pseudomonas aeruginosa elastase in Pseudomonas putida by triggering dissociation of the propeptide–enzyme complex, Microbiology 146 (2000) 2565– 2572. [9] J.L. Cereghino, J.M. Cregg, Heterologous protein expression in the methylotrophic yeast Pichia pastoris, FEMS Microbiol. Rev. 24 (2000) 45–66. [10] W.T. Xu, K.L. Huang, A.K. Deng, Z.L. Liang, Y.B. Luo, Variations of tissue DNA density and nuclear DNA content in soybean lines and their impacts on the GMO quantification, Food Control 18 (2007) 1300–1306. [11] X.H. Mei, Y.L. Hao, H.L. Zhu, H.Y. Gao, Y.B. Luo, Cloning of pectin methylesterase inhibitor from kiwi fruit and its high expression in Pichia pastoris, Enzyme Microb. Tech. 40 (2007) 1001–1005. [12] M.M. Brandford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding, Anal. Biochem. 72 (1976) 248–254. [13] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [14] K. Morihara, Production of elastase and proteinase by Pseudomonas aeruginosa, J. Bacteriol. 3 (1964) 745–757. [15] K. Morihara, H. Tsuzuki, T. Oka, H. Inoue, M. Ebata, Pseudomonas aeruginosa elastase isolation, crystallization, and preliminary characterization, J. Biol. Chem. 240 (1965) 3295–3340. [16] J.C. Olson, D.E. Ohman, Efficient production and processing of elastase and LasA by Pseudomonas aeruginosa require zinc and calcium ions, J. Bacteriol. 174 (1992) 4140–4147. [17] E. Kessler, M. Safrin, Synthesis, processing, and transport of Pseudomonas aeruginosa elastase, J. Bacteriol. 170 (1988) 5241–5247. [18] K.S. Mclver, E. Kessler, J.C. Olson, D.E. Ohman, The elastase propeptide functions as an intramolecular chaperone required for elastase activity and secretion in Pseudomonas aeruginosa, Mol. Microbiol. 18 (1995) 877–889. [19] L. Briand, V. Perez, J.C. Huet, E. Danty, C. Masson, J.C. Pernollet, Optimization of the production of a honeybee odorant-
74
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
binding protein by Pichia pastoris, Protein Expr. Purif. 15 (1999) 362–369. [20] M.E. Digan, S.V. Lair, R.A. Brierley, R.S. Siegel, M.E. Williams, S.B. Ellis, P.A. Kellaris, S.A. Provow, W.S. Craig, G. Velicelebi, M.M. Harpold, Continuous production of a novel lysozyme via secretion form the yeast, Pichia pastoris, Bio/Technology 7 (1989) 160–164.
[21] N. Morel, J. Massoulie, Expression and processing of vertebrate acetylcholinesterase in the yeast Pichia pastoris, J. Biochem. 328 (1997) 121–129. [22] R.A. Cordle, M.E. Lowe, Purification and characterization of human porcolipase expressed in yeast cells, Protein Expr. Purif. 13 (1998) 30– 35.
