Cloning, expression and characterization of the Sau3AI restriction and modification genes in Staphylococcus carnosus TM300

Gene. 94 (1990) 37-43 Elsevier

37

GENE 03686

Cloning, expression and characterization of the S a u 3 A I restriction and modification genes in S t a p h y l o coccus carnosus TM300 (Recombinant DNA; Staphylococcus aureus 3A; restriction endonuclease; DNA methyltransferase; sau3AIR and sau3AIM sequences; plasmids)

Stefan Seeber', Christoph Kessler b and Friedrieh GOtz" ° Mikrobielle Genetik, Universit~t Tiibingen, D.7400 Tiibingen (F.R.G.) and b Boehringer Mannheim GmbH, Biochemical Research Center, Department of Genetics, D-8122 Penzberg (F.R.G.) Tel. + 49-8856-60-2724/2867 Received by H.G. Zacban: 26 January 1990 Revised: 19 March 1990 Accepted: 20 May 1990

SUMMARY

The genes encoding the restriction enzyme (ENase) and modification enzyme (MTase) of Staphylococcus aureus 3A (recognition sequence 5'-GATC-3') have been cloned in Staphylococcus carnosus TM300 using the vector pCA44. Clones carrying both genes were isolated from DNA libraries prepared with Mbol + BamHI. The DNA region encoding M. Sau3AI was subcloned on a 3.66-kb EcoRV fragment in vector pT181mcs. Plasmids purified from the clones were resistant to digestion with Sau3AI, indicating that the sau3AIM gene was expressed and the product was functional in S. carnosus. Cell lysates of clones with both activities encoded on plasmid pSEM7, cut DNA with the same pattern as Sau3Al, showing that the sau3AIR gene was also expressed and the ENase was functional in S. carnosus. Sequence analysis shows that both genes are transcribed in the same direction and encode polypeptides with calculated Mrs of 56477 for R. Sau3Al and 47 300 for M" Sau3AI, Efforts to clone one or both genes in Escherichla coli have so far failed.

INTRODUCTION

Restriction-modification (R-M) systems of class-l, -II and -III in bacteria are thought to be defense mechanisms Correspondenceto: Dr. F, G6tz, MikrobieUe Genetik, Universititt Ttibingen, Auf der Morgenstelle 28, D-7400 Tflbingen (F.R.G.) Tel. + 49.7071-29-4636; Fax + 49-7071-29-4634. Abbreviations: aa, amino acid(s); bp, base pair(s); SmC,5-methyl cytosine; Cm, chloramphenicol; d, deletion; ENase (symbol R .), restriction endonuclease; Exolll, E. coliexonuclease III; kb, kilobase(s) or I000 bp; M, modification; mer, modified cytosine restriction; mcs, multiple cloning site; MTase (symbol M .), methyltransferase; nt, nucleotide(s), ORF, open reading frame; ori, origin of DNA replication; PAGE, polyacrylamide-gel electrophoresis; psi, pounds/square inch; R, resistance; R, restriction; R-M, restriction-modification; S., Staphylococcus; s sensitivity; sau3AIM, gene encoding M. Sau3AI; sau3AlR, gene encoding R. Sau3AI; SD, Shine-Dalgarno; SDS, sodium dodecyi sulfate; Tc, tetracycline; [ ], denotes plasmid-carrier state. 0378-1119/90/$03.50© 1990ElsevierScience PublishersB.V.(BiomedicalDivision)

against intruding DNA molecules (Modrich and Roberts, 1982). They consist of two enzyme activities: (I) ENase recognizes and cuts nonmodified and thus unprotected DNA at a specific recognition sequence, and (2)MTase protects DNA from restriction by the ENase by specific methylation of at least one particular nt in the same sequence. In this way the various R-M systems protect against phage infection. This phage immunity was the basis of the development of the International Phage Typing System for S. aureus (Williams and Rippon, 1952) as an epidemiological tool to characterize different strains of S. aureus. According to their phage patterns, the strains can be divided into four groups. Differences among the groups are mainly due to R-M activity. Extracts ofgroup II contain the same class-II ENases and the corresponding MTases (Stobberingh et ai., 1977). Sussenbach et al. (1976) first isolated the type-If restriction enzyme Sau3Al (or R. Sau3AI)

38 from group II S. aureus 3A. It recognizes the sequence 5'~-GATC-3', cleaving 5' to the G residues on each strand. M . Sau3AI modifies the C residues on both strands to form 5'-GATSmC-3'. Hemimethylated DNA occurs transiently during nascent replication when the newly synthesized DNA is not yet methylated. This renders the DNA resistant to a double-strand cleavage; however, Sau3AI introduces nicks into the unmethylated strand. Only complete methylation on both strands makes the site completely resistant to Sau3AI-cleavage (Streeck, 1980). Sau3AI has been available for many years and has become one ofthe most important restriction enzymes (e.g., in combination with BamHI (5'-~G/GATCC-3 ') for establishing gene libraries). M . Sau3AI (up to now not available) could also be of practical interest for methylating DNA (see e.g., Koob et al., 1988). More than 100 R-M systems have been completely or partially cloned ,IWilson, 1988). All R-M systems have been cloned in E. co,!i. The aim of the present study is to clone 1

2

3

4

5

6

and express the R-M system in another host bacterium, S. carnosus TM300 (Schleifer and Fischer, 1982; GOtz, et al., 1983), and determine the sequences of the sau3AIR and sau3AIM genes.

