- Email: [email protected]
Cloning, expression and evolution of the gene encoding the elongation factor 1α from a low thermophilic Sulfolobus solfataricus strain
FEMS Microbiology Letters 218 (2003) 285^290
www.fems-microbiology.org
Cloning, expression and evolution of the gene encoding the elongation factor 1K from a low thermophilic Sulfolobus solfataricus strain Mariorosario Masullo a;b , Piergiuseppe Cantiello b , Annalisa Lamberti Olimpia Longo b , Antonio Fiengo b;c , Paolo Arcari b;c; a
b;c
,
Dipartimento di Scienze Farmacobiologiche, Universita' di Catanzaro ‘Magna Graecia’, Roccelletta di Borgia, 88021 Catanzaro, Italy b Dipartimento di Biochimica e Biotecnologie Mediche, Universita' di Napoli Federico II, via S. Pansini 5, 80131 Napoli, Italy c CEINGE Biotecnologie Avanzate Scarl, via S. Pansini 5, 80131 Napoli, Italy Received 29 July 2002; received in revised form 15 November 2002; accepted 18 November 2002 First published online 27 December 2002
Abstract The gene encoding the elongation factor 1K (EF-1K) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75‡C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1K isolated from S. solfataricus strain MT4 (optimum growth temperature 87‡C). Only one amino acid change (Val15CIle) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G13 HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1K genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312U1039 ) is lower than that reported for other functional genes. ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Elongation factor; Protein synthesis ; Archaea; Molecular evolution; Sulfolobus solfataricus
1. Introduction The genus Sulfolobus belongs to the branch of archaebacteria characterised by extremely thermophilic, nonmethanogenic anaerobes. The most studied species of this sulfur-dependent branch are Sulfolobus solfataricus and Sulfolobus acidocaldarius, both growing at high temperature (80^87‡C) and low pH [1,2]. Several of these species have been phenotypically characterised and one possible criterion to distinguish among them is the di¡erence in the growth rates under controlled condition of temperature and medium composition [3]. Under this aspect, two S. solfataricus strains (MT3 and MT4) have been isolated from a solphataric area near Naples, Italy [4]. MT4 grows
* Corresponding author. Tel. : +39 (081) 7463120; Fax : +39 (081) 7463653. E-mail address : [email protected] (P. Arcari).
in the range of 63^89‡C (optimum growth temperature 87‡C, pH 3.0) whereas the MT3 strain is less thermophilic because it grows, at the same pH, in the range 50^80‡C (optimum growth temperature 75‡C) but it does not grow at 87‡C. Moreover, the MT3 strain showed a slightly higher GC content (42%) with respect to the MT4 strain (39%) [4]. Therefore, these two di¡erent archaeal strains appear to be suitable for comparative studies related to evolution and structure^function relationship in proteins. We have previously reported the puri¢cation and characterisation of the translational elongation factor 1K (EF1K) from the archaeon S. solfataricus, strain MT4 (SsMT4EF-1K) (ATCC 49255) [5] together with the cloning and the structural organisation of its encoding gene [6,7]. Because EF-1K is present in all the living organisms, it was of interest to analyse the molecular properties of the enzyme from the MT3 strain (SsMT3EF-1K) and to compare them with those of the MT4 enzyme. The analysis of its molecular and biochemical properties showed that a
0378-1097 / 02 / $22.00 ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1097(02)01178-3
FEMSLE 10797 23-1-03
Cyaan Magenta Geel Zwart
286
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
single amino acid di¡erence between the MT enzymes was responsible for di¡erent biochemical properties whereas, despite the di¡erent optimal growth temperature of the two microorganisms, the two enzymes displayed similar thermal behaviour.
2. Materials and methods 2.1. Plasmid construction, expression and puri¢cation of SsMT3EF-1K S. solfataricus (strain MT3) genomic DNA was used as template in order to synthesise by polymerase chain reaction (PCR) a DNA fragment containing the EF-1K gene. The forward primer, GAAGAGATAGAAAGAATAGC, corresponded to the C-terminal region of the S. solfataricus DNA (strain MT4) rbpS7 gene (amino acid residues E183 EIERIA) whereas the reverse primer ATTCTAGCTTTTGTAGGCAT, corresponded to the N-terminal region of the rbpS10 gene (segment M1 PTKARI). Both genes £ank in S. solfataricus the MT4 EF-1K gene [7]. The PCR product (1426 bp) was cloned in pGEM-3Z plasmid and sequenced. The pGEM-3Z plasmid containing the gene encoding SsMT3EF-1K was used as template with two primers ATGTCTCAAAAGCCTCA, corresponding to the sequence M1 SQKPH of the sequenced SsMT3EF-1K and CTAGCTTTTGTAGGCAT, corresponding to the segment M1 PTKAR of rbpS10 (see above). The PCR fragment obtained was cloned into the NdeI site (¢lled) of pET22 expression vector and the recombinant SsMT3EF-1K was obtained following the procedure already reported for SsMT4EF-1K [8]. 2.2. Biochemical assays Poly(U)-directed poly(Phe) synthesis, isolation of total tRNA, ribosome and phenylalanyl-tRNA synthetase (SsFRS) from S. solfataricus MT4 were performed as reported previously [9]. The preparation of Phe-EctRNAPhe , the formation of the ternary complex SsEF-1KW[Q-32 P]GTPWPhe-EctRNAPhe , and the protection against spontaneous deacylation of [3 H]Phe-EctRNAPhe were carried out as described previously [9]. The ability of SsMT3EF-1K to form a binary complex with [3 H]GDP was tested as described previously [5]. The intrinsic GTPase activity of SsMT3EF-1K was measured in the presence of 3.6 M NaCl (GTPaseNa ) [9]. Unless otherwise indicated the reaction mixture contained 0.1^0.3 WM SsMT3EF-1K and 50 WM [Q-32 P]GTP (speci¢c activity 150^300 cpm pmol31 ). The reaction was followed kinetically up to 30 min at 60‡C; the amount of 32 Pi released, the catalytic constant of GTPaseNa , the a⁄nity for [Q-32 P]GTP and the inhibition constants by GDP of GTPaseNa were determined as reported previously [10].
FEMSLE 10797 23-1-03
2.3. Thermophilicity and heat stability The thermophilicity of SsMT3EF-1K was checked by measuring the GTPaseNa in the temperature range of 40^91‡C. At each temperature the reaction was followed kinetically; at time intervals depending on the temperature, 40 Wl aliquots were withdrawn and analysed for the 32 Pi released [9]. The initial rate of the hydrolytic reaction was calculated from the linear part of each kinetics and the data were treated according to the Arrhenius equation; the energetic parameters of activation were calculated as reported [10]. Heat inactivation of SsMT3EF-1K was evaluated by incubating 4 WM protein in bu¡er A for 10 min at selected temperatures in the interval of 70^102‡C. 25 Wl aliquots were cooled on ice for 30 min and then analysed for their [3 H]GDP binding ability. 2.4. Sequence divergence calculation Sequence divergence was calculated by evaluating the proportion (p) of nucleotide substitutions according to Gojobory and Yokoyama [11] (p = number of base substitutions/total bases). The rate of nucleotide substitutions per site per year (a) was calculated according to the equation a = d/2Td , where d is the number of nucleotide substitutions corrected for multiple events according to the equation d = 3(3/4)ln[13(4/3)p] [12] and Td is the divergence time expressed in million years. 2.5. Molecular modelling The three-dimensional (3D) structure of SsMT4EF-1K in complex with GDP from S. solfataricus [13] (PDB entry 1JNY) from strain MT4 was used as template to predict the e¡ect of the Val15CIle amino acid di¡erence observed in SsMT3EF-1K by using the SwissPDB viewer software [14].