Protein Expression and Purification 63 (2009) 69–74 www.elsevier.com/locate/yprep
Cloning, expression and characterization of recombinant elastase from Pseudomonas aeruginosa in Picha pastoris Xijin Lin a,1, Wentao Xu a,b,1, Kunlun Huang a,b,1, Xiaohong Mei a, Zhihong Liang a, Zhemin Li a, Jingxin Guo a, YunBo Luo a,* a
Laboratory of Food Safety, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China b Supervision & Testing Center of Agricultural Products Quality, Ministry of Agriculture, Beijing 100083, China Received 31 October 2007, and in revised form 20 December 2007 Available online 3 January 2008
Abstract The gene lasB from Pseudomonas aeruginosa, which encoded elastase, was cloned and firstly successfully expressed in Pichia pastoris stain KM71 under the control of AOX promoter. The effects on the recombinant elastase activities of different pH, different temperatures and different metal ions were assayed. The full-length gene (1497 bp) encodes a preproenzyme including an N-terminal signal peptide (23 aa), a propeptide (197 aa) and mature elastase (301 aa). The recombinant elastase was secreted into culture supernatants using signal sequence from lasB and showed a single band at about 34 kDa by SDS–PAGE. The recombinant elastase expression hit the highest level of approximately 450 mg/L and the specific elastolytic activity of the recombinant elastase was 130 U/ml, which was approximately 26-fold higher than that of elastase obtained from P. aeruginosa. The optimal temperature and pH of the recombinant elastase was 28 °C and 7.4, respectively. The enzyme possessed high resistance to heat, and can be activated by Ca2+. These enzyme properties suggested that it could be produced in an industrial scale and has the potential to be a commercial enzyme. Ó 2008 Elsevier Inc. All rights reserved. Keywords: Recombinant elastase; Picha pastoris; Pseudomonas aeruginosa
Elastase, catalyzing the hydrolysis of elastin, is a member of zinc metalloprotease family [1]. Elastase hydrolyzes insoluble elastin much more efficiently than other protease and has been widely applied in many aspects, such as a medicine curing hyperlipidemia and arteriosclerosis [2], producing soluble elastin which could be used in cosmetics [3] and as meat tenderizer in food industry [4,5]. Elastase is mainly produced by bacteria and animals. Among the microbial elastases, the elastase produced by Pseudomonas aeruginosa has been studied thoroughly. P. aeruginosa is an opportunistic pathogen and can produce many toxic substances during fermentation such as exotoxin A [6], so elas*
1
Corresponding author. Fax: +86 10 6273 6479. E-mail address: [email protected] (Y.B. Luo). These three authors contributed equally.
1046-5928/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2007.12.011
tase gene is highly necessary for heterologous expression in a new host of safety and efficiency. The P. aeruginosa elastase gene lasB was first cloned and sequenced by Iglewki [7] and then the elastase gene was successfully expressed in Escherichia coli [7] and Pseudomonas putida [8] as intracellular protein. But difficulties in the purification of non-secreted elastase make it uneconomical for large-scale industrial application. Pichia pastoris, a highly developed expression system for largescale expression of heterologous protein, is an ideal alternative for its high production and high secretion efficiency [9]. In this study, the elastase gene lasB from Pseudomonas aeruginosa was firstly expressed in P. pastoris. High yield of elastase was achieved in this expression system with little changes in enzyme properties.
70
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
Materials and methods Microorganisms, vectors and materials The strain of P. aeruginosa (No. l0647) was obtained from Agricultural Culture Collection of China (Beijing, China). E. coli DH5a (Laboratory of Food Safety, CAU, Beijing, China) was used as the host for genetic cloning. P. pastoris KM71 (arg4 aox1::ARG4) and vector pPIC3.5K (Invitrogen, San Diego, USA) were used for protein expression. Pyrobest Taq DNA polymerase and endonucleases were obtained from Takara (Dalian, China). Elastin and Elastin-Congo Red were purchased from Sigma (St. Louis, USA). All other chemicals were of analytical grade and obtained from the local commercial resources. Cloning of full-length CDS of lasB and sequence analysis The genomic DNA was extracted from P. aeruginosa which was cultured for 24 h at 37 °C in LB liquid medium using a CTAB method [10]. The cloning primer sequences were designed according to GenBank (Accession No. M19472) as follows: 50 >CGGGATCCATGAAGAAGG TTTCTACGCTT<30 (sense primer containing ATG start codon) and 50 >GCGAATTCTTACAACGCGCTCGG<30 (anti-sense primer). The BamHI and EcoRI restriction sites were designed into the sense primer and anti-sense primer, respectively. After initial denaturation at 94 °C for 5 min, the