RESULTS AND DISCUSSION (a) Bacterial strains, plasmids, media and transformation

S. aureus 3A was used as the D N A donor strain. S. carnosus TM300 (Schleifer and Fischer, 1982), E. coli JM83 (ara, Alac-proAB, rpsL, dp8OlacZAM15) (YanischPerron et al., 1985), E. coil ERI451 (rectA-, B - ) (New England Biolabs, Inc. strain collection) and E. coli K802 (rectA-, B - ) (Bachmann, 1987) were used as cloning hosts. The staphylococcal strains and E. coliwere cultivated in B-broth (10 g peptone/5 g yeast extract/5 g NaCl/1 g glucose/ 1 g K2HPO4 per litre pH 7.2) and on B-agar containing 1.2% Difco Agar (Detroit, MI). The construction and 7

8

9

10 11 12 13

Fig. !. In vivo methylation by M. Sau3Al renders DNA resistant to R. Sau3Al cleavage, The presence of M, Sau3AI activity in recombinant 8. carnosus

clones was tested by grouping five clones together, isolating the plasmids, cutting the DNA with $au3Al and examining the digests by agarose gel electrophoresis. DNA from M. Sau3Al.expressing clones (C5 methylated)was resistant to R. Sau3AI digestion because of in vivo sau3AIM expression and activity.The clones in the M-positive groups were separated and independently retested, leading to the isolation of pSEM7 and pSEMI1, both of which contained the cloned sa~AIM gene. Lanes: I and 2, S. aureus 3A chromosomal DNA incubated for I h at 37°C with $au3Al and as a control with the isoschizomer Mbol, respectively (Mbol does not cleave N6 A-methylatedDNA but cleaves CS.methylatedDNA); 3 and 6, pSEM7 (14.3 kb) and pSEM! 1 (15.2kb) DNA, respectively (see Fig.3a); 4 and S, pSEM7 incubated with Sau3Al and Mbol, respectively; 7 and 8, pSEM!1 incubated with Sau3Al or Mbol, respectively; 9 and 10, phage ~.DNA digested with H/ndlll as size standards (Boehringer-Mannheim). Subcloned M" $au3Al activity is evaluated in lanes 11-13; sa~AIM was subcloned on pTSMI (see Fig.3b). Lanes: 11, uncut pTSMI; 12 and 13, pTSM1 cleavedwith $au3Al or Mbol, respectively. Digests were analyzed by electrophoresis on 0.8% agarose gels (Sambrook et al., 1989).

39 detection of S. carnosus M . S a u 3 A I - and R ' S a u 3 A I active recombinants are explained in the figure legends. (b) Cloning of sau3AIR and s a u 3 A I M in Staphylococcus carnosus TM300

Two out of approx. 800 transformants tested showed resistance to Sau3Al digestion due to the expression of a cloned sau3AIM gene. These two recombinant plasmids, pSEM7 and pSEMI 1, both showed the same insensitivity to Sau3Al digestion as the chromosomal DNA ofS. aureus 3A (Fig. 1). However, not all Sau3Al sites appeared to be completely methylated on both DNA strands, since after incubation with Sau 3AI the amount of the covalently closed circular fo.,'m of pSEM7 and pSEMI 1 decreased and the amount of the open circular form increased. The nicks were very likely created at the half-modified Sau3Al recognitio~ sites. The same phenomenon occurred with pSEM7 transformed and isolated from S. aureus 3A, when incubated with Sau3AI (data not shown). A possible interpretation is

1

2

3

4

5

that during plasmid replication, half-modified plasmids were generated which could serve as targets for Snu3Al. In all known R-M systems, the restriction and modification genes are located near each other. Therefore, cell extracts of the two positive clones were prepared and tested for the presence of R. Sau3Al by incubating with plasmid pBR322. Both clones had M. Sau3Al activity as well as R . Sau3Al activity. Fig. 2 shows the restriction patterns obtained with the cloned R- Sau3Al in comparison to that with commercially available enzyme. S. camosus had no detectable restriction activity on pBR322. (e) Localization of sau3AIR and sau3AIM on pSEM7 The smaller recombinant plasmid pSEM7 carries a 9.6-kb insert. A restriction map was determined (Fig. 3a) and the localization of the sau3AIR and sau3AIM genes was determined by constructing various deletions and subclones (Fig. 3c). The Bcll-Bcll and Nrul-Hpal deletions had no influence on the R-M activity, while the Ncil-Hpal and the Nrul-Scal deletions led to a loss of the restriction or both activities, respectively. The sau3AIM gene was subcloned on a 3.66-kb EcoRV fragment in the Srnal site of pTlSlmcs, forming pTSM1 (Figs. 1 and 3b), which expressed only MTase activity. The sau3AIM gent expression was independent of its orientation in the vector~ These results not only led to the localization of the R-M gc~es on pSEM7, but also indicated that both genes have their own promoters.

(d) Nueleotide sequence of the Sau3A!

Fig. 2. S. carnosus TM300[pSEM7] cells express R. Sau3AI activity. For lanes 2 and 4, crude extracts from M-active S. carnosus clones (prepared by French-press treatment of cells twice with 16000psi) containingthe respectiveplasmidswerepreparedand 1/~1was added to !/~g pBR322 DNA, incubatedfor I h at 37°C and analyzedon a 0.8% agarose gel (Sambrook et al., 1989). Lanes: t, pBR322 control; 2, pBR322 and pSEM7 extract; 3, pBR322 and commercial Sau3Al (Boehringer-Mannheim); 4, pBR322 and S. carnosus pCA44 extract (negative control); 5, see Fig. I, lanes 9 and 10.