3. Results and discussion 3.1. Cloning and expression of the SsMT3EF-1K gene The alignment of the nucleotide sequence of the SsMT3EF-1K gene (EMBL accession number AJ312397) with the corresponding sequence of the gene isolated from MT4 strain [6] showed the presence of three base substitutions, namely G43 CA, G720 CC and C954 CT as numbered from the start codon (not shown). The G43 CA change led to a di¡erent amino acid residue (Ile15 instead of Val15 in SsMT4EF-1K) whereas the other base di¡erences led to synonymous codons. The 5P untranslated region contained a potential Shine^Dalgarno sequence (positions 39 to 313) and a putative archaeal promoter (positions 33 to 37 and 335 to 343) [15], respectively
Cyaan Magenta Geel Zwart
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
2
1
0
0.75
on the structural and biochemical properties of SsMT3EF1K. For this purpose, the SsMT3EF-1K gene was cloned into pET22 expression vector and the recombinant enzyme was produced and puri¢ed [8].
0.50
3.2. Properties of SsMT3EF-1K and comparison with SsMT4EF-1K
0.25
0.00 0
0.3 0.6 0.9 α] µM [SsEF-1α
-15
0
15
30 α] (µM-1) 1/[SsEF-1α
Fig. 1. Poly(U)-directed poly(Phe) synthesis promoted by SsMT3EF-1K and SsMT4EF-1K. A: E¡ect of increasing concentration of SsMT3EF1K (a) and SsMT4EF-1K (b). 250 Wl of the reaction mixtures contained 0.1 WM SsEF-2, 1.5 Wg SsFRS, 27.4 Wg total tRNA, 0.2 WM ribosome, 2.4 WM [3 H]Phe (speci¢c activity 418 cpm pmol31 ). The reaction was allowed to proceed at 75‡C and at selected time intervals, 50 Wl aliquots were withdrawn, chilled on ice and then analysed for the amount of [3 H]Phe polymerised. The initial reaction rate, v, was reported. B: Lineweaver^Burk plots of the data reported in A.
as numbered from the start codon, and a transcription termination signal in the 3P £anking region (positions 1317^1323). Northern blot analysis of total RNA from strain MT3 (not shown) showed the presence of a strong major transcript of about 1300 nucleotides that hybridised to the SsEF-1K gene. The size of the transcript was in agreement with the presence of the promoter and the termination signals found in the £anking regions the SsMT3EF-1K gene. In the case of RNA isolated from the MT4 strain, the size of the major transcript was higher (1700 nucleotides) and indicated that the SsMT4EF-1K gene was cotranscribed with the S10 ribosomal protein gene [7]. In the amino acid sequence of SsMT3EF-1K the di¡erence with SsMT4EF-1K was in the ¢rst sequence motif involved in the binding of GTP and GDP [16], G13 HIDHGK. The identical amino acid change was found in the translated sequence of the EF-1K gene from S. solfataricus P2 strain although in this case also other amino acid di¡erences were present [17]. In the framework of a research programme on SsMT4EF-1K mutants, we have recently analysed by site-directed mutagenesis the functional role of Gly13 in the same region of SsEF-1K, G13 HVDHGK (Gly18, in EcEF-Tu). The overall results suggested that the G13A substitution a¡ected mainly the biochemical properties of the enzyme whereas its thermostability remained practically unaltered [9]. Therefore, it was of interest to analyse the e¡ects of the Ile15 presence
FEMSLE 10797 23-1-03
Under either native (gel ¢ltration) or denaturing (sodium dodecyl sulphate^polyacrylamide gel electrophoresis (SDS^PAGE)) conditions puri¢ed SsMT3EF-1K showed the same Mr as SsMT4EF-1K. The maximum rate of poly[3 H]Phe synthesis catalysed by SsMT3EF-1K was almost identical to that elicited by SsMT4EF-1K (Fig. 1A); however, the concentration of SsMT3EF-1K required to get half maximum activity (Kact ) was about 3.5-fold higher than that required by SsMT4EF-1K (0.207 and 0.058 WM, respectively) (Fig. 1B). This ¢nding could be ascribed to a lower ability of SsMT3EF-1K to bind aa-tRNA. In fact, compared to SsMT4EF-1K, SsMT3EF-1K in complex with either GppNHp (Fig. 2A) or GDP (Fig. 2B) was less e⁄cient to protect [3 H]Phe-EctRNAPhe from its spontaneous deacylation. However, as already reported for SsMT4EF1K [11], the e⁄ciency in the protection assay of SsMT3EF-1K complexed with GppNHp was about one
[3H]Phe-EctRNAphe bound (pmol)
1/v (min•pmol-1)
v (pmol•min-1)
3
287
2.8
0.28
A
2.1
0.21
1.4
0.14
0.7
0.07
0
0 0
25
50
75
B
0
25
50
75
α added (pmol) SsEF-1α Fig. 2. Protection against spontaneous deacylation of [3 H]PheEctRNAPhe by SsMT4EF-1K or SsMT3EF-1K. 30 Wl of reaction mixture containing 25 mM Tris^HCl bu¡er, pH 7.8, 10 mM NH4 Cl, 10 mM DTT, 20 mM magnesium acetate and 3.1 pmol of [3 H]Phe-EctRNAPhe (speci¢c activity 2065 cpm pmol31 ) were pre-incubated for 1 h at 0‡C to allow ternary complex formation in the presence of the indicated amount of SsMT4EF-1K (b) or SsMT3EF-1K (a) in complex with GppNHp (A) or GDP (B). The deacylation reaction was carried out for 1 h at 50‡C and the residual [3 H]Phe-EctRNAPhe was determined as reported in Section 2.
Cyaan Magenta Geel Zwart
288
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
tively). As already found for SsMT4EF-1K, the GTPaseNa of SsMT3EF-1K was competitively inhibited by GDP but with an e⁄ciency higher compared to SsMT4EF-1K, thus con¢rming the higher a⁄nity for GDP elicited by SsMT3EF-1K (not shown).
B
A 100
75 GTPaseNa (%)
50
25
75 3.3. E¡ect of heat and temperature on SsMT3EF-1K
50 1000/T (K-1) 2.8
25
2.9
3.0
-3 ln k
Residual [3H]GDP binding (%)
100
-4
0
-5
0 70
80
90
100
60 70 80 90 100
Temperature (°C) Fig. 3. Thermal properties of SsMT3EF-1K and SsMT4EF-1K. Heat inactivation (A) and thermophilicity (B) of SsMT3EF-1K (a) and SsMT4EF-1K (b). B, inset: Arrhenius analysis of the data in the range 60^87‡C.