PCR reaction was carried out using Pyrobest Taq polymerase. The conditions for each cycle were as follows: denaturation at 94 °C for 30 s, annealing at 63 °C for 30 s, and extension at 72 °C for 1.5 min. A final extension step for 10 min at 72 °C was added at the end of the 35 cycles. Amplified PCR products were ligated into pGEM-T Easy vector (Promega, USA) and the resultant recombinant plasmids were sequenced. Then the correct plasmid was digested with BamHI and EcoRI and ligated into pPIC3.5K with the same enzymic sites, generating pPIC3.5K/PAE. The insertion was identified by restriction analysis and sequencing. Transformation of P. pastoris with pPIC3.5K/PAE An amount of 10 lg recombinant plasmid (pPIC3.5K/ PAE) was linearized with SacI, and electroporated into P. pastoris KM71 under the following conditions: 1.5 kV, 25 lF, and 200 X, using a GenePulser (Bio-Rad, USA). The transformants were selected at 28 °C on the MD agar plates (1.34% YNB, 2% glucose, 4 105% biotin) for 2–4 days. The integration of the lasB into the genome of P. pastoris was confirmed by PCR using 5’AOX1 primer: 50 >TACTATTGCCAGCAT TGCTGC<30 and 30 AOX1 primer: 50 >GACTGGTTCCAAGACAAGC<30 . Screening of high expression transformants According to Mei et al. ,[11], the His+ transformants were grown in microtiter plates until all clones were at
the same density. Then, the His+ transformants were spotted on YPD plates containing G418 at a final concentration of 0, 1.0, 2.0, 4.0 mg/ml. The plates were incubated at 28 °C for 4 days. Expression of recombinant P. pastrois KM71 strains in shaking flask The colonies were inoculated into 10 mL BMGY medium (100 mM potassium phosphate (pH 6.0), 1.34% YNB, 4 105% biotin, 2% peptone, 1% yeast extract and 1% glycerol) and shaken (250 rpm) at 30 °C. The cells were collected by centrifugation (4000 rpm, 10 min) until OD600 reached 2–6 and then resuspended in 10 mL BMMY medium (BMGY with 0.5% methanol instead of 1% glycerol) and transferred into a 100 mL culture flask. The culture was shaken for 5 d at 30 °C. To maintain induction, 100% methanol was supplemented every 24 h to a final concentration of 1% throughout the induction phase. The concentration of protein in supernatant was measured by the method of Brandford [12]. SDS–polyacrylamide gel electrophoresis (SDS–PAGE) The molecular mass of the recombinant enzyme was determined by using SDS–PAGE (12% polyacrylamide) [13]. A volume of 16 lL of the supernatant was added into each lane of the gel. After electrophoresis, the gel was stained with Coomassie Brilliant Blue R-250, and destained by washing with a mixture of acetic acid–methanol–water (10:25:65, v/v/v). Elastase activity assay Agar plate containing 1.5% skim milk powder and 50 mM Tris–HCl buffer (pH 7.0) was used to identify elastase proteolytical activity. Clearing zone due to proteolysis appeared within 1–2 h at room temperature,. The elastolytic activity was quantitatively determined by a modified method described by Morihara [14]. The reaction mixture contained 1 mL of appropriately diluted enzyme and 2 mL of 0.2 M boric acid buffer containing 10 mg Elastin-Congo Red. Digestion was carried out at proper temperature for 2 h, and terminated by 2 mL 0.7 M phosphate buffer (pH 6.0), followed by centrifugation at 3000g for 10 min. Supernatant was measured by spectrophotometer at 495 nm. One unit of elastase activity was defined as the digestion of 1 mg Elastin-Congo Red at 28 °C in 2 h at pH 7.4. Recombinant enzyme characterization Estimations of the recombinant elastase activities at different pH and temperatures were conducted using the crude enzyme. To determine the optimal pH, buffers over the range from pH 5.5–9.0 were used for diluting the enzyme and the substrate. The buffers used included
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
0.05 M MES buffer (pH 5.5–6.5), 0.02 M phosphate buffer (pH 6.5–7.5), 0.2 M boric acid buffer (pH 7.4–9.0). The reactions were run in the different buffers for 2 h at 28 °C. To estimate pH stability, the enzyme was pre-incubated in the different pH buffers for 4 h at 4 °C, and later, the substrate was added and the standard assay as described in the section of elastase activity assay. The optimal temperature was determined by the standard activity assay at various temperatures from 4 to 65 °C in 0.2 M boric acid buffer (pH 7.4). To estimate thermal stability, the enzyme was pre-incubated for 15–120 min at the different temperatures. The standard assay as described in Section 2.7 was performed after pre-incubation. To investigate the effects of different metal ions and EDTA on the recombinant elastase activities, 10 mM CuSO4, 10 mM ZnSO4, 10 mM CaCl2, 10 mM FeSO4, 10 mM MgSO4, 10 mM MnSO4, 10 mM CoCl2, 10 mM EDTA, were added separately to the reaction solution, and elastolytic activities were then measured under the standard assay as described in the section of elastase activity assay.