R . M system Efforts to subclone the entire R - M genes in several E. coli strains (JM83, ERI451, K802) failed. There are strong indications that the cloning of either the complete R - M system or sau.~AIM alone is not possible in any E. coli strain tested. Only fragments carrying the incomplete genes could be subcloned into Xbal site of pUCI9 (l.3-kb Sall-Ncil, 1.7-kb Ncil-Scal and 2. l-kb EcoRV-$cal fragment). Each subclone was deleted from both ends with Exolll. A set of Exolll clones was isolated, each differing by 100-250 nt. The Exolll clones were sequenced using universal and reverse sequencing primers. The nt sequence revealed two major ORFs transcribed in the same direction (Fig. 4). Based on mapping and aa sequence data, sau3AIM and sau3AIR can be unequivocally positioned. R. Sau3AI is encoded by an ORF that extends from nt 448 to 1914. M. Sau3AI encoded by the ORF that begins at nt 2017 and ends with nt 3252. There is a putative SD-sequence (Shine and Dalgarno, 1974) 5 ' - A G G G G - 3 ' , six nt upstream of the TTG start codon of sau3AIR. A G + C-rich SD sequence is typical for Gram bacteria (McLaughlin et al., 1981). The identity and the translational start of the sau3AIR reading frame was confirmed by sequencing the first 23 aa of the N

40

a

terminus of the purified enzyme. Staphylococci utilize mainly ATG, but TTG and GTG are also used as translation start codons. Therefore R.Sau3AI consists of 489 aa with a predicted Mr of 56477. This agrees with the migration behaviour ofpurified R. Sau3AI in SDS-PAGE (Fig. 5). There is a putative SD sequence (5'-AGGAGGT-3') 6 nt upstream from the sau3AIM ATG start codon. This sequence is completely homologous to the 3' end ofthe 16S rRNA of S. camosus (Neff, 1987) indicating a higher colnplementarity between the 16S rRNA and the mRNA and, therefore, a stronger translational start signal than the less homologous sequence of sau3AIR. Together with the less frequently used start codon of sau3AIR, this might constitute a regulatory effect resulting in a more efficient expression of sau3AIM than sau3AIR. The sau3AIM reading frame encodes a 412-aa protein with a predicted Mr of

Psti Hindlll

EcoRV ~ Ec°RV

styl\I!

E~oRV\ Haell

A ~

Haell

~

L.._.=__

arsB

or/

I ,

~'~'~"

cat "~\ i _ i - i _ 2eO0/ arsC'~/Ec°Rl

"~r,,.~r,

EcoRvX'bal~

Bsn

.

14000

....~12000

I

PsEM~

Ik

I ~xba~

.....

[.

, =.=m=,

'=

" Bell 'edL

BstNI" . ~ HindllF ; 1 EcoRV Ncil Haell

\ EcoRl Sail

b ~ Sphl Pstl Xba[~

.

//

Fig. 3. (a) Restriction map of pSEM7 containing genes sau3AIR and sau3AIM. Plasmid pSEM7 was constructed as follows: S. aureus chromo-

Xbal

~.-. --r-

~\

"

col

.......

~Sacl Kpni

~

Ecoll / ~ Seal

~coRV D¢letioa

•

•

E¢oRV

!

"

.

IH~!

i o,i

sI= , "

i

•

,

.

i

.

'.

iNmi .

Pheu0~vi~ a M

a

~uu3,41M suuJ~41R ~Bcll Bci!

A, ....

•

~XNmi• Hpal

A~lmi Seal •

pTSMI

A

r

A

" "

'

12(XX) ' I

I

r~

I

I

I

I

'

÷

÷

÷

+

-

+

u

_

-

÷

somal DNA was prepared by the cleared lysate method (Novick and Bouanchaud, 1971) using 15/~g/ml of lysostaphin for iysis of the cells, followed by CsCI centrifugation. The DNA was partially digested with Mbol and 7-15-kb fragments were enriched by electroelution ~ e r ngarose.gel electrophoresis. The fragments were ligated to BamHI.cut and AP-treated vector pCA44, a 4.7-kb $caI.l~ulI.deletion derivative of pCA43 (Kreutz and G6tz, 1984). The ligation mixture was transformed into 5. carnosus TM300 by polyethyleneglycol-inducedprotoplast fusion (O6tz and Schumacher, 1987). Large-scale plasmid DNA isolation from S. carnosus was performed as described previously (G0tz et al., 1983); minipreparations were performed essentially by the alkaline lysis method (Birnboim and Doly, 1979) except that l$gg/ml of lysostaphin was incubated with the cells for 10 min at 37°C before lysis with NaOH/SDS. The gene library was screened for in vivo MTase activity as described in Fig. I. Heavy black line indicates the insert in vector pCA44. The arsC gene was divided into two inactive parts (arsC') by the cloning event, permitting an arsenate-sensitive prescreening of'the DNA library (Kreutz and G0tz, 1984). Arrows indicate orientations of the genes. (b)Restriction map of plasmid pTSMI. Piasmid pTSM! was derived by inserting the 3.66-kb EcoRV fragment containing the sau3AIM gene from pSEM7 into the vector pTlSImcs. This vector was derived from pTl81 (Kahn and Novick, 1983) by inserting a 320 bp Pmll-fragment with the mcs of pUCI9 in the Ndel site. The heavy black line represents the insert in vector pTl81mcs. Arrows indicate orientations of the genes and or/. sau3AIR' indicates that the sau3AIR is Y-truncated and functionally inactive. (e) Deletion analysis of pSEM?. The open bars indicate the nt sequences remaining in the various derivatives. Detection of MTase activity is described in Fig. 1; ENase activity is illustrated in Fig. 2. Scale at the bottom is in bp.