order of magnitude higher than that observed when it was complexed with GDP. Concerning the ability to form binary complex with guanine nucleotides, we found that compared to that of SsMT4EF-1K, the a⁄nity for both GDP and GTP of SsMT3EF-1K was about 2- and 1.25-fold higher, being the Kd values equal to 0.8 and 28 WM, respectively. SsMT3EF-1K was able to hydrolyse GTP in the presence of NaCl at molar concentration [10]. Compared to SsMT4EF-1K, the Km for GTP decreased by 3-fold (2.7 and 0.9 WM, respectively) whereas the kcat of the reaction resulted practically the same (0.8 and 0.9 min31 , respectively); as a consequence, the catalytic e⁄ciency of the GTPaseNa of SsMT3EF-1K resulted 3.3-fold higher compared to SsMT4EF-1K (1.0 and 0.3 min31 WM31 , respec-
Concerning the heat stability of SsMT3EF-1K, the I15V amino acid di¡erence caused almost no impairment of the thermostability of the enzyme compared to that of SsMT4EF-1K (Fig. 3A). In fact, although the denaturation pro¢les were slightly di¡erent in the temperature range 80^93‡C, the half inactivation temperatures (93 and 94‡C for SsMT3EF-1K and SsMT4EF-1K, respectively) were almost identical. Regarding the thermophilicity, SsMT3EF-1K showed the highest GTPase activity at 87‡C (Fig. 3B), a temperature 4‡C lower than that displayed by SsMT4EF-1K. The analysis of the rising part of the curves according to the Arrhenius equation (Fig. 3B, inset) showed that the activation energy of the GTPaseNa of SsMT3EF-1K was slightly lower than that displayed by SsMT4EF-1K (57.7 and 67.3 kJ mol31 , respectively). As a consequence, the energetic parameters of activation calculated at 60‡C showed that the free energy of activation of the reaction resulted almost identical for both enzymes (93.6 and 94.4 kJ mol31 , respectively) whereas, the entropy of activation was lower (3116 and 390 J mol31 K31 , respectively) thus indicating that the activated state of the hydrolytic reaction was entropically less favoured. 3.4. Molecular modelling of SsMT3EF-1K To explain at the structural level the di¡erences observed in the properties between SsMT3EF-1K and SsMT4EF-1K, a molecular model was constructed on the basis of the 3D structure of SsMT4EF-1K in complex
Fig. 4. Three-dimensional structure of SsEF-1KWGDP in the P-loop region. A: Location of Val15 in the SsMT4EF-1K structure (PDB entry 1JNY). B: Modelling of the same region following Val15CIle replacement. Models were visualised by using the RasMol software.
FEMSLE 10797 23-1-03
Cyaan Magenta Geel Zwart
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
289
Table 1 Rates of nucleotide substitutions per site per year among Sulfolobus EF-1K genesa EF-1K sequences compared
d1 (U1033 )
d2 (U1033 )
d3 (U1033 )
dall b (U1033 ) Rate of nucleotide substitutions (U1039 )
Identity (%)
SsMT3/SsMT4 SsMT3/SsP2 SsMT3/St SsMT3/Sa SsMT4/SsP2 SsMT4/St SsMT4/Sa SsP2/St SsP2/Sa Sa/St Average
0.76 7.0 36.0 45.7 7.7 34.4 44.0 39.2 44.0 34.4 ^
^
1.5 63.0 156.7 188.5 64.6 157.7 186.5 158.6 191.4 178.7 ^
2.3 72.1 233.0 284.8 7.5 233.0 282.6 237.2 287.0 238.2 187.7
99.7 93.1 79.9 76.3 92.9 79.9 76.4 79.6 76.0 79.5 ^
a b
1.5 24.0 26.4 1.5 24.9 28.0 22.5 27.2 11.5 ^
0.0004 0.0120 0.0388 0.0474 0.0012 0.0388 0.0471 0.0395 0.0478 0.0397 0.0312
See text for references. d1 , d2 , d3 , dall are the divergences at the ¢rst, second, third and all codon positions, respectively (see Section 2 for details).
with GDP [13]. V15 is not directly involved in the binding of GDP, therefore, as reported in Fig. 4, the V15I change reveals that the Ile side chain appeared to a¡ect neither the P-loop region nor the K-helix containing the GDP binding consensus elements. However, because of di¡erent side chain of I15 (Fig. 4B) with respect to V15 (Fig. 4A), a local rearrangement of the protein structure in the P-loop region might have occurred which increased its £exibility thus making the SsMT3EF-1K more able to bind guanine nucleotides and to hydrolyse GTP. 3.5. Molecular evolution of Sulfolobus EF-1K genes Elongation factor 1K (EF-Tu in eubacteria) sequences have been used as a molecular tool for phylogenetic relationships among extant life forms [18^20]. In order to estimate the molecular evolution at the gene level in Crenarchaeota, we have calculated the divergence in all codon positions among the nucleotide sequence of ¢ve EF-1K genes from the di¡erent Sulfolobus species known so far, namely S. solfataricus MT3 (SsMT3) (this work), S. solfataricus MT4 (SsMT4) [6], S. solfataricus strain P2 (SsP2) [17], Sulfolobus tokadaii strain 7 (St7) [21], S. acidocaldarius (Sa) [22]. The results reported in Table 1 showed that the average rate of nucleotide substitution per site per year for all codon positions was 0.0312U1039 . The separation time within archaea has been estimated as about 3U103 million years [23]. This rate is consistent with that found for other archaeal genes [24] but is about one order of magnitude lower than those found for eukaryotic functional genes [25,26]. A similar value of 3.17U1037 was observed in S. acidocaldarius in the evaluation of spontaneous mutations per cell division that conferred 5-£uoroorotic acid resistance [27]. The mutation rate found among EF-1K genes could be either underestimated or overestimated depending on the value of the divergence time used. In fact, the rate of nucleotide substitutions appears to be fairly steady for a period of time no longer than 100 million years [28]. However, a possible explanation for the modest mutational rate among hyperthermo-
FEMSLE 10797 23-1-03
philic archaea is the need to enforce their genetic ¢delity under harsh environmental condition through a not yet identi¢ed mechanism [27]. In conclusion, the di¡erences observed at the gene level in SsMT3EF-1K with respect to SsMT4SsEF-1K could be the result of mutations which have occurred in the adaptation of the MT species at the di¡erent growth temperatures. This ¢nding is in agreement with the di¡erent base content between the two genomes. As far as we know, no other example of enzyme isolated from these two S. solfataricus strains has been reported. However, the gene encoding alcohol dehydrogenase from S. solfataricus DSM 1617 (growth temperature range 78^87‡C) and the less thermophilic Sulfolobus sp. strain RC3 (optimum growth at 75‡C) have been isolated and expressed in Escherichia coli. Even in this case only few amino acid replacements were responsible for the di¡erent features of the two enzymes [29]. In the case of SsMT3EF-1K, the non-synonymous mutation occurred in a speci¢c region of the enzyme important for its catalytic properties but not involved in its thermostability. The slower rate in protein synthesis of SsMT3EF-1K with respect to SsMT4SsEF-1K could somehow account for the slightly higher doubling time of the MT3 strain with respect to the MT4 [4].
Acknowledgements We gratefully acknowledge Prof. A. Gambacorta for supplying S. solfataricus MT4 and MT3 cells. This work was supported by CNR, PRIN 2001 (Rome) and the European Community Biotechnology Program, Contract BIO4-CT97-2188. References [1] Brock, T.D., Brock, K.M., Belly, R.T. and Weiss, R.L. (1972) Sulfolobus: a new genus of sulfur-oxidizing bacteria living at low pH and high temperature. Arch. Microbiol. 84, 54^68.