71
Fig. 1. Analysis of elastase activity from supernatant of a transformed P. pastoris expressing elastase on skim milk agar plate. The round filter papers were loaded with 10 ll the supernatant after induced for 1–5 days, CK1 and CK2 refers to the supernatant from P. pastoris KM71 containing pPIC3.5K and KM71, respectively.
Results Cloning and sequence analysis of elastase gene (lasB) from P. aeruginosa The lasB gene encoding elastase was amplified from the genomic DNA of P. aeruginosa using the primers designed on the basis of the nucleotide sequences of elastase from P. aeruginosa reported in GenBank and a 1497 bp PCR product was obtained. Compared with other elastase gene sequences reported in GenBank, the nucleotide sequence of the cloned DNA shared 99% homology with lasB from P. aeruginosa PA01 (GenBank Accession No. M19472). Only three bases changed (1039 C?T, 1110 T?A, 1122 T?C) (Fig. 1), but there was no difference between the deduced amino acid sequence and native elastase from P. aeruginosa (GI:151210). The obtained 1497 bp nucleotide sequence has been submitted to GenBank and the obtained GenBank Accession No. is EU265777. Comparison of the gene sequences suggests that the difference of nucleotide sequence may be attributed to strain diversity.
mately 34 kDa by SDS–PAGE analysis (Fig. 2), similar to that of the native elastase from P. aeruginosa. The optimal induction time was also determined and the highest level of the recombinant enzyme occurred after 4 days of induction (Fig. 2). Elastolytic activity did not increase after 4 days of induction (Fig. 1). The recombinant elastase was secreted into culture supernatants using signal sequence from lasB and showed a single band at about 34 kDa by SDS–PAGE (Fig. 2). As the recombinant enzyme accounts for above 93% of the total protein in supernatant (detected by densitometer),
Expression of elastase in P. pastoris The constructed vector denoted as pPIC3.5K/PAE was SacI-linearized and electroporated into P. pastoris KM71. Transformants were selected by Geneticin 418 (4.0 mg/ mL) and confirmed by the genomic PCR assay and DNA sequencing. The elastase activity of supernatant was monitored after 1, 2, 3, 4 and 5 days of methanol induction by agar plate containing skim milk powder. Hydrolysis areas, appearing as transparent zones, were measured semi-quantitatively. No elastase activity was detected in the supernatant of yeast transformant containing only pPIC3.5K (Fig. 1). The size of recombinant elastase was approxi-
Fig. 2. Analysis of supernatant expression product by SDS–PAGE. Lane 1: wild P. pastoris KM71; lane 2: protein molecular weight marker (Takara); lane 3: transformed P. pastoris without methanol induction. lanes 4–8: transformed P. pastoris after methanol induction from 1–5 days.
72
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
the purity of the recombinant elastase can meet further enzyme analysis. Characterization of the recombinant elastase One P. pastoris clone expressing the highest elastase activity was selected for characterization. The optimal pH and temperature of the recombinant elastase were 7.4 in boric acid buffer (Fig. 3) and 28 °C (Fig. 4), respectively. The pH optimum changed because of different buffers we used. We found it is obvious that the recombinant enzyme in boric acid buffer at pH 7.4 performed much better than in other buffers, so boric acid buffer (pH7.4) was chosen as the buffer for the later experiments (data not shown). The assays of enzyme resistance to different pH indicated that the recombinant elastase can preserve its activity in acidic solution (pH 3–7) at about 4 °C (Fig. 5). This was different with the native elastase from P. aeruginosa which was stable in pH 6–10 [15]. The hydronium in the reaction solution might play a role in the recombinant elastase activity, but the mechanism is still unknown. The elastolytic activity of recombinant enzyme was significantly affected by many metal ions (Zn2+, Mn2+, Fe2+,
Fig. 5. pH stability of the recombinant enzyme.