Fig. 4. Nucleotide sequence ,~fsau3AIR and sau3AIM. The sequence starts at the Sail site and ends arbitrarily. The two large ORFs are translated into an sequence. The sau3AIR ORF starts at nt 448 with a Leu codon; however, in the protein the first aa is a Met (underlined in sequence). The formyl-group was probably removed. The sa~dAIR ORF ends at nt 1914.The sau3AIM ORF spans nt 2017-3252. The stop codons are indicated by asterisks. Possible SD sequences are overlined. Important restriction sites are indicated, The gene fragments for sequencing were subcloned in pUCl9 and transformed into E. coli (Cohen et al., 1972). E. coil plasmids were prepared by the procedure of Bimboim and Doly (1979). Subclones for DNA sequencing were prepared by targeting of deletions according to Henikoff (1984). Dideoxy-nt sequence analysis (Sanger et al., 1977) was carried out by sequencing supercoiled plasmid DNA (Chen and Seeburg, 1985). Gel electrophoresis was performed using an Na. acetate gradient in the polyacrylamide gel as described by Earl et al. (1987). Restriction endonucleases, T4 DNA ligase, Klenow enzyme, alkaline phosphatase, S I nuclease and ExoIII (BoehringerMannheim) and T7 DNA polymerase (Pharmacia) were used according to the manufacturer's specifications.

41 salX SO AA61'OGAC~I'I'CAP.AIIOA~'~_ _-_t'_n-_s+a,~,• ~.~.G~GTATA(.~;~.G~tGTACCkI~'~=UI"J~

||N

A~4CCkCkCkCrAkT~4Ca~,ACT~ ~J~V~'XCCm~ k~InOa~elmr~pryramPSLV~lykraanAXUalU.yslamlm~Im.

120

ACTATCATT~ATCCATAA~.

~ • +& T C C k T T G T T G C T A f t A C A ~

110

LUO Id~GATTAACT~ATTkkTAGACCT~CTCAGkT~,TT&TTC~ATGAGT~ATGkCT~ L¥oX~ad~nT~TXlWumA~llm~pSerAsP~istYrSeraml~/vTrlp~4~

~40 AATIL'IP.AGTTAGACS~AAT~_~_~.P.ATGNtAACTAAAGCCCTTACATTT&TGTAATGAATT

r-J4ADGTTTTTSOATAAAT&IkTaA~'~&EATAAAAAAGCAkv 8~vAJkGATTTA~ GlnSerl~qiTlrplHLldUillk~ndUIpTyrZ]LeLyliLylGJLaVLILGluksp~ •

3OO ATJUtAGAAATACGCCCCitAAAGT_~_~_s_~_~_s_s.CACAGCCCCAAGACIU~TA~ +, ~ACAAGT

AAGTATGTT~A~.

360 ATT&TATAATAGA~+'T&Tn~I_I_I_I.TGCATGGAGTAGAT+~PAA~TA~~

1920

l~Oil 1980 • ~ 6+dIJIATATCGIUI~+k~.~6&I • • ~ 6 . J

2040 TATJU~TAAGGSLTGItATTAAGT&T~AATGAAT~_S_A_A.TTAIIAGTAGTAGAA Ille~Asnl,ys r LaLysVelVa|Gtu

420 TGT~TTCT&TATAATTATATT&TTGIU~TTTTAAATA~TA 480 & T ~ & T T T A A T G T T A A ~ T A A ~-~-¢~vGAAAGTT&~_s_s_s_s.~t AGCCGTACAT Ne~GJI.u.ser~r~LmuTh=LysG~LnAJ~4V4JLH~s 54O

AATCGCG~_.L_s~_S.GAAG CTGTTGGT.S_s_~sG T G T & T T A G A A T T A A A ~ T C G & ~ AsnArqAJLilLysG JLuAtilVI tGlyLyllSllrVil JLLttuOJLuLdlUAIInGJLyGI y G I u S e r : 1o

6O0 AAACAkAGTAAGAGTTCkGTTGGTG&TGCATT~AkAATI~GTTT~GTN~~C LysG~nSerLysSorSorVa IGXyAopAt aPheGJLuAsnTrpPheGtyLysLysLysAsp AGTGATAGTAAACCAGATATGGCAGAAGCTGGGGTGGAA~'~PTAAGGCAACGI~kTTTAAA SerAIIpSO : L y s ProAIIIN411~IilG i uA JL41GLyVa LGluLIluLyaAlllTItrPro PitolLyll ?20 AAGTTGAAAAACGGAAAGTATAGCTCCAJ~GF-~GATTAGTATTAAAT&TT&TAAA~AT Lyol~u~-ys&snGlYLySTyrserSerLymGLuArqLeuVaLLauAsnl l e I l e A u n ' l ~ 780 GAGAAAGTGGCAAATG.S_s-s-S.TTTTGAAACTAGT&G~• • ~-~ATCTAAGAATAAT&CTATA GluLysva 1AIaAsnGt u A s n P ~ e G l u T A r S e r S e r P ~ e l ~ u S e r L y s A s n A s n T ~ r 11 e eeo GAATT&GCTTTCTATGAATATATCAAGGGAACA~.'T>G&TAATTGGATT&TT~G~ O l u L e u A l a P h e T y r G l u T y r l l e L y s O l y T h r P r o S e r & s p A s n T r p l l e 1 ZeLysGl u +00 OCGGTGCS~L~&TGAJ~TG CAT~_S_~_s_s.CCCG&Tt~ & ~ A ~ ~ T ~ ~ O AlsValLeuTyls~,, lulllll:H~L8LyllAlnPro [ leklpTyrGluZle~CleLysGl nAspTrp