Cyaan Magenta Geel Zwart
290
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
[2] Zillig, W., Stetter, K.O., Wunderl, S., Schulz, W. and Gierl, A. (1980) The Sulfolobus ‘Caldariella’ group: taxonomy on the basis of the structure of DNA-dependent RNA polymerases. Arch. Microbiol. 125, 259^269. [3] Grogan, D.W. (1989) Phenotypic characterization of the archaebacterial genus Sulfolobus: comparison of ¢ve wild-type strains. J. Bacteriol. 171, 6710^6719. [4] De Rosa, M., Gambacorta, A. and Bu’Lock, J.D. (1975) Extremely thermophilic acidophilic bacteria convergent with Sulfolobus acidocaldarius. J. Gen. Microbiol. 86, 156^164. [5] Masullo, M., Raimo, G., Parente, A., Gambacorta, A., De Rosa, A. and Bocchini, B. (1991) Properties of the elongation factor 1 alpha in the thermoacidophilic archaebacterium Sulfolobus solfataricus. Eur. J. Biochem. 199, 529^537. [6] Arcari, P., Gallo, M., Ianniciello, G., Dello Russo, A. and Bocchini, V. (1994) The nucleotide sequence of the gene encoding the elongation factor 1a in Sulfolobus solfataricus. Homology of the product with related proteins. Biochim. Biophys. Acta 1217, 333^337. [7] Ianniciello, G., Gallo, M., Arcari, P. and Bocchini, V. (1994) Organization of a Sulfolobus solfataricus gene cluster homologous to the Escherichia coli str operon. Biochem. Mol. Biol. Int. 33, 927^937. [8] Ianniciello, G., Masullo, M., Gallo, M., Arcari, P. and Bocchini, V. (1996) Expression in Escherichia coli of thermostable elongation factor 1 alpha from the archaeon Sulfolobus solfataricus. Biotech. Appl. Biochem. 23, 41^45. [9] Masullo, M., Cantiello, P., de Paola, B., Catanzano, F., Arcari, P. and Bocchini, V. (2002) G13A substitution a¡ects the biochemical and physical properties of the elongation factor 1 alpha. A reduced intrinsic GTPase activity is partially restored by kirromycin. Biochemistry 41, 628^633. [10] Masullo, M., De Vendittis, E. and Bocchini, V. (1994) Archaebacterial elongation factor 1 alpha carries the catalytic site for GTP hydrolysis. J. Biol. Chem. 269, 20376^20379. [11] Gojobori, T. and Yokoyama, S. (1985) Rates of evolution of the retroviral oncogene of Moloney murine sarcoma virus and its cellular homologues. Proc. Natl. Acad. Sci. USA 82, 4198^4203. [12] Hori, H. and Osawa, S. (1979) Evolutionary change in 5S RNA secondary structure and a phylogenetic tree of 54 5S RNA species. Proc. Natl. Acad. Sci. USA 76, 381^387. [13] Vitagliano, L., Masullo, M., Sica, F., Zagari, A. and Bocchini, V. (2001) The crystal structure of Sulfolobus solfataricus elongation factor 1 alpha in complex with GDP reveals novel features in nucleotide binding and exchange. EMBO J. 20, 5305^5311. [14] Guex, N. and Peitsch, M.C. (1997) SWISS-MODEL and the SwissPdbViewer : an environment for comparative protein modelling. Electrophoresis 18, 2714^2723. [15] Thomm, M. and Wich, G. (1988) An archaebacterial promoter element for stable RNA genes with homology to the TATA box of higher eukaryotes. Nucleic Acids Res. 16, 151^163. [16] Dever, T.E., Glynias, M.J. and Merrick, W.C. (1987) GTP-binding domain : three consensus sequence elements with distinct spacing. Proc. Natl. Acad. Sci. USA 84, 1814^1818. [17] She, Q., Singh, R.K., Confalonieri, F., Zivanovic, Y., Allard, G., Awayez, M.J., Chan-Weiher, C.C., Clausen, I.G., Curtis, B.A., De Moors, A., Erauso, G., Fletcher, C., Gordon, P.M., Heikamp-de Jong, I., Je¡ries, A.C., Kozera, C.J., Medina, N., Peng, X., Thi-
FEMSLE 10797 23-1-03
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25] [26]
[27]
[28] [29]
Ngoc, H.P., Redder, P., Schenk, M.E., Theriault, C., Tolstrup, N., Charlebois, R.L., Doolittle, W.F., Duguet, M., Gaasterland, T., Garrett, R.A., Ragan, M.A., Sensen, C.W. and Van der Oost, J. (2001) The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc. Natl. Acad. Sci. USA 98, 7835^7840. Creti, R., Ceccarelli, E., Bocchetta, M., Sanangelantoni, A.M., Tiboni, O., Palm, P. and Cammarano, P. (1994) Evolution of translational elongation factor (EF) sequences : Reliability of global phylogenies inferred from EF-1K(Tu) and EF-2(G) proteins. Proc. Natl. Acad. Sci. USA 91, 3255^3259. Baldauf, S.L., Palmer, J.D. and Ford Doolittle, W. (1996) The root of the universal tree and the origin of eukaryotes based on elongation factor phylogeny. Proc. Natl. Acad. Sci. USA 93, 7749^7754. Bocchetta, M., Gribaldo, S., Sanangelantoni, A. and Cammarano, P. (2000) Phylogenetic depth of the bacterial genera Aquifex and Thermotoga inferred from analysis of ribosomal protein, elongation factor, and RNA polymerase subunit sequences. J. Mol. Evol. 50, 366^380. Kawarabayasi, Y., Hino, Y., Horikawa, H., Jin-no, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A., Kosugi, H., Hosoyama, A., Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi, A., Aoki, K., Masuda, S. and Yanagii, M. (2001) Complete genome sequence of an aerobic thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain7. DNA Res. 8, 123^140. Auer, J., Spicker, G., Mayerhofer, L., Puehler, G. and Boeck, A. (1990) Organisation and nucleotide sequence of a gene cluster comprising the translation elongation factor 1alpha from the extreme thermophilic archaebacterium Sulfolobus acidocaldarius : Phylogenetic implications. Syst. Appl. Microbiol. 14, 14^22. Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J., Manilo¡, J., Dyer, T.A., Wolfe, R.S., Balch, W.E., Tanner, R.S., Magrum, L.J., Zablen, L.B., Blakemore, R., Gupta, R., Bonen, L., Lewis, B.J., Stahl, D.A., Luehrsen, K.R., Chen, K.N. and Woese, C.R. (1980) The phylogeny of prokaryotes. Science 209, 457^463. Arcari, P., Dello Russo, A., Ianniciello, G., Gallo, M. and Bocchini, V. (1993) Nucleotide sequence and molecular evolution of the gene coding for glyceraldehyde-3-phosphate dehydrogenase in the thermoacidophilic archaebacterium Sulfolobus solfataricus. Biochem. Genet. 31, 241^251. Li, W.H., Gojobori, T. and Nei, M. (1981) Pseudogenes as a paradigm of neutral evolution. Nature 292, 237^239. Li, W.H., Wu, C.I. and Luo, C.C. (1985) A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Mol. Biol. Evol. 2, 150^174. Grogan, D.W., Carver, G.T. and Drake, J.W. (2001) Genetic ¢delity under harsh conditions: Analysis of spontaneous mutation in the thermoacidophilic archaeon Sulfolobus acidocaldarius. Proc. Natl. Acad. Sci. USA 98, 7928^7933. Wilson, A.C., Ochman, H. and Prager, E.M. (1987) Molecular time scale for evolution. Trends Genet. 3, 241^246. Cannio, R., Fiorentino, G., Carpinelli, P., Rossi, M. and Bartolucci, S. (1996) Cloning and overexpression in Escherichia coli of the genes encoding NAD-dependent alcohol dehydrogenase from two Sulfolobus species. J. Bacteriol. 178, 301^305.