Fig. 6. Effect of metal ions and ETDA on the activities of the recombinant enzyme.
Fig. 3. Effects of pH on the activity of recombinant enzyme. pH range from 3 to 10 was used with the following buffers: 0.02 M MES buffer (pH 5.5–6.5), 0.02 M phosphate buffer (pH 6.5–7.5) and 0.2 M boric acid buffer (pH 7.4–9.0).
Co2+, Cu2+ and Cd2+) especially by Zn2+ and Cd2+, and chelating agent EDTA inhibits half of its activity (Fig. 6). However, Mg2+ has little effect on its activity, while Ca2+, which is required for elastase activity [16], could slightly increase its activity. These results were quite the same as that of the native elastase from P. aeruginosa, which also performed in the same conditions [15], except for EDTA inhibited nearly 95% of native P. aeruginosa elastase activity. The recombinant enzyme was stable against heat. Above 50% of the original activity remained after heat treatment at 46 °C for 2 h, and 90% of its activities can be preserved in room temperature for 2 h (Fig. 7). We chose the temperature range between 28 °C and 55 °C because it is the common reaction temperature range in practice, while in pervious article [14], the author chose 50–75 °C. The thermostabililty of our recombinant enzyme at 55 °C within 15 min was quite the same with the native enzyme [14]. Discussion
Fig. 4. Effects of temperature on the activity of recombinant enzyme from 4 to 65 °C.
In this study, the full-length CDS 1497 bp of lasB gene coding elastase from P. aeruginosa was cloned and expressed in P. pastoris. Elastase is initially synthesized as a precursor with a pre-pro-mature domain structure consisting of a signal peptide (23 residues), a propeptide (174 residues) and a carboxy-terminal catalytic domain (301 res-
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
73
and be stable in acidic and neutral conditions. These enzyme properties suggested that it could be produced in an industrial scale and has the potential as a commercial enzyme. Acknowledgments This work was supported by the Ministry of Agriculture and Ministry of Science and Technology of China. References
Fig. 7. Thermal stability of the recombinant enzyme.
idues) [17]. Elastase requires its propeptide for both proper folding and secretion in P. aeruginosa [18]. But whether its propeptide is still necessary or not when expressed in P. pastoris is still unknown. In our previous study, the 903 bp sequence encoding the mature protein had been expressed solely in P. pastoris, but no target protein was detected in the culture medium (unpublished data). This might indicated that PAE propeptide was still necessary for proper folding and transportation in eukaryotic expression system, but the details still need to be investigated. Pichia pastoris expressing vector pPIC3.5K lacks a-factor signal sequence for an efficient secretion. But our target protein elastase was still secreted into the medium under the control of signal sequence from lasB. The secretion signal sequence from Saccharomyces cerevisiae a-factor has been used with the most success. However, the native signal sequences from different organisms have also been used successfully for heterologous protein expression in P. pastoris [19–22]. In this paper, it is proved that signal sequence from lasB can function properly in the secretion of target protein in P. pastoris. Currently, heterologous expression is the main tool for the production of industrial enzymes. P. pastoris was one of the favorite expression hosts because of many advantages over other hosts. In this report, P. pastoris was firstly employed to express the active recombinant elastase using the signal sequence from lasB. The elastase was secreted into the medium as a major protein with 93% purity and apparent molecular mass of 34 kDa. The produced protein was easy to be purified since P. pastoris secreted a very low level of its own proteins in the medium. The recombinant elastase expression hit the highest level of approximately 450 mg/L and the specific elastolytic activity of the recombinant elastase was 130 U/mL, which was approximately 26-fold higher than that of native elastase extracted from P. aeruginosa. The optimal pH of the recombinant elastase was around 7 and the optimal temperature range of the recombinant elastase was 25–40 °C, which were basically the same with that of the native elastase. The recombinant enzyme can preserve 90% of its activities in room temperature for 2 h