2100 TTS~elTGCGG~-A AGGTTTAnm~_A_~_TACGAIUU~TGGTAT&TTT LltuPltIA I IIGIyVilIG ! yG lyilItltAI~ILIluGlyLIIUGtu A I m ~ L y ~ l y Z ~ e ~ 21110 GACATAA~TCAATGGGAGCCCTP.ACGAAAAATCCI~CATGCATt'IP~ k s p r IoTI~zTrI~IaAsnG JmTrpGIuFroStrArqLy8 r X e G l n t l i U X e ~ IIl~Z 22=0 T&TAGTAJUUtGATTTAAGAACGGCATCCATAGTAATAAGGATATT~CCCAGGTATCTF~T TYrSerLysArqi~eLysAsnG JLy[ Xetll~SerAsnLysAsp [ l e J ~ s G JLnvalSerAsp 2289 GkAGAAATGGCAAATACTGAAGCTGATATGAITGTAGGAGGATSL'I~'CITGCCAAGATTAT GluG t ul(e~ULaJ~nTitrGluA~aAspi4te~ |~LeVaIGILyGIyI~oF r O C y S G L ~ 2:140 TCAGTTGCAAGGAGTt~AJ~TGGAGAATTAGGAATA ATTC SeevalAlaArqserLsuAsnG ~7GIuLaWSJWI l e g I nGlyLysLySGtyValL4ul~e :taO0 TGGCAJ~TTATTAGATAT&TT~AJU~TAC&TTTCCT/~kTACTTGTT~CTT~F_s~ TITGLnZ~e [leArqTy~1~oG~LnAsnTItrPheProLysTyrLeuLsuLeuGJLuAsnVa]L 2460 G&TAG&TI'ATTGAAATCA~'I"JL~'G>CAGAGAGGGAGAGACTTTGCTCTAATGTTATCA kspArql,~,~tatuLysserProSorSorGlnArqG ~y&rqAspl~eAlltva XHe~:LeuSer

:tSa0 ACCTTA~kTGAG'~TAGGCT&TAATGTTGAATGGCGCGTGATTAATGCTGCTGA~A~ C ThrLluA|nG~LuLsuGIyTyrAsnVIIGIuTrlPArgVsJLZl e k s n A l l A l a A s p T y r O I y 2580 AATGCTCAAAGAEGTAGAAGGGT&TTTATATt'F4P~'dATATAAGP.AAGASPI~PAJ~CTATAGC

~enlO,a G L n A r q ~ q A r q & r q V e X P l t e X l e P ~ e O L y ' ~ r L y s G L ~ p ~ n ~ e r GAAATAATAAATCAATAT&TTAATGAAP~--.s-~-~.GGCACATP.~ATTG>G AA~ACA Olul~Le|~eJ~nGJLnTyrl ~eAsnG JLuGtyLys&/aH~sO~uLaw~erOl u G ~ y L a u T ~ IlllZZ 10~0 AGTT&TTTAGCGCCATGTACAAAGGGTGCGAATGCTAGTTCTTTAAGAAATCAGCCSMPAT SelTyrLauAtsProCysT~L'LysOlykl aAmnAlaSerSe~LeuArq&snolnProTyr 1000 TCAGACATAAAAGCAAAGCitJ~AGAGCATTTT~PI~PGAAGTCTGGGTATAT0&CATCTATT SorAOpl t eLyekXsLysO~nArqd~lsP~eSerLau~ymaerO~yTyrlle~Tnrserx l e 1140 ffA~O C k A A T A f f A G GTG&TG.s_s_s_s_~_~.TAO&STCAAST(FFCAJ~G &C C C k ~ ~ tAuArqLysTyrVlIL4uG,Ly&IpGItaLyoI~eAoplJerl XoVllLyllkSpProP~eOlta

1300 ATIdd~G.s_~_~_s_s.TCAATAOAOOACATAOTCTTT0 .s_s_~_~TTTC&OCCAT&TATAAA~ G t L e L y a o l u L y s S e r l l e O l u A m p [ IoV81 P~eO/uLysF~ooLnProTyrl l e A e n T r ~ L|(JO