Cyaan Magenta Geel Zwart
www.fems-microbiology.org
Cloning, expression and evolution of the gene encoding the elongation factor 1K from a low thermophilic Sulfolobus solfataricus strain Mariorosario Masullo a;b , Piergiuseppe Cantiello b , Annalisa Lamberti Olimpia Longo b , Antonio Fiengo b;c , Paolo Arcari b;c; a
b;c
,
Dipartimento di Scienze Farmacobiologiche, Universita' di Catanzaro ‘Magna Graecia’, Roccelletta di Borgia, 88021 Catanzaro, Italy b Dipartimento di Biochimica e Biotecnologie Mediche, Universita' di Napoli Federico II, via S. Pansini 5, 80131 Napoli, Italy c CEINGE Biotecnologie Avanzate Scarl, via S. Pansini 5, 80131 Napoli, Italy Received 29 July 2002; received in revised form 15 November 2002; accepted 18 November 2002 First published online 27 December 2002
Abstract The gene encoding the elongation factor 1K (EF-1K) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75‡C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1K isolated from S. solfataricus strain MT4 (optimum growth temperature 87‡C). Only one amino acid change (Val15CIle) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G13 HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1K genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312U1039 ) is lower than that reported for other functional genes. ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Elongation factor; Protein synthesis ; Archaea; Molecular evolution; Sulfolobus solfataricus
1. Introduction The genus Sulfolobus belongs to the branch of archaebacteria characterised by extremely thermophilic, nonmethanogenic anaerobes. The most studied species of this sulfur-dependent branch are Sulfolobus solfataricus and Sulfolobus acidocaldarius, both growing at high temperature (80^87‡C) and low pH [1,2]. Several of these species have been phenotypically characterised and one possible criterion to distinguish among them is the di¡erence in the growth rates under controlled condition of temperature and medium composition [3]. Under this aspect, two S. solfataricus strains (MT3 and MT4) have been isolated from a solphataric area near Naples, Italy [4]. MT4 grows
* Corresponding author. Tel. : +39 (081) 7463120; Fax : +39 (081) 7463653. E-mail address : [email protected] (P. Arcari).
in the range of 63^89‡C (optimum growth temperature 87‡C, pH 3.0) whereas the MT3 strain is less thermophilic because it grows, at the same pH, in the range 50^80‡C (optimum growth temperature 75‡C) but it does not grow at 87‡C. Moreover, the MT3 strain showed a slightly higher GC content (42%) with respect to the MT4 strain (39%) [4]. Therefore, these two di¡erent archaeal strains appear to be suitable for comparative studies related to evolution and structure^function relationship in proteins. We have previously reported the puri¢cation and characterisation of the translational elongation factor 1K (EF1K) from the archaeon S. solfataricus, strain MT4 (SsMT4EF-1K) (ATCC 49255) [5] together with the cloning and the structural organisation of its encoding gene [6,7]. Because EF-1K is present in all the living organisms, it was of interest to analyse the molecular properties of the enzyme from the MT3 strain (SsMT3EF-1K) and to compare them with those of the MT4 enzyme. The analysis of its molecular and biochemical properties showed that a
0378-1097 / 02 / $22.00 ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1097(02)01178-3
FEMSLE 10797 23-1-03
Cyaan Magenta Geel Zwart
286
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
single amino acid di¡erence between the MT enzymes was responsible for di¡erent biochemical properties whereas, despite the di¡erent optimal growth temperature of the two microorganisms, the two enzymes displayed similar thermal behaviour.
2. Materials and methods 2.1. Plasmid construction, expression and puri¢cation of SsMT3EF-1K S. solfataricus (strain MT3) genomic DNA was used as template in order to synthesise by polymerase chain reaction (PCR) a DNA fragment containing the EF-1K gene. The forward primer, GAAGAGATAGAAAGAATAGC, corresponded to the C-terminal region of the S. solfataricus DNA (strain MT4) rbpS7 gene (amino acid residues E183 EIERIA) whereas the reverse primer ATTCTAGCTTTTGTAGGCAT, corresponded to the N-terminal region of the rbpS10 gene (segment M1 PTKARI). Both genes £ank in S. solfataricus the MT4 EF-1K gene [7]. The PCR product (1426 bp) was cloned in pGEM-3Z plasmid and sequenced. The pGEM-3Z plasmid containing the gene encoding SsMT3EF-1K was used as template with two primers ATGTCTCAAAAGCCTCA, corresponding to the sequence M1 SQKPH of the sequenced SsMT3EF-1K and CTAGCTTTTGTAGGCAT, corresponding to the segment M1 PTKAR of rbpS10 (see above). The PCR fragment obtained was cloned into the NdeI site (¢lled) of pET22 expression vector and the recombinant SsMT3EF-1K was obtained following the procedure already reported for SsMT4EF-1K [8]. 2.2. Biochemical assays Poly(U)-directed poly(Phe) synthesis, isolation of total tRNA, ribosome and phenylalanyl-tRNA synthetase (SsFRS) from S. solfataricus MT4 were performed as reported previously [9]. The preparation of Phe-EctRNAPhe , the formation of the ternary complex SsEF-1KW[Q-32 P]GTPWPhe-EctRNAPhe , and the protection against spontaneous deacylation of [3 H]Phe-EctRNAPhe were carried out as described previously [9]. The ability of SsMT3EF-1K to form a binary complex with [3 H]GDP was tested as described previously [5]. The intrinsic GTPase activity of SsMT3EF-1K was measured in the presence of 3.6 M NaCl (GTPaseNa ) [9]. Unless otherwise indicated the reaction mixture contained 0.1^0.3 WM SsMT3EF-1K and 50 WM [Q-32 P]GTP (speci¢c activity 150^300 cpm pmol31 ). The reaction was followed kinetically up to 30 min at 60‡C; the amount of 32 Pi released, the catalytic constant of GTPaseNa , the a⁄nity for [Q-32 P]GTP and the inhibition constants by GDP of GTPaseNa were determined as reported previously [10].
FEMSLE 10797 23-1-03
2.3. Thermophilicity and heat stability The thermophilicity of SsMT3EF-1K was checked by measuring the GTPaseNa in the temperature range of 40^91‡C. At each temperature the reaction was followed kinetically; at time intervals depending on the temperature, 40 Wl aliquots were withdrawn and analysed for the 32 Pi released [9]. The initial rate of the hydrolytic reaction was calculated from the linear part of each kinetics and the data were treated according to the Arrhenius equation; the energetic parameters of activation were calculated as reported [10]. Heat inactivation of SsMT3EF-1K was evaluated by incubating 4 WM protein in bu¡er A for 10 min at selected temperatures in the interval of 70^102‡C. 25 Wl aliquots were cooled on ice for 30 min and then analysed for their [3 H]GDP binding ability. 2.4. Sequence divergence calculation Sequence divergence was calculated by evaluating the proportion (p) of nucleotide substitutions according to Gojobory and Yokoyama [11] (p = number of base substitutions/total bases). The rate of nucleotide substitutions per site per year (a) was calculated according to the equation a = d/2Td , where d is the number of nucleotide substitutions corrected for multiple events according to the equation d = 3(3/4)ln[13(4/3)p] [12] and Td is the divergence time expressed in million years. 2.5. Molecular modelling The three-dimensional (3D) structure of SsMT4EF-1K in complex with GDP from S. solfataricus [13] (PDB entry 1JNY) from strain MT4 was used as template to predict the e¡ect of the Val15CIle amino acid di¡erence observed in SsMT3EF-1K by using the SwissPDB viewer software [14].