[1] K. Morihara, Elastolytic properties of various proteases from microbial origin, Arch. Biochem. Biophys. 120 (1967) 68–78. [2] L. Robert, A.M. Robert, B. Jacotot, Elastin elastase atherosclerosis revisited, Atherosclerosis 140 (2) (1998) 281–295. [3] Y. Xu, G.Q. He, J.J. Li, Effective extraction of elastase from Bacillus sp. fermentation broth using aqueous two-phase system, J. Zhejiang Univ. Sci. 6B (11) (2005) 1087–1094. [4] H. Takaj, M. Kondou, T. Hisatsuka, Alkaline elastase from an alkalophilic Bacillus strain on the tenderization of beef meat, J. Agric. Food Chem. 40 (12) (1992) 2364–2368. [5] T. Considine, A. Healy, Proteolytic specificity of elastase on bovine beta-casein, Food Chem. 66 (1999) 463–470. [6] P.V. Liu, Exotoxins of Pseudomonas aeruginosa. I. Factors that influence the production of exotoxin A, J. Infect. Dis. 128 (1973) 506– 513. [7] R.A. Bever, B.H. Iglewski, Molecular characterization and nucleotide sequence of the Pseudomonas aeruginosa elastase structural gene, J. Bacteriol. 170 (1988) 4309–4314. [8] P. Braun, W. Bitter, J. Tommassen, Activation of Pseudomonas aeruginosa elastase in Pseudomonas putida by triggering dissociation of the propeptide–enzyme complex, Microbiology 146 (2000) 2565– 2572. [9] J.L. Cereghino, J.M. Cregg, Heterologous protein expression in the methylotrophic yeast Pichia pastoris, FEMS Microbiol. Rev. 24 (2000) 45–66. [10] W.T. Xu, K.L. Huang, A.K. Deng, Z.L. Liang, Y.B. Luo, Variations of tissue DNA density and nuclear DNA content in soybean lines and their impacts on the GMO quantification, Food Control 18 (2007) 1300–1306. [11] X.H. Mei, Y.L. Hao, H.L. Zhu, H.Y. Gao, Y.B. Luo, Cloning of pectin methylesterase inhibitor from kiwi fruit and its high expression in Pichia pastoris, Enzyme Microb. Tech. 40 (2007) 1001–1005. [12] M.M. Brandford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding, Anal. Biochem. 72 (1976) 248–254. [13] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [14] K. Morihara, Production of elastase and proteinase by Pseudomonas aeruginosa, J. Bacteriol. 3 (1964) 745–757. [15] K. Morihara, H. Tsuzuki, T. Oka, H. Inoue, M. Ebata, Pseudomonas aeruginosa elastase isolation, crystallization, and preliminary characterization, J. Biol. Chem. 240 (1965) 3295–3340. [16] J.C. Olson, D.E. Ohman, Efficient production and processing of elastase and LasA by Pseudomonas aeruginosa require zinc and calcium ions, J. Bacteriol. 174 (1992) 4140–4147. [17] E. Kessler, M. Safrin, Synthesis, processing, and transport of Pseudomonas aeruginosa elastase, J. Bacteriol. 170 (1988) 5241–5247. [18] K.S. Mclver, E. Kessler, J.C. Olson, D.E. Ohman, The elastase propeptide functions as an intramolecular chaperone required for elastase activity and secretion in Pseudomonas aeruginosa, Mol. Microbiol. 18 (1995) 877–889. [19] L. Briand, V. Perez, J.C. Huet, E. Danty, C. Masson, J.C. Pernollet, Optimization of the production of a honeybee odorant-
74
X. Lin et al. / Protein Expression and Purification 63 (2009) 69–74
binding protein by Pichia pastoris, Protein Expr. Purif. 15 (1999) 362–369. [20] M.E. Digan, S.V. Lair, R.A. Brierley, R.S. Siegel, M.E. Williams, S.B. Ellis, P.A. Kellaris, S.A. Provow, W.S. Craig, G. Velicelebi, M.M. Harpold, Continuous production of a novel lysozyme via secretion form the yeast, Pichia pastoris, Bio/Technology 7 (1989) 160–164.
[21] N. Morel, J. Massoulie, Expression and processing of vertebrate acetylcholinesterase in the yeast Pichia pastoris, J. Biochem. 328 (1997) 121–129. [22] R.A. Cordle, M.E. Lowe, Purification and characterization of human porcolipase expressed in yeast cells, Protein Expr. Purif. 13 (1998) 30– 35.