8 o f f t eAIIpLy|ldluCylGlull~llPhOOor JCllAIIn~yllG~yOt ULylIGIYLSUAInTyr ~X &GAATAO©CTCTGCCk-n-¢~AAATCT.s_=_s_s.GOTAAkACTACTAAAAOTAAA©CATTCCCG k r q : t eA~s8orA~sI ~eLeuA|nLeuLylO t yLysTIt rT~rLyllSerl,yllPrOP~eP:o L210 OA,AOT'I'~+~l~.OI~OT'IT~AAAAAT(:&TL"T&TAO"L"&O'I'~.s_s..s..~.©&G~C&~~ T ~ G G,~UVllGluOLuPhoOluLynSerSerl 1 a r r i v a l LysT~rV8 lHLsP~tASnLy88.y8 L440 AATGTGAATAJ~AGAAAGTATGTCATTT~OAG~.¢¢¢~AAATTTGAAGAACTAGCTAA~AG &snV~IAonLyIGIUSOrHOtSerF~eGLyALIF~el,yoF~eG|UG~uLsuAIaASnGIu F,~RV zsoo GAATGGGAAG&TAGTGAAGG&TATCCT>GCACAATGGCGAAAC~T~-~ ~-~AGAAACA GluTL~G I uAopSerGLuO~yTyrP=oSorAllGlnTITArqAIInP~eLeul~uG t u T h r 1560 AG~fro-l,• ~A~AAAGAAG&TGAAGATGGTGTAG&C&TATTCAAAGGAAT& ArqPhOlAuPhePllovslVaLLysGLu&spGluAepGlyVat Asp| lePltel.ysGly Xl e 16~t0 AAA'¢¢¢¢¢+-AGTATGCCTGAAGf~AGACATAAACGGACCTGTCAAkAGAATCT~SG&TGAT LysP~ePl~eSerlto~ProGluOL uAsp£ ~OASnGIyP=oVa t LysArqHe~Ttl~SpAsp

1680 ACAGTGkAGAAATTAAJ~AGAGGGTGTCAC&TTAGJ~AGCTGTACCGGACAJU~GTACAAAG Thrva~ L y s L y s L e u L y s o l u O l y v I 1ThL'LauGL uAlllVs 1 Pro&spl, ysSe rSPhrLys 1740 G&TGGTI~GAGAATAAAAAATAA'nT~+GTAGATAJU~GTGATG&TTTAATPP~CCATGTT AspGlyTrp&rg| l e L y | A s n A J n F h e V a l A s p L y e s o r A | p & | p l ,e u | IeCySHXsVa I

2440 AAAGCT&TGGAAGIU~~TAJU~ATT&TAT&TCACAATGGTTTGTTT~CTPJ~ I.yllkllNe~G]LuGluSerProldluAepLy81 Lo 1 leTyrttllsAsnG~LyLauPlMd~lsG/u

~700 G~ i ~-~-~.~-~ATTIPm~TTATG CCAAT.S-s-~-~-~.TAGAC~AAATAGGACT~ItTATTACTCAT k l a P t t o P r o [ leG1uAspTyrA~gd~nLyoAonAIWVa~ASnArq'rltrHis ~@TltrNl8 ,1740 G&T&TAGTCGATATTTCkQ&TAATI~&v ~,-~-,~.AA~-6-~ATAATAGTGOAATCATGftJ~A A e p l l e V s l U p Z ~eSerkspAsnP~eSorl~eG&nPMTyrAen~ot~lyX lelW~Lys

|O|0 AATOOAGAAATSPt~AA~P&SPJPOACAP.~AT&~AAAATATG. s - s - s _ S ~ T C A ~ & ~ kanOlyG t ulleLeuT~rZ~sAspT~rX l o P r o L y s T y r O l u l , y o s e r v s ITl~rLauOlY |it0 0AAATIP&T'JP0I~,AOTP,ATOT&0AT0&T~ ,, .-n-,,~,ATIPN~,TP.AAOATP.A,AA'IT~kTAAA O l u X l e l l e O l u l e r A s n V ~ iAepAepOlyPholorLeuAenolnAspOlnlZeAspl, y8 51140 ~TAAAT&TTTAAOAGG&~'~.NUU~OATTN~ACOAACTA~J~AAAGATGOTCk~T&T PhoLyoTyrLauArqO~yProLyo Lysl I o L y s A I q ~ r T I ~ r l , yoAOpO~yH$oGIuTY: |000 T&~-~-~-+-63~AGkAGGTGOT&TGTCTGAAACAGATTCATTAOAOI~ACCTOCAAGkACkATO TyrP~oserGluOlyOlyllo~Ser~luT~rAspSerLeuOluLauProAls&rq~rllo~

Lglll 3010 CITACAAGTGf~A?CAT~J~AT~JtJ~TAOJ ~ G T A C S ~ & + - ~ T c J | k l t A O F L ' A O A ~ A T LauThrSerG luSerSerJL leAsnArqserTl~rHloPheLauAsnvalkepOt yVa I T y r 31|0 AGftJ~CTTTGACACCTA~LeFI=AAGCAOAAAGGTI~AATGGGTTTCCAGATAASVI~ACAGAA ArqTttrLauThrProl IeGIUA~aG t uAIqLauAIInGLyPltoProAIIpAsnTrpTItrO|u )1|0 OlyNo~Prol loLyoNo~ArqTyrP~oCynKo~O/yAnml~LeuV~ IV8 t PrOLsul l o

~IIRZ 3240 ACTAOAATAGGTAATCAAATFG.~_s_s_s_~_s.Tt~&TAGTATt~ACAAATGA ~ ~ & ~ G T h r A r g l ~ e G t y A s n G l n l leGLuLys[ l e & J p S e r l 2 e T ~ r & s n A s p G | u P h e S e ~ G l n 3300 CTACGTTT&TFTTAAATAAATCAJ~TGTAGAGTGCGTTI~&TTTAACAA~ATACT LeuArqlauPne * ]31~0 AAAG&TTC&TAGAT~PATTGTATATTG&CCAGT&TTT&TCAGCGT&TT&~T:-:AATATATA

Fig,4.