3. Results and discussion 3.1. Cloning and expression of the SsMT3EF-1K gene The alignment of the nucleotide sequence of the SsMT3EF-1K gene (EMBL accession number AJ312397) with the corresponding sequence of the gene isolated from MT4 strain [6] showed the presence of three base substitutions, namely G43 CA, G720 CC and C954 CT as numbered from the start codon (not shown). The G43 CA change led to a di¡erent amino acid residue (Ile15 instead of Val15 in SsMT4EF-1K) whereas the other base di¡erences led to synonymous codons. The 5P untranslated region contained a potential Shine^Dalgarno sequence (positions 39 to 313) and a putative archaeal promoter (positions 33 to 37 and 335 to 343) [15], respectively
Cyaan Magenta Geel Zwart
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
2
1
0
0.75
on the structural and biochemical properties of SsMT3EF1K. For this purpose, the SsMT3EF-1K gene was cloned into pET22 expression vector and the recombinant enzyme was produced and puri¢ed [8].
0.50
3.2. Properties of SsMT3EF-1K and comparison with SsMT4EF-1K
0.25
0.00 0
0.3 0.6 0.9 α] µM [SsEF-1α
-15
0
15
30 α] (µM-1) 1/[SsEF-1α
Fig. 1. Poly(U)-directed poly(Phe) synthesis promoted by SsMT3EF-1K and SsMT4EF-1K. A: E¡ect of increasing concentration of SsMT3EF1K (a) and SsMT4EF-1K (b). 250 Wl of the reaction mixtures contained 0.1 WM SsEF-2, 1.5 Wg SsFRS, 27.4 Wg total tRNA, 0.2 WM ribosome, 2.4 WM [3 H]Phe (speci¢c activity 418 cpm pmol31 ). The reaction was allowed to proceed at 75‡C and at selected time intervals, 50 Wl aliquots were withdrawn, chilled on ice and then analysed for the amount of [3 H]Phe polymerised. The initial reaction rate, v, was reported. B: Lineweaver^Burk plots of the data reported in A.
as numbered from the start codon, and a transcription termination signal in the 3P £anking region (positions 1317^1323). Northern blot analysis of total RNA from strain MT3 (not shown) showed the presence of a strong major transcript of about 1300 nucleotides that hybridised to the SsEF-1K gene. The size of the transcript was in agreement with the presence of the promoter and the termination signals found in the £anking regions the SsMT3EF-1K gene. In the case of RNA isolated from the MT4 strain, the size of the major transcript was higher (1700 nucleotides) and indicated that the SsMT4EF-1K gene was cotranscribed with the S10 ribosomal protein gene [7]. In the amino acid sequence of SsMT3EF-1K the di¡erence with SsMT4EF-1K was in the ¢rst sequence motif involved in the binding of GTP and GDP [16], G13 HIDHGK. The identical amino acid change was found in the translated sequence of the EF-1K gene from S. solfataricus P2 strain although in this case also other amino acid di¡erences were present [17]. In the framework of a research programme on SsMT4EF-1K mutants, we have recently analysed by site-directed mutagenesis the functional role of Gly13 in the same region of SsEF-1K, G13 HVDHGK (Gly18, in EcEF-Tu). The overall results suggested that the G13A substitution a¡ected mainly the biochemical properties of the enzyme whereas its thermostability remained practically unaltered [9]. Therefore, it was of interest to analyse the e¡ects of the Ile15 presence
FEMSLE 10797 23-1-03
Under either native (gel ¢ltration) or denaturing (sodium dodecyl sulphate^polyacrylamide gel electrophoresis (SDS^PAGE)) conditions puri¢ed SsMT3EF-1K showed the same Mr as SsMT4EF-1K. The maximum rate of poly[3 H]Phe synthesis catalysed by SsMT3EF-1K was almost identical to that elicited by SsMT4EF-1K (Fig. 1A); however, the concentration of SsMT3EF-1K required to get half maximum activity (Kact ) was about 3.5-fold higher than that required by SsMT4EF-1K (0.207 and 0.058 WM, respectively) (Fig. 1B). This ¢nding could be ascribed to a lower ability of SsMT3EF-1K to bind aa-tRNA. In fact, compared to SsMT4EF-1K, SsMT3EF-1K in complex with either GppNHp (Fig. 2A) or GDP (Fig. 2B) was less e⁄cient to protect [3 H]Phe-EctRNAPhe from its spontaneous deacylation. However, as already reported for SsMT4EF1K [11], the e⁄ciency in the protection assay of SsMT3EF-1K complexed with GppNHp was about one
[3H]Phe-EctRNAphe bound (pmol)
1/v (min•pmol-1)
v (pmol•min-1)
3
287
2.8
0.28
A
2.1
0.21
1.4
0.14
0.7
0.07
0
0 0
25
50
75
B
0
25
50
75
α added (pmol) SsEF-1α Fig. 2. Protection against spontaneous deacylation of [3 H]PheEctRNAPhe by SsMT4EF-1K or SsMT3EF-1K. 30 Wl of reaction mixture containing 25 mM Tris^HCl bu¡er, pH 7.8, 10 mM NH4 Cl, 10 mM DTT, 20 mM magnesium acetate and 3.1 pmol of [3 H]Phe-EctRNAPhe (speci¢c activity 2065 cpm pmol31 ) were pre-incubated for 1 h at 0‡C to allow ternary complex formation in the presence of the indicated amount of SsMT4EF-1K (b) or SsMT3EF-1K (a) in complex with GppNHp (A) or GDP (B). The deacylation reaction was carried out for 1 h at 50‡C and the residual [3 H]Phe-EctRNAPhe was determined as reported in Section 2.
Cyaan Magenta Geel Zwart
288
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
tively). As already found for SsMT4EF-1K, the GTPaseNa of SsMT3EF-1K was competitively inhibited by GDP but with an e⁄ciency higher compared to SsMT4EF-1K, thus con¢rming the higher a⁄nity for GDP elicited by SsMT3EF-1K (not shown).
B
A 100
75 GTPaseNa (%)
50
25
75 3.3. E¡ect of heat and temperature on SsMT3EF-1K
50 1000/T (K-1) 2.8
25
2.9
3.0
-3 ln k
Residual [3H]GDP binding (%)
100
-4
0
-5
0 70
80
90
100
60 70 80 90 100
Temperature (°C) Fig. 3. Thermal properties of SsMT3EF-1K and SsMT4EF-1K. Heat inactivation (A) and thermophilicity (B) of SsMT3EF-1K (a) and SsMT4EF-1K (b). B, inset: Arrhenius analysis of the data in the range 60^87‡C.