42 Block I :

1

2

92.5 I ~ ~

•

67.0

J

BsuRI Bs~RI

fidLFAGiGGFRiamqNlgg lisLFsGaGGldLGfqkagf iidLFAGcGGFshGfkmagy V I s L F s G c G G I d L G f E I a g l V I s L F c G a G G l d L G f E I a g l

Sa___~U3AI

6

V V E L F A G V G G F R L G L E N T K N

H~aII HaelII DdeI BsuRI BsDRI

66

SaU3AI

76

vD~ iGGp Q SL~ nr cnlIIGGF p Se r An viGGF p fSe g rlvdde .. . . . . . . . . . . . . . . . . . . . . . . . ._ .. ........... ADMIVGG DYSVARSLNGELG

HDaII HaeIII DdeI BsuRI BsDRI

133 I01 105 186 185

qPK~ffLENVkgLknhdkgr kPiffLaENVkgmmaqrhnk sPKffvmENVlgILsmktks qPeifvaENVkgmmtlgkge qPeifvaENVkgmmtlggge

SaU3AI

119

FPKYLLLENVDRLLKSPSSQ

175 141 148

vNAknfGvpQnReRiylvGf INAnDYGvAQdRkRVFyiGf INAoDYGvpQsRqRVFfiGI

iit.qzxx VdeX

kDa

45.0 29.0

33 2 60 59

H~alI

2

B l o c k ZZ :

146

B).ock IIl:

Block ~V:

Fig. 5. Size and homogeneity of the purified R. Sau3AI. Following 0.1% SDS-12% PAGE (Laemmli, 1970), the gel was stained with Coomassie brilliant blue. Lanes: I, R. Sau3Al purified from S. carnosus[pSEMT] cell extract; 2, size markers (Serva, Heidelberg). $. carnosus crude extracts were prepared by passing the cells four times through a French pressure cell (Aminco, Silver Spring) with 16000 psi. The cell DNA was precipitated using streptomycin sulfate. R. Sau3AI was purified by column chromatography on heparin sepharose CL-6B (Pharmacia) and phosphocellulose Pll (Whatman), each with a linear gradient of 100-800 mM NaCI, followed by Mono-Q chromatography on a Pharmacia FPLC-system with a linear gradient of 0 to I M NaCI. To confirm the identification of the purified protein as R. $au3AI, the N terminus was sequenced by automated Edman degradation using a pulsed liquid protein sequencer 477A with on-line PTH-analyser 120 (Applied Biosystems). Sequencing reagents and solvents were obtained from Calbiochem. About 200 pmol of the protein was applied to the reaction chamber. Sequencing and PTH analysis were carried out with a standard program.

HDalI HaeIII Ddel BsuRI

226 BsDRI 225 .......-....-....._., SaU3AZ 162

1 N A r D Y G v p Q 1 R e R V i l e G v 1 N A r D Y G v p Q I R e R V i l v G v INAADYGNAQRRRRVFXFGS

Block V: HDaII Haelll

323 294

DdeI

340

~RZ

375

vsdasaYkqfGNsvaVPalqatGk esl ndgYknlGNAvpVnLaye t

v vp

I ak 1

nrldkqYkqiGNAvpVfLtravak

--............................................................ Sau3Al 370 M P Z K M R Y F C M G N A

LVVPLITR'r

GN

Fig. 6. Homology comparison of the M. Sau3Al aa sequence with the five highly conserved blocks ofMTases (Pbsfai et al., 1989). Homologous aa in M.$au3AI are capitalized. Lower-case letters refer to nonhomologous aa. Numbers refer to the sequence position of the first aa in each block. The PC-doublet suggested as part of the catalytic center is boxed.

47 300. Both genes have the same G + C-content of 31 ~o and are terminated by a UAA stop codon, However, typical transcriptional terminator structures could not be detected. The intergenic space is only 103 nt, so that the sau3AIM promoter may overlap with the 3' end of sau3AIR.

(1989), Fig, 6 shows the comparison of the most homologous regions of M, Sau3AI with five other MTases, We also found the highly conserved PC-doublet in block II, postulated to be part of the catalytic site and the approx. 140 aa variable region between blocks IV and V, suggested to be responsible for the specific sequence recognition (Pbsfai et al., 1989).

(e) Homology studies with R, Sau3AI and M. Sau3AI We compared the R, So.3AI with the M. Sau3AI aa sequence and found only a short homology of 8 aa (-E-K-I-D-S-I-'-.-D-.-F-) at aa position 220 in the R. S..3AI protein sequence and at aa position 396 in the M. Sau3AI protein sequence. The R . S . . 3 A I and the M. Sa.3AI sequences were compared with sequences in the GenBank and with the homologous sequences summarized by Pbsfai et al. (1989). While no significant homology to other endonucleases could be detected either at the DNA or protein level of R. Sau3AI, M. Sau3AI had the typical homologous consensus motifs for 5C-MTases suggested by Pbsfai et al.

(f) Conclusions (1) The genes for the class-If R-M system (recognition sequence 5'-GATC-Y) from S. aureus 3AI have been cloned into S. carnosus TM300. Isola~,*.d pSEI~7 plasmids were resistant to Sau3AI digestion, but at least half of the plasmid molecules were nicked by Sau3AI probably because of the presence of haLf-modified recognition sites. (2) The Sau3AI system has the ~ame general organization as other class-ll R-M systems: R , S a u 3 ~ and M.Sou3AI were separate, singlc-polypeptide enzymes, encoded by separate, adjacent genes:. In the Sau3AI R-M system, both gee,~s have the same transcriptional orientation; sau3AIR is followed by sauSAIM.