order of magnitude higher than that observed when it was complexed with GDP. Concerning the ability to form binary complex with guanine nucleotides, we found that compared to that of SsMT4EF-1K, the a⁄nity for both GDP and GTP of SsMT3EF-1K was about 2- and 1.25-fold higher, being the Kd values equal to 0.8 and 28 WM, respectively. SsMT3EF-1K was able to hydrolyse GTP in the presence of NaCl at molar concentration [10]. Compared to SsMT4EF-1K, the Km for GTP decreased by 3-fold (2.7 and 0.9 WM, respectively) whereas the kcat of the reaction resulted practically the same (0.8 and 0.9 min31 , respectively); as a consequence, the catalytic e⁄ciency of the GTPaseNa of SsMT3EF-1K resulted 3.3-fold higher compared to SsMT4EF-1K (1.0 and 0.3 min31 WM31 , respec-
Concerning the heat stability of SsMT3EF-1K, the I15V amino acid di¡erence caused almost no impairment of the thermostability of the enzyme compared to that of SsMT4EF-1K (Fig. 3A). In fact, although the denaturation pro¢les were slightly di¡erent in the temperature range 80^93‡C, the half inactivation temperatures (93 and 94‡C for SsMT3EF-1K and SsMT4EF-1K, respectively) were almost identical. Regarding the thermophilicity, SsMT3EF-1K showed the highest GTPase activity at 87‡C (Fig. 3B), a temperature 4‡C lower than that displayed by SsMT4EF-1K. The analysis of the rising part of the curves according to the Arrhenius equation (Fig. 3B, inset) showed that the activation energy of the GTPaseNa of SsMT3EF-1K was slightly lower than that displayed by SsMT4EF-1K (57.7 and 67.3 kJ mol31 , respectively). As a consequence, the energetic parameters of activation calculated at 60‡C showed that the free energy of activation of the reaction resulted almost identical for both enzymes (93.6 and 94.4 kJ mol31 , respectively) whereas, the entropy of activation was lower (3116 and 390 J mol31 K31 , respectively) thus indicating that the activated state of the hydrolytic reaction was entropically less favoured. 3.4. Molecular modelling of SsMT3EF-1K To explain at the structural level the di¡erences observed in the properties between SsMT3EF-1K and SsMT4EF-1K, a molecular model was constructed on the basis of the 3D structure of SsMT4EF-1K in complex
Fig. 4. Three-dimensional structure of SsEF-1KWGDP in the P-loop region. A: Location of Val15 in the SsMT4EF-1K structure (PDB entry 1JNY). B: Modelling of the same region following Val15CIle replacement. Models were visualised by using the RasMol software.
FEMSLE 10797 23-1-03
Cyaan Magenta Geel Zwart
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
289
Table 1 Rates of nucleotide substitutions per site per year among Sulfolobus EF-1K genesa EF-1K sequences compared
d1 (U1033 )
d2 (U1033 )
d3 (U1033 )
dall b (U1033 ) Rate of nucleotide substitutions (U1039 )
Identity (%)
SsMT3/SsMT4 SsMT3/SsP2 SsMT3/St SsMT3/Sa SsMT4/SsP2 SsMT4/St SsMT4/Sa SsP2/St SsP2/Sa Sa/St Average
0.76 7.0 36.0 45.7 7.7 34.4 44.0 39.2 44.0 34.4 ^
^
1.5 63.0 156.7 188.5 64.6 157.7 186.5 158.6 191.4 178.7 ^
2.3 72.1 233.0 284.8 7.5 233.0 282.6 237.2 287.0 238.2 187.7
99.7 93.1 79.9 76.3 92.9 79.9 76.4 79.6 76.0 79.5 ^
a b
1.5 24.0 26.4 1.5 24.9 28.0 22.5 27.2 11.5 ^
0.0004 0.0120 0.0388 0.0474 0.0012 0.0388 0.0471 0.0395 0.0478 0.0397 0.0312
See text for references. d1 , d2 , d3 , dall are the divergences at the ¢rst, second, third and all codon positions, respectively (see Section 2 for details).
with GDP [13]. V15 is not directly involved in the binding of GDP, therefore, as reported in Fig. 4, the V15I change reveals that the Ile side chain appeared to a¡ect neither the P-loop region nor the K-helix containing the GDP binding consensus elements. However, because of di¡erent side chain of I15 (Fig. 4B) with respect to V15 (Fig. 4A), a local rearrangement of the protein structure in the P-loop region might have occurred which increased its £exibility thus making the SsMT3EF-1K more able to bind guanine nucleotides and to hydrolyse GTP. 3.5. Molecular evolution of Sulfolobus EF-1K genes Elongation factor 1K (EF-Tu in eubacteria) sequences have been used as a molecular tool for phylogenetic relationships among extant life forms [18^20]. In order to estimate the molecular evolution at the gene level in Crenarchaeota, we have calculated the divergence in all codon positions among the nucleotide sequence of ¢ve EF-1K genes from the di¡erent Sulfolobus species known so far, namely S. solfataricus MT3 (SsMT3) (this work), S. solfataricus MT4 (SsMT4) [6], S. solfataricus strain P2 (SsP2) [17], Sulfolobus tokadaii strain 7 (St7) [21], S. acidocaldarius (Sa) [22]. The results reported in Table 1 showed that the average rate of nucleotide substitution per site per year for all codon positions was 0.0312U1039 . The separation time within archaea has been estimated as about 3U103 million years [23]. This rate is consistent with that found for other archaeal genes [24] but is about one order of magnitude lower than those found for eukaryotic functional genes [25,26]. A similar value of 3.17U1037 was observed in S. acidocaldarius in the evaluation of spontaneous mutations per cell division that conferred 5-£uoroorotic acid resistance [27]. The mutation rate found among EF-1K genes could be either underestimated or overestimated depending on the value of the divergence time used. In fact, the rate of nucleotide substitutions appears to be fairly steady for a period of time no longer than 100 million years [28]. However, a possible explanation for the modest mutational rate among hyperthermo-
FEMSLE 10797 23-1-03
philic archaea is the need to enforce their genetic ¢delity under harsh environmental condition through a not yet identi¢ed mechanism [27]. In conclusion, the di¡erences observed at the gene level in SsMT3EF-1K with respect to SsMT4SsEF-1K could be the result of mutations which have occurred in the adaptation of the MT species at the di¡erent growth temperatures. This ¢nding is in agreement with the di¡erent base content between the two genomes. As far as we know, no other example of enzyme isolated from these two S. solfataricus strains has been reported. However, the gene encoding alcohol dehydrogenase from S. solfataricus DSM 1617 (growth temperature range 78^87‡C) and the less thermophilic Sulfolobus sp. strain RC3 (optimum growth at 75‡C) have been isolated and expressed in Escherichia coli. Even in this case only few amino acid replacements were responsible for the di¡erent features of the two enzymes [29]. In the case of SsMT3EF-1K, the non-synonymous mutation occurred in a speci¢c region of the enzyme important for its catalytic properties but not involved in its thermostability. The slower rate in protein synthesis of SsMT3EF-1K with respect to SsMT4SsEF-1K could somehow account for the slightly higher doubling time of the MT3 strain with respect to the MT4 [4].
Acknowledgements We gratefully acknowledge Prof. A. Gambacorta for supplying S. solfataricus MT4 and MT3 cells. This work was supported by CNR, PRIN 2001 (Rome) and the European Community Biotechnology Program, Contract BIO4-CT97-2188. References [1] Brock, T.D., Brock, K.M., Belly, R.T. and Weiss, R.L. (1972) Sulfolobus: a new genus of sulfur-oxidizing bacteria living at low pH and high temperature. Arch. Microbiol. 84, 54^68.