43 (3) While the E N a s e s h o w s no apparent homology to other E N a s e s , the M T a s e possesses the h o m o l o g o u s boxes typical for 5C M T a s e s .

ACKNOWLEDGEMENTS W e t h a n k G. Schmitz for helpful c o m m e n t s a n d suggestions, S. Stefanovic for determining the protein sequence d a t a a n d K. Brune for critically reading the manuscript.

REFERENCES Bachmann, B.J.: Derivations and genotypes of some mutant derivatives of Escherfchia coli K-12. In Neidhardt, F.C., Ingraham, J.L., Low, K.B., Magasanik, B., Schaechter, M. and Umbarger, H.E. (Eds.), Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology, Vol. 2. American Society for Microbiology, Washington, DC, 1987, pp. 1190-1220. Bimboim, H.C. and Doly, J.: A rapid alkaline extraction method procedure for screening recombinant DNA. Nucleic Acids Res. 7 (1979) 1513-1523. Cohen, S.N., Chang, A.C.Y. and Hsu, L.: Nonchromosomal antibiotic resistance in bacteria: genetic transformation of E. coli by R-factor DNA. Proc. Natl. Acad. Sci. USA 69 (1972) 2110-2114. Chen, E.Y. and Seeburg, P.H.: Supercoiled sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. Earl, C.D., Albright, L.M. and Heinrich, P.: Dideoxy sequencing using double-stranded DNA templates. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Smith, J.A., Seidman, J.G. and Struhl, K. (Eds.), Current Protocols in Molecular Biology. Greene and Wiley-interscience, New York, 1987, pp. 7.4.11-7.4.13. 7.4.11-7.4.13. Ggtz, F. and Schumacher, B.: Improvements of protoplast transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40 (1987) 285-288. Ggtz, F., Zabielski, J. and Philipson, L.: DNA homology between the arsenate resistance plasmid pSX267 from Staphylococcus xylosus and the penicillinase plasmid pl258 from Staphylococcus aureus. Plasmid 9 (1983) 126-137. Henikoff, S.: Unidirectional digestion with exonuelease !Ii creates targeted brea'kpoints for DNA sequencing. Gene 28 (1984) 351-359. Kahn, S.A. and Novick, R.P.: Complete nucleotide sequence of pTlgl, a tetracycline-resistance plasmid from Staphylococcus aureus. Plasmid 10 (1983) 251-259.

Koob, M., Grimes, E. and Szybalski, W.: Conferring operator specificity on restriction endonucleases. Science 241 (1988) 1084-1086. Kreutz, B. and G6tz, F.: Construction of Staphylococcm plasmid vector pCA43 conferring resistance to chlorampbenicol, arsenate, arsenite and antimony. Gene 31 (1984) 301-304. Laemmfi, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685. McLaugldin, J.R., Murray, C.L and Rabinowitz, J.C: Unique features in the ribosome binding site sequence ofthe Gram-positive Staphylococcus aureus ~.lactamase gene. J. Biol. Chem. 256 (1981) ! 1283-11291. Modrich, P. and Roberts, RJ.: Type-ll restriction and modification enzymes. In Linn, S.M. and Roberts, RJ. (Eds.), Nucleases. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982, pp. 109-154. Neff, P.: Klonierung and Sequenzienmg der 16S rDNA yon Staphylococcus carnosus. Diplomarbeit, Technische Universitlit, M0nchen, 1987. Novick, R.P. and Bouanchaud, D.: Extrachromosomal nature of drug resistance in Staphylococcus aureus. Ann. N. Y. Acad. Sci. 182 (1971) 279-294. Pbsfai, J., Bhagwat, A.S., Pbsfal, G. and Roberts, RJ.: Predictive motifs derived from cytosine methyltransferases. Nucleic Acids Res. 17 (1989) 2421-2435. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2rid ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Sanger, F., Nicklen, S. and Coalson A.R.: DNA sequencing with chaintermination inhibitors. Proc. Natl. Acad. Sci. USA 71 (1977) 5463-5467. Schleifer, K.H. and Fischer, U.: Description of a new species ofthe genus Staphylococcus: S. carnosus. Int. J. Syst. Bacteriol. 32 (1982) 153-156. Shine, J. and Dalgarno, L.: The Y-terminal sequence ofEscherichia coli ribosomal RNA: complementary to nonsense triplets and ribosome binding site. Proc. Natl. Acad. Sci. USA 71 (1974) 1342-1346. Stobberingh, E.E., Schiphof, R. and Sussenbach, J.S.: Occurrence of a class 11restriction endonuclease in Staphylococcus aureus. J. Bacteriol. 131 (1977) 645-649. Streeck, R.E.: Single-strand and double-strand cleavage at half-modified and fully modified recognition sites for the restriction nucleases Sau3A and Taql. Gene 12 (1980) 267-275. Sus.senbach, J.S., Montfoort, C.H., Schiphof, R. and Stobberingh, E.E.: A restriction endonuclease from Staphylococcus aureus. Nucleic Acids Res. 3 (1976) 3193-3202. Williams, R.E.O. and Rippon, J.E.: Bacteriophage typing of Staphylococ. cus aureus. J. Hy8. 50 (1952) 320-353. Wilson, G.G.: Cloned restriction-modification systems - a review. Gene 74 (1988) 281-289. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 phage cloning vector and host strains: nucleotide sequences of the Ml3mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119.