Cyaan Magenta Geel Zwart
290
M. Masullo et al. / FEMS Microbiology Letters 218 (2003) 285^290
[2] Zillig, W., Stetter, K.O., Wunderl, S., Schulz, W. and Gierl, A. (1980) The Sulfolobus ‘Caldariella’ group: taxonomy on the basis of the structure of DNA-dependent RNA polymerases. Arch. Microbiol. 125, 259^269. [3] Grogan, D.W. (1989) Phenotypic characterization of the archaebacterial genus Sulfolobus: comparison of ¢ve wild-type strains. J. Bacteriol. 171, 6710^6719. [4] De Rosa, M., Gambacorta, A. and Bu’Lock, J.D. (1975) Extremely thermophilic acidophilic bacteria convergent with Sulfolobus acidocaldarius. J. Gen. Microbiol. 86, 156^164. [5] Masullo, M., Raimo, G., Parente, A., Gambacorta, A., De Rosa, A. and Bocchini, B. (1991) Properties of the elongation factor 1 alpha in the thermoacidophilic archaebacterium Sulfolobus solfataricus. Eur. J. Biochem. 199, 529^537. [6] Arcari, P., Gallo, M., Ianniciello, G., Dello Russo, A. and Bocchini, V. (1994) The nucleotide sequence of the gene encoding the elongation factor 1a in Sulfolobus solfataricus. Homology of the product with related proteins. Biochim. Biophys. Acta 1217, 333^337. [7] Ianniciello, G., Gallo, M., Arcari, P. and Bocchini, V. (1994) Organization of a Sulfolobus solfataricus gene cluster homologous to the Escherichia coli str operon. Biochem. Mol. Biol. Int. 33, 927^937. [8] Ianniciello, G., Masullo, M., Gallo, M., Arcari, P. and Bocchini, V. (1996) Expression in Escherichia coli of thermostable elongation factor 1 alpha from the archaeon Sulfolobus solfataricus. Biotech. Appl. Biochem. 23, 41^45. [9] Masullo, M., Cantiello, P., de Paola, B., Catanzano, F., Arcari, P. and Bocchini, V. (2002) G13A substitution a¡ects the biochemical and physical properties of the elongation factor 1 alpha. A reduced intrinsic GTPase activity is partially restored by kirromycin. Biochemistry 41, 628^633. [10] Masullo, M., De Vendittis, E. and Bocchini, V. (1994) Archaebacterial elongation factor 1 alpha carries the catalytic site for GTP hydrolysis. J. Biol. Chem. 269, 20376^20379. [11] Gojobori, T. and Yokoyama, S. (1985) Rates of evolution of the retroviral oncogene of Moloney murine sarcoma virus and its cellular homologues. Proc. Natl. Acad. Sci. USA 82, 4198^4203. [12] Hori, H. and Osawa, S. (1979) Evolutionary change in 5S RNA secondary structure and a phylogenetic tree of 54 5S RNA species. Proc. Natl. Acad. Sci. USA 76, 381^387. [13] Vitagliano, L., Masullo, M., Sica, F., Zagari, A. and Bocchini, V. (2001) The crystal structure of Sulfolobus solfataricus elongation factor 1 alpha in complex with GDP reveals novel features in nucleotide binding and exchange. EMBO J. 20, 5305^5311. [14] Guex, N. and Peitsch, M.C. (1997) SWISS-MODEL and the SwissPdbViewer : an environment for comparative protein modelling. Electrophoresis 18, 2714^2723. [15] Thomm, M. and Wich, G. (1988) An archaebacterial promoter element for stable RNA genes with homology to the TATA box of higher eukaryotes. Nucleic Acids Res. 16, 151^163. [16] Dever, T.E., Glynias, M.J. and Merrick, W.C. (1987) GTP-binding domain : three consensus sequence elements with distinct spacing. Proc. Natl. Acad. Sci. USA 84, 1814^1818. [17] She, Q., Singh, R.K., Confalonieri, F., Zivanovic, Y., Allard, G., Awayez, M.J., Chan-Weiher, C.C., Clausen, I.G., Curtis, B.A., De Moors, A., Erauso, G., Fletcher, C., Gordon, P.M., Heikamp-de Jong, I., Je¡ries, A.C., Kozera, C.J., Medina, N., Peng, X., Thi-
FEMSLE 10797 23-1-03
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25] [26]
[27]
[28] [29]
Ngoc, H.P., Redder, P., Schenk, M.E., Theriault, C., Tolstrup, N., Charlebois, R.L., Doolittle, W.F., Duguet, M., Gaasterland, T., Garrett, R.A., Ragan, M.A., Sensen, C.W. and Van der Oost, J. (2001) The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc. Natl. Acad. Sci. USA 98, 7835^7840. Creti, R., Ceccarelli, E., Bocchetta, M., Sanangelantoni, A.M., Tiboni, O., Palm, P. and Cammarano, P. (1994) Evolution of translational elongation factor (EF) sequences : Reliability of global phylogenies inferred from EF-1K(Tu) and EF-2(G) proteins. Proc. Natl. Acad. Sci. USA 91, 3255^3259. Baldauf, S.L., Palmer, J.D. and Ford Doolittle, W. (1996) The root of the universal tree and the origin of eukaryotes based on elongation factor phylogeny. Proc. Natl. Acad. Sci. USA 93, 7749^7754. Bocchetta, M., Gribaldo, S., Sanangelantoni, A. and Cammarano, P. (2000) Phylogenetic depth of the bacterial genera Aquifex and Thermotoga inferred from analysis of ribosomal protein, elongation factor, and RNA polymerase subunit sequences. J. Mol. Evol. 50, 366^380. Kawarabayasi, Y., Hino, Y., Horikawa, H., Jin-no, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A., Kosugi, H., Hosoyama, A., Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi, A., Aoki, K., Masuda, S. and Yanagii, M. (2001) Complete genome sequence of an aerobic thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain7. DNA Res. 8, 123^140. Auer, J., Spicker, G., Mayerhofer, L., Puehler, G. and Boeck, A. (1990) Organisation and nucleotide sequence of a gene cluster comprising the translation elongation factor 1alpha from the extreme thermophilic archaebacterium Sulfolobus acidocaldarius : Phylogenetic implications. Syst. Appl. Microbiol. 14, 14^22. Fox, G.E., Stackebrandt, E., Hespell, R.B., Gibson, J., Manilo¡, J., Dyer, T.A., Wolfe, R.S., Balch, W.E., Tanner, R.S., Magrum, L.J., Zablen, L.B., Blakemore, R., Gupta, R., Bonen, L., Lewis, B.J., Stahl, D.A., Luehrsen, K.R., Chen, K.N. and Woese, C.R. (1980) The phylogeny of prokaryotes. Science 209, 457^463. Arcari, P., Dello Russo, A., Ianniciello, G., Gallo, M. and Bocchini, V. (1993) Nucleotide sequence and molecular evolution of the gene coding for glyceraldehyde-3-phosphate dehydrogenase in the thermoacidophilic archaebacterium Sulfolobus solfataricus. Biochem. Genet. 31, 241^251. Li, W.H., Gojobori, T. and Nei, M. (1981) Pseudogenes as a paradigm of neutral evolution. Nature 292, 237^239. Li, W.H., Wu, C.I. and Luo, C.C. (1985) A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Mol. Biol. Evol. 2, 150^174. Grogan, D.W., Carver, G.T. and Drake, J.W. (2001) Genetic ¢delity under harsh conditions: Analysis of spontaneous mutation in the thermoacidophilic archaeon Sulfolobus acidocaldarius. Proc. Natl. Acad. Sci. USA 98, 7928^7933. Wilson, A.C., Ochman, H. and Prager, E.M. (1987) Molecular time scale for evolution. Trends Genet. 3, 241^246. Cannio, R., Fiorentino, G., Carpinelli, P., Rossi, M. and Bartolucci, S. (1996) Cloning and overexpression in Escherichia coli of the genes encoding NAD-dependent alcohol dehydrogenase from two Sulfolobus species. J. Bacteriol. 178, 301^305.
Cyaan Magenta Geel Zwart